DUF2283 structural domain-containing protein mutant and application thereof

Abstract

The invention relates to the technical field of bioengineering, in particular to a protein mutant containing a DUF2283 structural domain and application of the protein mutant. Compared with a wild type DUF2283 structural domain-containing protein of corynebacterium glutamicum, the protein mutant containing the DUF2283 structural domain, provided by the invention, contains mutation of which the 6th aspartic acid is mutated into amino acids except the aspartic acid. The mutant can significantly improve the lysine synthesis efficiency of the strain, and further significantly improve the lysine yield and / or saccharic acid conversion rate of the strain. The mutant can be used for construction and screening of lysine or lysine derivative production strains, is beneficial to improvement of lysine yield and saccharic acid conversion rate of the lysine production strains, and has important significance in improvement of fermentation production performance of the strains and reduction of production cost.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to a DUF2283 domain-containing protein mutant and application thereof. Background Art

[0002] As an essential amino acid, L-lysine is widely used in food processing, medicine and feed additives. About 90% of L-lysine is used in the feed industry, and 10% is used in the food and pharmaceutical industries. As an animal feed additive, L-lysine can help the animal body absorb other amino acids, thereby improving the quality of feed. Therefore, it is of great significance to increase the production of lysine.

[0003] The method for producing L-Lysine includes protein decomposition, chemical method, enzyme method and microbial fermentation method. At present, L-Lysine is mainly industrialized by microbial fermentation method, wherein Corynebacterium glutamicum is the most commonly used L-Lysine production bacterium, which has the characteristics of fast growth rate, non-pathogenicity, weak ability to degrade self metabolites, and is widely used in the production of various amino acids, nucleotides and organic acids. The synthesis of L-Lysine by Corynebacterium glutamicum starts from L-aspartic acid, and obtains L-Lysine through multi-step enzyme catalysis reaction. The yield of L-Lysine is related to the enzyme activity in the biosynthetic pathway and the distribution of metabolic flow. By enhancing the enzyme activity of the terminal synthesis pathway or changing the central metabolic flow direction, and increasing the supply of reducing power, the L-Lysine production of Corynebacterium glutamicum can be promoted to improve. In order to further promote the L-Lysine production of Corynebacterium glutamicum, it is still necessary to develop new proteins and coding genes thereof that can promote the production of L-Lysine. Summary of the invention

[0004] The invention provides a DUF2283 domain-containing protein mutant and application thereof.

[0005] Specifically, the present invention provides the following technical solutions:

[0006] In a first aspect, the present invention provides a DUF2283 domain-containing protein mutant, wherein, compared with a wild-type DUF2283 domain-containing protein of Corynebacterium glutamicum, the mutant contains a mutation in which aspartic acid at position 6 is mutated to an amino acid other than aspartic acid.

[0007] The above-mentioned amino acids other than aspartic acid include, but are not limited to, alanine, arginine or lysine.

[0008] Preferably, the mutant contains a mutation in which aspartic acid at position 6 is mutated to alanine, arginine or lysine compared to the wild-type DUF2283 domain-containing protein of Corynebacterium glutamicum.

[0009] Further preferably, the mutation of the mutant compared to the wild-type DUF2283 domain-containing protein of Corynebacterium glutamicum is that the aspartic acid at position 6 is mutated to alanine, arginine or lysine.

[0010] The NCBI reference sequence number of the wild-type DUF2283 domain-containing protein of Corynebacterium glutamicum of the present invention is NCgl1286, and its amino acid sequence is shown in SEQ ID NO. 4. The nucleotide sequence of the encoding gene is shown in SEQ ID NO.8.

[0011] Preferably, the amino acid sequence of the DUF2283 domain-containing protein mutant is shown in any one of SEQ ID NOs. 1 to 3.

[0012] The DUF2283 domain-containing protein mutant provided by the present invention can significantly improve the lysine production and sugar-acid conversion rate of microorganisms (especially bacteria of the genus Corynebacterium).

[0013] In a second aspect, the present invention provides a nucleic acid molecule encoding the above-mentioned DUF2283 domain-containing protein mutant.

