VanR in-vitro transcription factor sensor responding to vanillic acid

Abstract

The invention discloses a VanR in-vitro transcription factor sensor responding to vanillic acid, and belongs to the field of biological detection. According to the method, an allosteric transcription factor VanR from Corynebacterium glutamicum is taken as a recognition element, restriction enzyme Nb.BbvCI causing single-chain breakage, DNA polymerase and a double-chain transduction DNA fragment (wherein a VanR recognition site and a Nb.BbvCI restriction enzyme cutting site are overlapped) are used, the reaction is carried out at room temperature, a fluorescence value is detected in real time through a microplate reader, and the result shows that the result is accurate and reliable. The method has the advantages of being rapid in identification and suitable for portable equipment. The in-vitro VanR biosensor provided by the invention has a better application prospect, and can be used for high-throughput screening of a rate-limiting enzyme O-methyltransferase (OMT) in a vanillin biosynthesis process.

Description

Technical Field

[0001] The invention relates to a VanR in vitro transcription factor sensor responding to vanillic acid, and belongs to the field of biological detection. Background Art

[0002] The effective detection of small molecules in samples has been widely used in the fields of pharmaceutical production, food safety and environmental pollution. The main methods for detecting small molecules are physical and chemical analysis methods and biological analysis methods. The physical and chemical analysis method mainly uses mass spectrometry, chromatography and mass spectrometry-chromatography combined technology, which has the characteristics of high sensitivity and accuracy. However, its sample pretreatment process is cumbersome, costly, time-consuming and labor-intensive. The biological analysis method mainly generates, amplifies, converts and outputs signals through the specific interaction between small molecules and proteins / nucleic acids. A biosensor is an analytical device composed of a biological sensitive element and a signal converter. It is a device that measures biological or chemical reactions by generating a signal proportional to the concentration of the analyte in the reaction. Biosensors are used in applications such as disease monitoring, drug discovery and detection of pollutants, pathogenic microorganisms and as markers of disease indicators in body fluids (blood, urine, saliva, sweat).

[0003] Transcription factor-based biosensors. Natural transcription factors that respond to small molecules are widely present in natural microorganisms. Among them, more than 200 transcription factors have been found in Escherichia coli, which can sense a wide range of metabolites, including amino acids, sugars, sugar phosphates, and lipids. However, whole-cell biosensors have poor robustness, long response time, and poor stability and reproducibility. In addition, the biosafety issues caused (e.g., the risk of spread of genetically modified WCBs) and the permeability and toxicity of the analyte remain a major obstacle. For these considerations, in vitro transcription factor sensors have unique advantages, with the characteristics of feasibility, adjustability, low cost and high stability, modularity, and compatibility.

[0004] VanR is a negative transcriptional regulator of bacteria belonging to the PadR family and regulates the expression of vanillic acid transport and degradation proteins in response to vanillic acid. VanR contains 192 residues (21kDa). Similar to other PadR family members, VanR forms a functional dimer, and each VanR subunit consists of an N-terminal DNA binding domain (NTD) and a C-terminal dimerization domain (CTD). A VanR dimer uses two interdomain cavities to bind two vanillic acid molecules simultaneously. There are currently reports on the use of VanR whole-cell biosensors, but whole-cell biosensors have the disadvantages of poor robustness, long response time, and poor stability and reproducibility. In contrast, in vitro VanR biosensors have application prospects.

[0005] O-methyltransferase (OMT) is the rate-limiting enzyme in the synthesis of vanillin. Vanillin can be further converted into vanillic acid under the catalysis of vanillin dehydrogenase (VDH). Co-expression of OMT and VDH in the system can indirectly reflect the activity of OMT by detecting the amount of vanillic acid. The more vanillic acid, the more vanillin is produced and the higher the activity of OMT. However, it is unclear how to construct a biosensor for sensing vanillic acid. Therefore, it is urgent to develop an in vitro vanillic acid biosensor that can be used for high-throughput screening of O-methyltransferase (OMT), the rate-limiting enzyme in the biosynthesis of vanillin. Summary of the invention

[0006] In view of the above-mentioned deficiencies in the prior art, the present invention proposes a VanR in vitro transcription factor sensor responsive to vanillic acid, aiming to solve the technical problems that the current VanR whole-cell biosensor has poor robustness, long response time, poor stability and reproducibility, and there is no in vitro vanillic acid biosensor.

