Double-fluorescence subcellular glycogen fluorescence probe dFluoGPS and application thereof

Abstract

The invention belongs to the technical field of detection, discloses a dual-fluorescence subcellular glycogen fluorescent probe dFluoGPS and application thereof, and particularly discloses a probe which comprises a) and b), wherein a) comprises a binding module for specifically binding glycogen and a spectroscopically detectable reporting module; b) comprising a binding module for specifically binding glycogen, a spectroscopically detectable reporting module and a nuclear localization signal module. The invention provides a probe (dFluoGPS glycogen probe), the probe is used for promoting the glycogen binding module to bind glycogen in cytoplasm and cell nucleus to form a fluorescent aggregate through a binding module specifically bound with glycogen and a nuclear localization signal, so that the glycogen is qualitatively detected at a subcellular level with high sensitivity.

Description

Technical Field

[0001] The invention belongs to the field of detection technology, and specifically relates to a dual-fluorescence subcellular glycogen fluorescent probe dFluoGPS and an application thereof. Background Art

[0002] Glycogen is an important energy storage substance in organisms. It is a biological macromolecular carbohydrate formed by glucose molecules connected by α-1,4- and α-1,6-glycosidic bonds. Glycogen in living cells aggregates with glycogen metabolic enzymes and other glycogen-binding proteins to form microscopic glycogen granules or glycosomes. Its molecular weight is 10 6 ~10 8 , with a diameter ranging from 10 to 300 nm. In the human body, glycogen exists in two forms, liver glycogen and muscle glycogen, and plays the role of energy storage. When the body is under-supplied with energy, glycogen will quickly decompose to provide energy for the body's life activities and produce metabolic signal molecules. When the enzymes or signal molecules involved in glycogen metabolism mutate, it will cause metabolic abnormalities such as glycogen storage and utilization, leading to abnormal glycogen content and biochemical characteristics in tissue cells, namely glycogen storage disease (GSD). Recent studies have shown that nuclear glycogen exists in some tumor cells and pathological conditions, and the function of nuclear glycogen is still unclear. Due to the low content of nuclear glycogen, its detection method relies on cumbersome and expensive isotope-labeled mass spectrometry. Therefore, fast and effective subcellular glycogen detection is very important for the mechanism study of glycogen metabolism-related diseases and the diagnosis of GSD. At present, the most commonly used methods for detecting glycogen content at the cellular and tissue levels are periodic acid Schiff (PAS) staining, antibody-dependent immunofluorescence staining and biochemical detection. Among them, PAS staining can only stain fixed cells and cannot monitor the glycogen content in real time at the level of living cells. At the same time, PAS staining has low sensitivity and lacks specificity in detecting glycogen. In addition to glycogen, PAS staining can also detect other carbohydrate-containing molecules, including glycoproteins, glycolipids, and mucins; antibody-dependent immunofluorescence staining relies on rare glycogen antibodies or other glycogen-binding protein antibodies, which are also not suitable for real-time detection of living cells; while biochemical detection and isotope labeling detection of glycogen content require cell lysis and cumbersome enzymatic colorimetric reactions such as glycogen purification, glycogenolysis, and glucose quantification, which are less convenient, specific, and sensitive. So far, there is no biosensor that can achieve subcellular level, high sensitivity, and specificity in real time detection of glycogen in living cells. Summary of the invention

[0003] The first aspect of the present invention aims to provide a probe.

[0004] The second aspect of the present invention aims to provide biological materials related to the probe of the first aspect of the present invention.

[0005] The third aspect of the present invention aims to provide application of the probe of the first aspect of the present invention or the biomaterial of the second aspect of the present invention.

[0006] The fourth aspect of the present invention aims to provide a product.

[0007] The fifth aspect of the present invention aims to provide a method for detecting glycogen.