[0014] According to the amino acid sequence and codon rules of the DUF2283 domain-containing protein mutant provided above, a person skilled in the art can obtain the nucleotide sequence of a nucleic acid molecule encoding the DUF2283 domain-containing protein mutant.

[0015] In some embodiments of the present invention, the nucleotide sequence of the nucleic acid molecule encoding the above-mentioned DUF2283 domain-containing protein mutant is shown in any one of SEQ ID NOs. 5-7.

[0016] In a third aspect, the present invention provides a biological material comprising the above-mentioned nucleic acid molecule, or expressing the above-mentioned DUF2283 domain-containing protein mutant.

[0017] The biological materials mentioned above include expression cassettes, vectors or host cells.

[0018] Wherein, the expression cassette is a recombinant nucleic acid molecule obtained by operably linking the nucleic acid molecule with a transcription and / or translation regulatory element.

[0019] The vector includes but is not limited to a plasmid vector, a viral vector, and a transposon.

[0020] The host cell is any cell capable of carrying the nucleic acid molecule or expressing the DUF2283 domain-containing protein mutant, including microbial cells, preferably bacteria of the genus Corynebacterium, Enterobacteriaceae or Bacillus.

[0021] In a fourth aspect, the present invention provides any of the following uses of the above-mentioned DUF2283 domain-containing protein mutant, the nucleic acid molecule, or the biomaterial:

[0022] (1) Application in the production of lysine or its derivatives;

[0023] (2) Application in constructing a microorganism for producing lysine or its derivatives;

[0024] (3) Application in screening or identifying high-lysine-producing microorganisms.

[0025] The present invention also provides the use of the above-mentioned DUF2283 domain-containing protein mutant or the nucleic acid molecule or the biological material in improving the lysine production capacity of microorganisms.

[0026] The above-mentioned improvement in productivity can be manifested as an increase in the yield of lysine and / or the sugar-acid conversion rate.

[0027] In the above application, the microorganism is a bacterium of the genus Corynebacterium, a bacterium of the family Enterobacteriaceae or a bacterium of the genus Bacillus.

[0028] Preferably, the Corynebacterium bacterium is Corynebacterium glutamicum, the Enterobacteriaceae bacterium is Escherichia coli, and the Bacillus bacterium is Bacillus subtilis.

[0029] In a fifth aspect, the present invention provides a modified microorganism, wherein the modified microorganism expresses the above-mentioned DUF2283 domain-containing protein mutant, and / or the modified microorganism contains the above-mentioned nucleic acid molecule.

[0030] Specifically, the modified microorganism is modified so that it expresses the above-mentioned DUF2283 domain-containing protein mutant, and / or contains the above-mentioned nucleic acid molecule.

[0031] Preferably, the modified microorganism does not express the original DUF2283 domain-containing protein before its modification.

[0032] Preferably, the chromosomal in situ DUF2283 domain protein gene of the modified microorganism is mutated into a gene encoding the above-mentioned DUF2283 domain protein mutant.

[0033] Preferably, the microorganism is a bacterium of the genus Corynebacterium, a bacterium of the family Enterobacteriaceae or a bacterium of the genus Bacillus.

[0034] More preferably, the Corynebacterium bacterium is Corynebacterium glutamicum, the Enterobacteriaceae bacterium is Escherichia coli, and the Bacillus bacterium is Bacillus subtilis.

[0035] For the wild-type strain of Corynebacterium glutamicum, the NCBI reference sequence number of the chromosome in situ DUF2283 domain protein gene is NCgl1286, and its amino acid sequence is shown in SEQ ID NO. 4. The nucleotide sequence of the encoding gene is shown in SEQ ID NO. 8. Those skilled in the art can determine the homologous genes of NCgl1286 in other microorganisms by sequence similarity analysis.

[0036] In some embodiments of the present invention, a modified Corynebacterium glutamicum is provided, wherein the modified Corynebacterium glutamicum is capable of expressing the DUF2283 domain-containing protein mutant. The ability of the modified Corynebacterium glutamicum to produce lysine and its lysine yield and / or sugar-acid conversion rate are significantly improved compared to before modification.