[0007] The first technical solution provided by the present invention is a biosensor for detecting vanillic acid, wherein the biosensor comprises a recognition element and a transducer element, wherein the recognition element is an allosteric transcription factor VanR; the transducer element comprises a transducer DNA fragment and at least one transducer protein, wherein the transducer DNA fragment comprises an allosteric transcription factor action site and a transducer site;

[0008] Wherein, the binding of the allosteric transcription factor to its action site hinders the binding of at least one of the transducer proteins to the transducer site, and the binding of the allosteric transcription factor to the small molecule changes the interaction between the allosteric transcription factor and the transducer DNA fragment;

[0009] Wherein, the transducing DNA fragment is double-stranded at the transcription factor action site, and the transducing protein includes DNA polymerase and restriction endonuclease.

[0010] In certain embodiments, the allosteric transcription factor VanR is from Corynebacterium glutamicum (Accession: 6LG2). The nucleotide sequence of the allosteric transcription factor VanR is shown in SEQ ID NO.3.

[0011] In certain embodiments, the transducing DNA fragment comprises SEQ ID NO.1 and SEQ ID NO.2,

[0012] SEQ ID NO.1:

[0013] AACCCAACCCGCCCTACCCAACCTCAGCAACTAACTAAGAGTTTAGGTATTTGGTTA CAACG-P; SEQ ID NO.2: CGTTGTAACCAAATACCTAAACTCTTAGTTAGTT. The P in SEQ ID NO.1 represents phosphorylation modification.

[0014] In certain embodiments, the transduction site is adjacent to or overlaps with an allosteric transcription factor action site, and the allosteric transcription factor VanR action site is AACTAACTAAGAGTTTAGGTATTTGGTT.

[0015] In certain embodiments, at least one of the transducer proteins is a DNA polymerase.

[0016] The second technical solution provided by the present invention is a method for detecting small molecules in a sample, the method comprising contacting the sample with the biosensor described in the first technical solution, and detecting the product of DNA amplification, wherein the small molecule is vanillic acid.

[0017] In certain embodiments, the method comprises the steps of:

[0018] S1. Design and synthesize transduction DNA fragments;

[0019] S2, mixing and incubating the sample to be tested, the allosteric transcription factor VanR and the transducing DNA fragment of step S1;

[0020] S3, adding a restriction endonuclease, dNTP and DNA polymerase that cause chain breaks to the mixture obtained in step S2 for amplification, and detecting the amplified product;

[0021] S4, a fluorescence-based detection method, specifically, adding the fluorescent dye ThT. When the G4 chain and ThT are combined, the maximum fluorescence value is obtained under the excitation light of 425nm and the emission light of 482nM;

[0022] S5. The detection method based on colorimetry is to incubate the solution obtained in step S3 with hemin, and then add ABTS 2- and H2O2, and the generated G quadruplex was detected by absorbance.

[0023] In certain embodiments, in S1, two primers are designed, namely T and P, which are transducing DNA fragments, and the sequence of T (SEQ ID NO.1) is:

[0024] AACCCAACCCGCCCTACCCAACCTCAGCAACTAACTAAGAGTTTAGGTATTTGGTTA CAACG-P, the sequence of P (SEQ ID NO. 2) is: CGTTGTAACCAAATACCTAAACTCTTAGTTAGTT.

[0025] In certain embodiments, in S1, primers T and P are added to the system in equal amounts, heat denatured at 95 degrees for 5 minutes, and then slowly cooled to room temperature to form partially bound double-stranded fragments.

[0026] In certain embodiments, in S2, the sample to be tested, the allosteric transcription factor VanR and the DNA fragment obtained in S1 are mixed and incubated at room temperature for 20 minutes.

[0027] In certain embodiments, in S3, a restriction endonuclease Nb.BbVCI, dNTPs and DNA polymerase that cause chain breaks are added to the mixture of step S2. There is a competitive relationship between the DNA polymerase and vanillic acid. When vanillic acid is present, vanillic acid specifically binds to VanR, and VanR is released from the transduced DNA fragment. Nb.BbvCI recognizes the Nb.BbvCI restriction enzyme cleavage site on the transduced DNA and causes chain breaks. The DNA polymerase extends the primers and amplifies them to obtain a large number of G4 chains.

[0028] In certain embodiments, in S4, the fluorescence-based detection method is specifically: adding fluorescent dye ThT to the solution obtained in S3, when a large number of G4 chains amplified in S3 are combined with ThT, it has a maximum fluorescence value under an excitation light of 425nm and an emission light of 482nM, and the more G4 chains generated, the higher the fluorescence value.

[0029] In some embodiments, in S5, the colorimetric detection method is specifically: incubating the solution obtained in step S3 with hemin, and then adding ABTS 2- and H2O2, and the generated G quadruplexes are detected by absorbance. The more G4 chains generated, the higher the absorbance.

[0030] In certain embodiments, the allosteric transcription factor VanR is from Corynebacterium glutamicum. The nucleotide sequence of the allosteric transcription factor VanR is shown in SEQ ID NO.3.

[0031] In certain embodiments, the VanR coding sequence is synthesized by Qingke Biotechnology Co., Ltd. and inserted into the corresponding restriction enzyme sites of pET-21a (Novagen) plasmid. The plasmid is transformed into the expression strain Escherichia coli BL21 (DE3), and VanR is expressed and purified by nickel column.

[0032] In certain embodiments, the amount of each single strand of the transducing DNA fragment added is 100-400 nM, and preferably the amount of each single strand of the transducing DNA fragment added is 400 nM.

[0033] In certain embodiments, in S3, the reaction time is 15 to 40 min, preferably, the reaction time is 20 min.

[0034] In certain embodiments, the amplification reaction buffer formula in step S3 is: 10 mM Tris-HCl, pH=7.9; 50 mM NaCl; 1 mM EDTA; 10 mM MgCl2; 100 μg / mL BSA.

[0035] In certain embodiments, the amount of VanR added is 40-100 nM, preferably, the amount of VanR added is 100 nM.

[0036] In certain embodiments, the amount of Nb.BbvCI restriction endonuclease added is 1 to 3 U, preferably, the amount of Nb.BbvCI restriction endonuclease added is 2 U.

[0037] In certain embodiments, the amount of DNA polymerase Klenow Fragment added is 0.25-1.0U, preferably, the amount of DNA polymerase Klenow Fragment added is 0.5U.

[0038] The third technical solution provided by the present invention is the use of the biosensor described in the first technical solution or the method described in the second technical solution in detecting vanillic acid.

[0039] The technical effects of the present invention are as follows:

[0040] 1. The VanR in vitro sensor of the present invention can stably respond to vanillic acid in vitro with good specificity.

[0041] 2. The fluorescence value of the VanR in vitro sensor of the present invention is positively correlated with the concentration of vanillic acid in the range of 0-200 μM vanillic acid. When 200 μM vanillic acid is added to the reaction system, the fluorescence value can be increased by 12 times.

[0042] 3. The VanR in vitro sensor of the present invention can be used for high-throughput screening of methyltransferase OMT, a key enzyme in vanillin biosynthesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 Schematic diagram of the biosensing strategy of coupling aTF with SDA.

[0044] Figure 2 The fluorescence values ​​of Ex425 / Em482 corresponding to adding different concentrations of G4 into the reaction system.

[0045] Figure 3 This is a gel image of VanR protein purified by Ni column.

[0046] Figure 4 The effect of different reaction buffers on the reaction.

[0047] Figure 5 This is the effect of the amount of T and P added on the system.

[0048] Figure 6 This is the effect of the amount of Nb.BbvCI enzyme added on the system.

[0049] Figure 7 This is the effect of the amount of Klenow Fragment enzyme added on the system.

[0050] Figure 8 is the change of fluorescence value with reaction time.

[0051] Fig. 9 is the inhibitory effect of the added amount of VanR on fluorescence.

[0052] Fig.10 This is the effect of the amount of vanillic acid added on the fluorescence value.

[0053] Fig.11 The substrate response specificity of the sensor.