[0037] The modified microorganism can be constructed by the following method: using a microorganism capable of synthesizing lysine as a starting strain, expressing the DUF2283 domain protein mutant and not expressing its original DUF2283 domain protein, the modified microorganism is constructed.

[0038] In some embodiments of the present invention, the original DUF2283 domain-containing protein gene of the microorganism is mutated so that it encodes the DUF2283 domain-containing protein mutant, thereby obtaining the modified microorganism.

[0039] In some embodiments of the present invention, the microorganism of described modification is the wild-type microorganism that expresses the described DUF2283 domain protein mutant.Preferably also wild-type Corynebacterium glutamicum, described wild-type Corynebacterium glutamicum includes but not limited to Corynebacterium glutamicum ATCC13032 or ATCC14067.Corynebacterium glutamicum ATCC 13032 and ATCC 14067 are Corynebacterium glutamicum model strains, can buy and obtain through commercially available means, and the genome sequence of related strains has been disclosed, can be queried on the NCBI website.

[0040] In some embodiments of the present invention, the starting strain of the modified microorganism is Corynebacterium glutamicum CGMCC No.11942, which is a lysine-producing bacterium and was deposited in the General Microbiological Center of China Culture Collection Committee on December 25, 2015, at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and is classified and named as Corynebacterium glutamicum. The strain has been disclosed in patent CN105734004B.

[0041] In some embodiments of the present invention, the starting strain of the modified microorganism is Corynebacterium glutamicum CGMCC No.13407, which is a lysine-producing bacterium and was deposited in the General Microbiological Center of China Culture Collection Administration on November 30, 2016, at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and is classified and named as Corynebacterium glutamicum. The strain has been disclosed in patent application CN106635944A.

[0042] The present invention respectively uses Corynebacterium glutamicum (wild-type strain, production bacteria modified by genetic engineering) of different genetic backgrounds as the starting strain to construct the above-mentioned modified microorganism, and after verification, after the original DUF2283 domain protein encoding gene of these starting strains is replaced with the encoding gene containing DUF2283 domain protein mutant, the lysine production and sugar-acid conversion rate of the strain are significantly improved. It can be seen that the lifting effect of the lysine production capacity of the strain containing DUF2283 domain protein mutant does not depend on other genetic modifications contained by the above-mentioned strain, and these genetic modifications are only to make the strain have a certain lysine production capacity. Therefore, the lifting effect of the lysine production capacity of the Corynebacterium glutamicum containing DUF2283 domain protein mutant has universality for the starting strain that can synthesize and accumulate lysine. Thus, it can be understood by those skilled in the art that the DUF2283 domain protein mutant is introduced into other lysine-producing strains (such as other Corynebacterium glutamicum, other Corynebacterium bacteria, etc.) can effectively promote the production of lysine and / or the lifting of sugar-acid conversion rate.

[0043] In a sixth aspect, the present invention provides use of the modified microorganism described above in the production of lysine or its derivatives.

[0044] In a seventh aspect, the present invention provides a method for producing lysine or its derivatives by fermentation, the method comprising: culturing the modified microorganism described above to obtain a culture, and collecting lysine or its derivatives from the culture.

[0045] In some embodiments of the present invention, the method comprises: inoculating the modified microorganism into a seed culture medium for seed culture to obtain a seed solution, inoculating the seed solution into a fermentation culture medium for culture to obtain a fermentation solution, and separating and extracting lysine or its derivatives from the fermentation solution.

[0046] In an eighth aspect, the present invention provides a method for increasing the lysine production of a lysine-producing strain, the method comprising: modifying the lysine-producing strain so that it expresses the above-mentioned DUF2283 domain-containing protein mutant.

[0047] The beneficial effect of the present invention is that the DUF2283 domain protein mutant provided by the present invention can significantly improve the lysine synthesis efficiency of the strain, thereby significantly improving the lysine yield and / or sugar-acid conversion rate of the strain. The mutant can be used for the construction and screening of lysine or its derivative production strains, which is conducive to improving the lysine yield and sugar-acid conversion rate of the lysine production strain.

[0048] The lysine yield and sugar-acid conversion rate of the modified Corynebacterium glutamicum constructed by using the DUF2283 domain protein mutant of the present invention are significantly improved, which is of great significance for improving the fermentation production performance of the strain and reducing the production cost of lysine. DETAILED DESCRIPTION

[0049] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution in the present invention will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0050] The names and sequences of the primers involved in the following examples are shown in Table 1.

[0051] Table 1 Primer sequences

[0052] name Sequence 5'→3' NCgl1286-1f ggggagctttccgatctctaatt NCgl1286-1r atactcaaaattcataattagcctttc <h2 style=";text-align:left;direction:ltr"><![CDATA[NCgl1286 <h2 style=";text-align:left;direction:ltr"> D6A <h2 style=";text-align:left;direction:ltr"> -2f]]><h2 style=";text-align:left;direction:ltr"> ctaattatgaattttgagtatgccccagaagctgatgcagcctatcta <h2 style=";text-align:left;direction:ltr"><![CDATA[NCgl1286 <h2 style=";text-align:left;direction:ltr"> D6R <h2 style=";text-align:left;direction:ltr"> -2f]]><h2 style=";text-align:left;direction:ltr"> ctaattatgaattttgagtatcgaccagaagctgatgcagcctatcta <h2 style=";text-align:left;direction:ltr"><![CDATA[NCgl1286 <h2 style=";text-align:left;direction:ltr"> D6K <h2 style=";text-align:left;direction:ltr"> -2f]]><h2 style=";text-align:left;direction:ltr"> ctaattatgaattttgagtataagccagaagctgatgcagcctatcta NCgl1286-2r atgtgaatgcgtcgtcagattctaag

[0053] If no specific techniques or conditions are specified in the following examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0054] Example 1 Introducing the mutant gene NCgl1286 into the model bacteria of Corynebacterium glutamicum ATCC 13032 D6A

[0055] The genome of Corynebacterium glutamicum ATCC 13032 was used as a template and the primer pair NCgl1286-1f / NCgl1286-1r was used for PCR amplification to obtain the upstream homology arm fragment 13032-NCgl1286-up; the genome of Corynebacterium glutamicum ATCC 13032 was used as a template and the primer pair NCgl1286 D6A-2f / NCgl1286-2r primer pair was used for PCR amplification to obtain the downstream homology arm fragment 13032-NCgl1286-dn. The mixture of the two fragments 13032-NCgl1286-up and 13032-NCgl1286-dn was used as a template, and the NCgl1286-1f / NCgl1286-2r primer pair was used for PCR amplification to obtain the fragment 13032-up-dn. 13032-up-dn was double-digested with BamHI and NheI, and the vector pK18mobsacB (GenBank: FJ437239.1; available from public channels) was double-digested with the same enzymes. The two digestion products were connected with T4 DNA Ligase and transformed into Trans1T1 competent cells to obtain the recombinant plasmid pK18mobsacB-13032-NCgl1286 D6A .

[0056] Competent cells of ATCC 13032 were prepared according to the C. glutamicum Handbook (Charpter 23). Recombinant plasmid pK18mobsacB-13032-NCgl1286 D6A The competent cells were transformed by electroporation and the transformants were selected on BHI selection medium containing 15 mg / L kanamycin. The selected transformants were cultured overnight in ordinary BHI liquid medium at 33°C and shaken at 220 rpm on a rotary shaker. During the culture process, the transformants underwent a second recombination, and the vector sequence was removed from the genome by gene exchange. The culture was diluted in a continuous gradient (10 -2 Serial dilution up to 10 -4 ), the dilution was spread on a common BHI solid medium containing 10% sucrose and incubated at 33°C for 48 hours. The colonies that grew did not carry the inserted vector sequence in their genome. The target sequence was amplified by PCR and analyzed by nucleotide sequencing to obtain a strain carrying the mutant gene NCgl1286 D6A The strain was named 13032-NCgl1286 D6A The strain is based on the model bacteria of Corynebacterium glutamicum ATCC 13032, and its NCgl1286 gene (the coding gene containing the DUF2283 domain protein) is mutated so that the 6th amino acid of the encoded protein is mutated from aspartic acid to alanine.