[0054] Fig.12 These are the fluorescence values ​​of the mouse control group, low-dose vanillic acid group (VA-L), and high-dose vanillic acid group (VA-H). DETAILED DESCRIPTION

[0055] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0056] Test method:

[0057] The detection method of G4 chain body refers to the method in the following literature:

[0058] (1)Li Y, Xu S, Wu X, Xu Q, Zhao Y, Lou X, Yang

[0059] (2)Li R, Liu Q, Jin Y, Li BG-triplex / hemin DNAzyme: An ideal signal generator for isothermal exponential amplification reaction-based biosensing platform. Anal Chim Acta. 2019Nov 4; 1079:139-145.

[0060] The raw materials used in the embodiment:

[0061] The oligonucleotides used in the examples were synthesized and purified by Beijing Tsingke Biotech Co., Ltd. Nb.BbvCI, Klenow Fragment DNA polymerase and four deoxyribonucleoside 5'-triphosphates (dNTPs) were purchased from New England Biolabs (Beijing). 2-[4-(dimethylamino)phenyl]-3,6-dimethylbenzothiazolium cation (ThT), 2,2-azino-bis(3-ethyl-benzothiazole-6-sulfonic acid) diammonium salt (ABTS) and hemin were purchased from Sigma. All solutions were prepared using sterilized Milli-Q water. The compounds for preparing the reaction buffer, such as Tris-HCl, NaCl, ethylenediaminetetraacetic acid (EDTA), MgCl2, bovine serum albumin (BSA), N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES), and dithiothreitol (DTT), were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. The pET-21a plasmid was purchased from Yunzhou Biotechnology, and the Escherichia coli BL21 (DE3) was purchased from Mingzhou Biotechnology, all of which were commercial plasmids and strains.

[0062] Example 1 VanR in vitro sensor responsive to vanillic acid

[0063] In this example, the allosteric transcription factor VanR from Corynebacterium glutamicum was used as a recognition element, and the restriction endonuclease Nb.BbvCI that causes single-strand breaks, DNA polymerase, and a double-stranded transducible DNA fragment (wherein the VanR recognition site and the Nb.BbvCI restriction enzyme site overlapped) were used to detect the fluorescence value in real time using a microplate reader.

[0064] The chemical name of vanillic acid is 4-hydroxy-3-methoxybenzoic acid, which is widely present in nature. In the natural state, there is a competitive binding relationship between the restriction endonuclease Nb.BbvCI and DNA polymerase. In the absence of vanillic acid, VanR binds to the VanR action site. Since the VanR binding site overlaps with the Nb.BbvCI recognition site, the binding of VanR to TFBS prevents the Nb.BbvCI restriction enzyme site from being exposed, inhibiting the cutting of the transduced DNA fragment by Nb.BbvCI, making it impossible for the DNA polymerase to extend and amplify using the transduced DNA as a template.

[0065] When vanillic acid is present, vanillic acid specifically binds to VanR, and VanR is released from the transduced DNA fragment. Nb.BbvCI recognizes the Nb.BbvCI restriction enzyme site on the transduced DNA and causes chain breakage. DNA polymerase extends the primers to obtain a large number of G4 chains, which are then detected. In the fluorescence method, the G4 chain is combined with the fluorescent dye ThT, and the fluorescence value is measured at an excitation wavelength of 425nM and an emission wavelength of 482nM on a microplate reader. The fluorescence value is positively correlated with the concentration of vanillic acid within a certain range. In the colorimetric method, the G4 chain is incubated with heme, so that the DNA chain forms a G-quadruplex structure deoxyribozyme. In order to trigger ABTS 2- ABTS 2- Add the H2O2 solution to the G-quadruplex-hemin DNAzyme solution at the same time, and record the absorbance at 380nm-500nm after the reaction. The absorbance value is positively correlated with the concentration of vanillic acid within a certain range.

[0066] 1. Based on Figure 1 A pair of primers, T and P, were designed to couple aTF with SDA. The sequences are shown in Table 1. The bold italic black part (region A) is the DNA binding sequence of VanR, the underlined part (region B) is the recognition site of Nb.BbvC1, and the black lowercase part (region C) is the complementary DNA sequence of the G-quadruplex.

[0067] Table 1: Primer sequences

[0068]

[0069] 2. Explore the fluorescence values ​​after different concentrations of G4 bind to ThT.