[0057] Example 2 Introducing the mutant gene NCgl1286 into the model bacteria of Corynebacterium glutamicum ATCC 13032 D6R

[0058] Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-13032-NCgl1286 D6R (Using the NCgl1286-1f / NCgl1286-1r primer pair and NCgl1286 D6R -2f / NCgl1286-2r primer pair) was transformed into the model bacteria ATCC13032 to obtain a recombinant strain in which the coding gene NCgl1286 containing the DUF2283 domain protein was mutated so that the 6th amino acid of the encoded protein was mutated to arginine. The strain was named 13032-NCgl1286 D6R .

[0059] Example 3 Introducing the mutant gene NCgl1286 into the model bacteria of Corynebacterium glutamicum ATCC 13032 D6K

[0060] Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-13032-NCgl1286 D6K (Using the NCgl1286-1f / NCgl1286-1r primer pair and NCgl1286 D6K -2f / NCgl1286-2r primer pair) was transformed into the model bacteria ATCC13032 to obtain a recombinant strain in which the coding gene NCgl1286 containing the DUF2283 domain protein was mutated so that the 6th amino acid of the encoded protein was mutated to lysine. The strain was named 13032-NCgl1286 D6K .

[0061] Example 4 Introducing the mutant gene NCgl1286 into the model bacteria of Corynebacterium glutamicum ATCC 14067 D6A

[0062] Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-14067-NCgl1286 D6A The strain was transformed into the model bacterium ATCC 14067 to obtain a recombinant strain in which the gene NCgl1286 encoding the protein containing the DUF2283 domain was mutated so that the 6th amino acid of the encoded protein was mutated to alanine. The strain was named 14067-NCgl1286. D6A .

[0063] Example 5 Introducing the mutant gene NCgl1286 into the model bacteria of Corynebacterium glutamicum ATCC 14067 D6R

[0064] Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-14067-NCgl1286D6R The strain was transferred into the model bacteria ATCC 14067 to obtain a recombinant strain in which the gene NCgl1286 encoding the protein containing the DUF2283 domain was mutated so that the 6th amino acid of the encoded protein was mutated to arginine. The strain was named 14067-NCgl1286. D6R .

[0065] Example 6 Introducing the mutant gene NCgl1286 into the model bacteria of Corynebacterium glutamicum ATCC 14067 D6K

[0066] Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-14067-NCgl1286 D6K The strain was transferred into the model bacterium ATCC 14067 to obtain a recombinant strain in which the gene NCgl1286 encoding the protein containing the DUF2283 domain was mutated so that the 6th amino acid of the encoded protein was mutated to lysine. The strain was named 14067-NCgl1286. D6K .

[0067] Example 7 Strain fermentation performance test

[0068] The culture medium used in the lysine fermentation experiment is as follows:

[0069] Seed activation medium: BHI 37g / L, 18g / L agar powder.

[0070] Seed culture medium: sucrose 20 g / L, yeast powder 5 g / L, peptone 10 g / L, urea 5 g / L, magnesium sulfate heptahydrate 0.4 g / L, adjust pH to 7.0.

[0071] Fermentation medium: glucose 60g / L, ammonium sulfate 25g / L, potassium dihydrogen phosphate 2.0g / L, magnesium sulfate heptahydrate 1.0g / L, soybean meal hydrolyzate 10g / L, calcium carbonate 30g / L, adjust pH to 7.0.

[0072] The lysine fermentation method is as follows:

[0073] 1. Seed activation: Take the strain to be verified from the cryopreserved tube, streak it on the seed activation medium, and culture it at 33℃ for 24h;

[0074] 2. Seed culture: Pick the activated seeds 1 from the plate and transfer them to a 500mL Erlenmeyer flask containing 30mL of seed culture medium. Incubate at 33℃ and 220r / min for 6h to obtain seed solution.

[0075] 3. Fermentation culture: inoculate 2 mL of seed liquid into a 500 mL Erlenmeyer flask containing 20 mL of fermentation medium, culture at 33°C and 220 rpm for 14-15 h, and make three replicates for each strain.

[0076] 4.OD 562 Determination: Take 100 μL of fermentation liquid and dilute it to an appropriate multiple. Use a spectrophotometer to detect the OD at a wavelength of 562. Do three replicates for each strain and calculate the average value. 562 As shown in Table 2.

[0077] 5. Determination of lysine concentration: 2 mL of fermentation broth was centrifuged (12000 rpm, 2 min), and the supernatant was collected. The L-lysine content in the fermentation broth of the recombinant bacteria and the control bacteria was detected by HPLC. Three parallels were made for each strain, and the average value was calculated. The detected lysine concentrations are shown in Table 2.

[0078] Table 2 Lysine production, sugar-acid conversion rate and growth test results of recombinant strains

[0079] strains L-Lysine(g / L) Sugar acid conversion rate % <![CDATA[OD 562 ]]> ATCC 13032 0.52 0.87％ 40.5 <![CDATA[13032-NCgl1286 D6A ]]> 0.71 1.18％ 40.1 <![CDATA[13032-NCgl1286 D6R ]]> 0.68 1.13％ 40.6 <![CDATA[13032-NCgl1286 D6K ]]> 0.75 1.25％ 40.5 ATCC 14067 0.44 0.73％ 36.8 <![CDATA[14067-NCgl1286 D6A ]]> 0.66 1.10％ 36.9 <![CDATA[14067-NCgl1286 D6R ]]> 0.62 1.03％ 37.0 <![CDATA[14067-NCgl1286 D6K ]]> 0.69 1.15％ 37.1

[0080] The above results show that the lysine production and sugar-acid conversion rate of Corynebacterium glutamicum carrying the DUF2283 domain protein mutant are significantly improved compared with the control bacteria.

[0081] The above examples prove that the DUF2283 domain protein mutant has a significant promoting effect on lysine synthesis in the model strain of Corynebacterium glutamicum. The effect of the DUF2283 domain protein mutant on lysine production is further verified in lysine producing bacteria. Lysine producing bacteria CGMCC No.13407 and CGMCC No.11942 are used for verification. Both CGMCC No.13407 and CGMCC No.11942 are obtained by genetic modification of the model bacteria ATCC13032, and their lysine synthesis related genes are strengthened.

[0082] Example 8 Introducing the mutant gene NCgl1286 into CGMCC No.13407 D6A

[0083] Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-13032-NCgl1286 D6A The strain was transferred into CGMCC No. 13407 to obtain a recombinant strain in which the gene encoding the DUF2283 domain protein NCgl1286 was mutated so that the 6th amino acid of the encoded protein was mutated to alanine. The strain was named 13407-NCgl1286. D6A .

[0084] Example 9 Introducing the mutant gene NCgl1286 into CGMCC No.13407 D6R

[0085] Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-13032-NCgl1286 D6R The strain was transferred into CGMCC No. 13407 to obtain a recombinant strain in which the gene NCgl1286 encoding the DUF2283 domain protein was mutated so that the 6th amino acid of the encoded protein was mutated to arginine. The strain was named 13407-NCgl1286. D6R .

[0086] Example 10 Introducing the mutant gene NCgl1286 into CGMCC No.13407 D6K

[0087] Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-13032-NCgl1286 D6K The strain was transferred into CGMCC No. 13407 to obtain a recombinant strain in which the gene NCgl1286 encoding the DUF2283 domain protein was mutated so that the 6th amino acid of the encoded protein was mutated to lysine. The strain was named 13407-NCgl1286. D6K .

[0088] Example 11 Introducing the mutant gene NCgl1286 into CGMCC No.11942 D6A

[0089] Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-13032-NCgl1286 D6A The strain was transferred into CGMCC No. 11942 to obtain a recombinant strain in which the gene encoding the DUF2283 domain protein NCgl1286 was mutated so that the 6th amino acid of the encoded protein was mutated to alanine. The strain was named 11942-NCgl1286. D6A .

[0090] Example 12 Introducing the mutant gene NCgl1286 into CGMCC No.11942 D6R

[0091] Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-13032-NCgl1286 D6RThe strain was transferred into CGMCC No. 11942 to obtain a recombinant strain in which the gene encoding the DUF2283 domain protein NCgl1286 was mutated so that the 6th amino acid of the encoded protein was mutated to arginine. The strain was named 11942-NCgl1286. D6R .