[0070] In a 100 μL system, 5 μM ThT and different concentrations of G4 (0-800 nM) were added, and the fluorescence value of Ex425 / Em482 was detected by an ELISA instrument. Figure 2 As shown in the figure, there is a good linear relationship between the concentration of G4 added to the reaction system and the fluorescence value of Ex425 / Em482.

[0071] 3. Expression and purification of VanR

[0072] The VanR coding sequence was designed and synthesized by Qingke Biotechnology Co., Ltd. It was inserted into the corresponding restriction enzyme site of the pET-21a (Novagen) plasmid. The plasmid was transformed into the expression strain Escherichia coli BL21 (DE3), and VanR was expressed and purified. The concentration of the purified protein was quantified by the BCA protein quantification method, and 12% SDS-PAGE protein gel electrophoresis was performed. The electrophoresis results are shown in Figure 3 As shown, the arrow indicates the position of the target protein band. It can be seen that the eluted VanR protein band is obvious and relatively single.

[0073] 4. Sensor Optimization

[0074] The primers T and P were annealed, and the dosages of T and P, restriction endonuclease Nb.BbvCI and DNA polymerase KlenowFragment, reaction time, reaction buffer and the amount of VanR added were optimized.

[0075] (1) Optimize the dosage of T and P: Add different amounts of T and P (100-400 nM) to the reaction system. Figure 5 The results showed that the optimized dosage was 400nM T and 400nM P for annealing, and the fluorescence value reached 15000.

[0076] (2) Optimize the dosage of restriction endonuclease Nb.BbvCI: Add different amounts of Nb.BbvCI to the system, such as Figure 6 As shown, the optimized dosage is 2U Nb.BbvCI, and the fluorescence value reaches 15030.

[0077] (3) Optimize the dosage of DNA polymerase Klenow Fragment: Add different amounts of Klenow Fragment to the system, such as Figure 7 As shown, the optimized dosage is 0.5U Klenow Fragment, and the fluorescence value reaches 17000.

[0078] (4) Optimize reaction time: According to the optimized reaction system, the fluorescence value was detected every 5 minutes for a total of 40 minutes. Figure 8 It can be seen that the optimized reaction time is 20 minutes and the fluorescence value reaches 17200.

[0079] (5) Investigate the effect of different reaction buffers on fluorescence values: There are three types of buffers, A, B, and C, and their formulas are as follows.

[0080] A: 10mM Tris-HCl, pH=7.9; 50mM NaCl; 1mM EDTA; 10mM MgCl2; 100μg / mL BSA

[0081] B: 10mM HEPES, pH=7.9; 50mM NaCl; 10mM MgCl2

[0082] C: 10mM Tris-HCl, pH=7.9; 50mM NaCl; 10mM MgCl2; 1mM DTT

[0083] like Figure 4 As shown, the fluorescence in buffer A was the highest, with a fluorescence value of 17203, and buffer A was used subsequently.

[0084] (6) Optimize the concentration of VanR in the sensor: After annealing with 400 nM T and 400 nM P, add different concentrations of VanR (20 nM to 100 nM) to the system and incubate at room temperature for 20 min to allow VanR to bind to the template. Add 2 U Nb.BbvCI, 0.5 U Klenow Fragment, and 5 μM ThT to the system and react at room temperature for 20 min. Detect the fluorescence value with an enzyme-labeled instrument. Fig. 9 As shown, the optimized VanR concentration thus obtained was 100 nM.

[0085] Example 2 Sensitivity and linear range of in vitro sensor for vanillic acid

[0086] The performance of the sensor in detecting vanillic acid was studied using the optimized system of Example 1. 400nM T and 400nM P were annealed to obtain transduced DNA in a 50μL reaction system (containing 400pM transduced DNA, 100nM HosA, different concentrations of vanillic acid (from 0-200μM) and buffer) and incubated at room temperature for 20min, then 2U Nb.BbvCI, 0.5U KlenowFragment, 5μM ThT were added, reacted at room temperature for 20min, and the fluorescence value was measured at an excitation wavelength of 425nM and an emission wavelength of 482nM on a microplate reader. The specific reaction system of each group is as follows:

[0087] A: 400 nM T;

[0088] B: 400nM T+400nM P;

[0089] C: 400nM T+400nM P+100nM VanR+

[0090] D: 400nM T+400nM P+100nM VanR+50μM vanillic acid;

[0091] E: 400nM T+400nM P+100nM VanR+100μM vanillic acid;

[0092] F: 400nM T+400nM P+100nM VanR+150μM vanillic acid;

[0093] G: 400nM T+400nM P+100nM VanR+200μM vanillic acid.