[0092] Example 13 Introducing the mutant gene NCgl1286 into CGMCC No.11942 D6K

[0093] Referring to the method of Example 1, the constructed recombinant plasmid pK18mobsacB-13032-NCgl1286 D6K The strain was transferred into CGMCC No. 11942 to obtain a recombinant strain in which the gene NCgl1286 encoding the DUF2283 domain protein was mutated so that the 6th amino acid of the encoded protein was mutated to lysine. The strain was named 11942-NCgl1286. D6K .

[0094] Example 14 Strain fermentation performance test

[0095] CGMCC No.13407, CGMCC No.11942 and their modified recombinant bacteria 13407-NCgl1286 were treated with the method of Example 7. D6A 、13407-NCgl1286 D6R 、13407-NCgl1286 D6K 、11942-NCgl1286 D6A 、11942-NCgl1286 D6R 、11942-NCgl1286 D6K The results of the lysine fermentation experiment are shown in Table 3.

[0096] Table 3 Lysine production, sugar-acid conversion rate and growth test results of recombinant strains

[0097]

[0098]

[0099] The fermentation results showed that the lysine production and sugar-acid conversion rates of the recombinant bacteria carrying the DUF2283 domain protein mutants in the same batch of tested lysine-producing bacteria CGMCC No.13407, CGMCC No.11942 and recombinant bacteria carrying the DUF2283 domain protein mutants were significantly improved, and the mutation of the sixth amino acid from aspartic acid (D) to lysine (K) had a better effect on improving the lysine production and sugar-acid conversion rate.

[0100] The above results show that the DUF2283 domain-containing protein mutant provided by the present invention has a significant promoting effect on the lysine production and sugar-acid conversion rate of Corynebacterium.

[0101] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A DUF2283 domain-containing protein mutant, characterized in that: Compared with the wild-type DUF2283 domain-containing protein of Corynebacterium glutamicum, the mutant contains a mutation in which aspartic acid at position 6 is mutated to an amino acid other than aspartic acid.

2. The DUF2283 domain-containing protein mutant according to claim 1, characterized in that: Compared with the wild-type DUF2283 domain-containing protein of Corynebacterium glutamicum, the mutant contains a mutation in which the sixth aspartic acid is mutated into alanine, arginine or lysine.

3. The DUF2283 domain-containing protein mutant according to claim 1 or 2, characterized in that: The amino acid sequence of the mutant is shown in any one of SEQ ID NOs. 1 to 3.

4. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the DUF2283 domain-containing protein mutant according to any one of claims 1 to 3.

5. Biomaterial, characterized in that The biological material comprises the nucleic acid molecule according to claim 4, or the biological material expresses the DUF2283 domain-containing protein mutant according to any one of claims 1 to 3.

6. Any of the following uses of the DUF2283 domain-containing protein mutant according to any one of claims 1 to 3, the nucleic acid molecule according to claim 4, or the biomaterial according to claim 5: (1) Application in the production of lysine or its derivatives; (2) Application in constructing a microorganism for producing lysine or its derivatives; (3) Application in screening or identifying microorganisms with high lysine production; Preferably, the microorganism is a bacterium of the genus Corynebacterium, a bacterium of the family Enterobacteriaceae or a bacterium of the genus Bacillus.

7. A modified microorganism, characterized in that The modified microorganism expresses the DUF2283 domain-containing protein mutant according to any one of claims 1 to 3, and / or the modified microorganism contains the nucleic acid molecule according to claim 4.

8. The modified microorganism according to claim 7, characterized in that The chromosomal in situ DUF2283 domain protein gene of the modified microorganism is mutated into a gene encoding the DUF2283 domain protein mutant according to any one of claims 1 to 3; Preferably, the microorganism is a bacterium of the genus Corynebacterium, a bacterium of the family Enterobacteriaceae or a bacterium of the genus Bacillus.

9. Use of the modified microorganism according to claim 7 or 8 in producing lysine or its derivatives.

10. A method for producing lysine or its derivatives by fermentation, characterized in that: The method comprises: culturing the modified microorganism according to claim 7 or 8 to obtain a culture, and collecting lysine or a derivative thereof from the culture.

Images