[0094] like Fig.10 As shown, with the increase of vanillic acid concentration, the fluorescence value gradually increases. The response sensitivity of vanillic acid reaches 200μM level, and the linear range of response is 0-200μM, with high response sensitivity and wide linear range. When 200μM vanillic acid is added to the reaction system, the fluorescence value can be increased by 12 times.

[0095] Example 3 Response Specificity of Vanillic Acid In Vitro Sensor

[0096] Based on the optimized reaction conditions in Example 1, 400 nM T and 400 nM P were annealed to obtain transduced DNA in a 50 μL reaction system (comprising 400 pM transduced DNA, 100 nM HosA, substrate and buffer) and incubated at room temperature for 20 min. Then, 2 U Nb.BbvCI, 0.5 U Klenow Fragment and 5 μM ThT were added and reacted at room temperature for 20 min. The fluorescence value was measured on a microplate reader at an excitation wavelength of 425 nM and an emission wavelength of 482 nM.

[0097] Different substrates were added to the reaction system, including ferulic acid, caffeic acid, vanillin, isovanillin, isovanillic acid, protocatechuic aldehyde, protocatechuic acid, protocatechuic alcohol, and vanillic acid. Fig.11 As shown, among several substances, the sensor specifically recognizes vanillic acid and does not recognize other substances. It has good substrate response specificity and can reduce the false positive problems that may occur in practical applications.

[0098] Example 4 Application of in vitro vanillic acid biosensor

[0099] Vanillic acid is a substance produced after norepinephrine is metabolized in the peripheral nervous system. The increase of this substance often indicates neuroblastoma or nephroblastoma. The in vitro vanillic acid biosensor of the present invention has certain clinical application potential and value.

[0100] Vanillic acid is an effective ingredient in many traditional Chinese medicines such as Astragalus. It has multiple biological activities such as antioxidant, anti-inflammatory, and anti-tumor, and can be used in the fields of food, medicine, and cosmetics. In the food field, vanillic acid can be used as a natural antioxidant to extend the shelf life of food; in the medical field, vanillic acid can be used to prepare anti-inflammatory and anti-tumor drugs; in the cosmetic field, vanillic acid can be used as an active ingredient to improve skin quality and delay skin aging.

[0101] In order to study the effectiveness of the invented in vitro vanillic acid biosensor in detecting real samples, the sensor was used to detect vanillic acid in serum in clinical diagnosis, and animal experiments were conducted in mice. The results showed that the biosensor has good robustness and sensitivity in real analysis, and the reaction is carried out at room temperature, with the advantages of rapid identification and suitability for portable equipment. In addition, the present invention provides a way to develop biosensors for in vitro detection of various small molecules, especially those that cannot be detected by conventional methods.

[0102] The experimental animals were 40 SPF male C57BL / 6 mice in good health with an average weight of (20.25±1.91) g, and a body weight of (20±2) g, provided by the Guangdong Medical Experimental Animal Center, with a room temperature of (22±2)°C, a relative humidity of 50% to 70%, natural light and dark alternation during the day and night, pellet feed, and free drinking water. This study complies with ethical standards.

[0103] (1) Drug: Vanillic acid (HPLC ≥ 97%), product number: B21361, Shanghai Yuanye Biotechnology Co., Ltd.

[0104] (2) Animal grouping and administration: After 1 week of adaptive feeding, 40 C57BL / 6 mice were randomly divided into a normal control group, a low-dose vanillic acid group (VA-L 25 mg / (kg·d)-1, continuously gavaged for 4 weeks), and a high-dose vanillic acid group (VA-H group, 50 mg / (kg·d)-1, continuously gavaged for 4 weeks), with 10 mice in each group. The control group was fed with a basic feed and normal drinking water. Vanillic acid was dissolved in dimethyl sulfoxide.

[0105] (3) Determination of vanillic acid: After the end of the experiment, fast for the first 12 hours and no water for the first hour. Blood samples were collected by eye removal, and after standing at room temperature for 2 hours, centrifuged at 3500r / min and 4°C for 10 minutes. The upper serum was aspirated, and the fluorescence value was measured using the in vitro vanillic acid biosensor of the present invention. The serum test results showed that the fluorescence value of the high-dose vanillic acid group (VA-H group) was 15000, and the fluorescence value of the low-dose vanillic acid group (VA-L) was 5000. The fluorescence of the control group was the lowest. The fluorescence value of the high-dose vanillic acid group (VA-H group) was 3 times that of the low-dose vanillic acid group (VA-L), which was significantly higher than the low-dose group, which was in line with the experimental expectations. Fig.12 shown.

[0106] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A biosensor for detecting vanillic acid, characterized in that: The biosensor comprises a recognition element and a transducer element, wherein the recognition element is an allosteric transcription factor VanR; the transducer element comprises a transducer DNA fragment and at least one transducer protein, wherein the transducer DNA fragment comprises an allosteric transcription factor action site and a transducer site; Wherein, the binding of the allosteric transcription factor to its action site hinders the binding of at least one of the transducer proteins to the transducer site, and the binding of the allosteric transcription factor to the small molecule changes the interaction between the allosteric transcription factor and the transducer DNA fragment; Wherein, the transducing DNA fragment is double-stranded at the transcription factor action site, and the transducing protein includes DNA polymerase and restriction endonuclease.

2. The biosensor according to claim 1, characterized in that The allosteric transcription factor VanR is from Corynebacterium glutamicum; the transducing DNA fragment includes SEQ ID NO.1 and SEQ ID NO.

2.

3. The biosensor according to claim 2, characterized in that The allosteric transcription factor VanR action site is AACTAACTAAGAGTTTAGGTATTTGGTT, and the transduction site is adjacent to or overlaps with the allosteric transcription factor action site.

4. A method for detecting small molecules in a sample, characterized in that: The method comprises contacting the sample with the biosensor according to any one of claims 1 to 3, and detecting the product of DNA amplification, wherein the small molecule is vanillic acid.

5. The biosensor according to claim 4, characterized in that The steps include: S1. Design and synthesize transduction DNA fragments; S2, mixing and incubating the sample to be tested, the allosteric transcription factor VanR and the transducing DNA fragment of step S1; S3. Add restriction endonucleases that cause chain breaks, dNTPs and DNA polymerase to the mixture obtained in step S2 to carry out an amplification reaction, and detect the amplified product using a fluorescence-based detection method and / or a colorimetric-based detection method.

6. The biosensor according to claim 5, characterized in that In S1, two primers, T and P, were designed. T and P were transducing DNA fragments. The sequence of T was SEQ ID NO.1, and the sequence of P was SEQ ID NO.

2. The primers T and P were added to the system in equal amounts, heat denatured at 95 degrees for 5 minutes, and cooled to room temperature to form partially bound double-stranded fragments.

7. The biosensor according to claim 5, characterized in that In S2, the amount of each single strand of the transducing DNA fragment added is 100-400 nM, and the amount of VanR added is 40-100 nM.

8. The biosensor according to claim 5, characterized in that In S3, the amplification reaction time is 15 to 40 minutes; the amount of Nb.BbvCI restriction endonuclease added is 1 to 3 U, and the amount of DNA polymerase added is 0.25 to 1.0 U.

9. The biosensor according to claim 5, characterized in that: The fluorescence-based detection method is specifically as follows: adding the fluorescent dye ThT to the S3 system. When a large number of G4 chains amplified in the S3 system are combined with ThT, the maximum fluorescence value is obtained under the excitation light of 425nm and the emission light of 482nM. The more G4 chains are generated, the higher the fluorescence value. The specific detection method based on colorimetry is: add hemin to the system in step S3 for incubation, and then add ABTS 2- and H2O2, and the generated G quadruplexes are detected by absorbance. The more G4 chains generated, the higher the absorbance.

10. Use of the biosensor according to any one of claims 1 to 3 or the method according to any one of claims 4 to 9 in detecting vanillic acid.

Images