[0008] In order to achieve the above object, the technical solution adopted by the present invention is:

[0009] Recent studies have shown that the carbohydrate binding module (CBM) protein domain in polysaccharide regulatory proteins can specifically recognize and bind to polysaccharide polymer ligands such as glycogen and cellulose, which provides a new idea for further developing living cell glycogen probes. According to their amino acid sequence similarity, the CBM domain can be classified into 55 CBM family sequences, and different CBM families show significant differences in substrate specificity, ligand affinity and mode of action. Currently known glycogen binding proteins such as STBD1, AMPKβ1 and AMPKβ2 all specifically recognize and bind to glycogen through the CBM20 sequence. Based on this, the present invention develops a genetically encoded dual fluorescence subcellular glycogen fluorescent probe (dFluoGPS) by fusing cytoplasmic and nuclear localized CBM20 and dual-color fluorescent protein. dFluoGPS, as a living cell fluorescent probe, can be used to achieve high-sensitivity real-time qualitative detection of glycogen in the cytoplasm and nucleus at the same time.

[0010] The first aspect of the present invention provides a probe comprising a) and b);

[0011] wherein a) comprises a binding module that specifically binds to glycogen and a reporter module that is detectable by spectroscopy;

[0012] b) comprises a binding module that specifically binds to glycogen, a reporter module that is detectable by spectroscopy, and a nuclear localization signal module.

[0013] In some embodiments of the present invention, the binding module that specifically binds to glycogen is a carbohydrate binding module.

[0014] In some embodiments of the invention, the carbohydrate binding module comprises CBM20.

[0015] CBM20 specifically refers to the 263-354 amino acid sequence in the STBD1 protein (STBD1, starch binding domain 1 [Homo sapiens (human)] Gene ID: 8987). CBM20 is a glycogen-specific binding domain in living cells and can be replaced by the CBM20 domain of other proteins, such as CBM20 of AMPK-β1 and AMPK-β2. CBM20 can be derived from humans, mice or other animals. However, CBM20 cannot be replaced by other types of CBMs such as CBM1, CBM2, CBM21, CBM25 or any combination thereof, as the above CBMs cannot achieve the purpose of detecting glycogen.

[0016] In some embodiments of the invention, the spectroscopically detectable reporter moiety comprises a fluorescent protein.

[0017] In some embodiments of the present invention, the fluorescent protein includes ultraviolet fluorescent protein, blue fluorescent protein, cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein, red fluorescent protein, far-red fluorescent protein, near-infrared fluorescent protein, infrared fluorescent protein, sapphire fluorescent protein, long Stokes shift fluorescent protein, convertible fluorescent protein or any combination thereof.

[0018] In some embodiments of the present invention, the fluorescent protein comprises BFP, Sirius, TagBFP, mTagBFP2, Azurite, EBFP2, mKalama1, Sirius, Sapphire, T-Sapphire, ECFP, mAmetrine, Cerulean, mCerulean3, SCFP3A, CyPet, mTurguoise, mTurquoise2, monomeric Midoriishi-Cyan, Aquamarine, eCFP, TagCFP, mTFP1, AmCyan1, EGFP, Emerald, Superfolder GFP, monomeric AzamiGreen, TurboGFP, TagGFP2, mUKG, mWasabi, Clover, mNeonGreen, eGFP, AcGFP, ZGreen1, ZsYellow1, mBanana, EYFP, Topaz, Citrine, Venus, SYFP2, Ype t, IanRFP-deltaS83, mPapaya1, TagYFP, mOrange, mOrange2, monomer Kusabira-Orange, mKOk, mKO2, mTangerine, mNectarine, TagRFP, TagRFP-T, mApple, mRuby, mRuby2 , DsRed-Express2, DsRed-Express, tdTomato, DsRed-Monomer, DsRed-Monomer, DsRed2, AsRed2, mStrawberry, mCherry, HcRed1, FusionRed, mRaspberry, E2-Crim son, mPlum, HcRed-Tandem, mKate2, mNeptune, NirFP, TagRFP657, TagRFP675, iFP1.4, iRFP(iRFP713), iRFP670, iRFP682, iRFP702, iRFP720, iFP2.0, mIFP, mKeima Red, LSS-mKate1, LSS-mKate2, LSSmOrange, mBeRFP, PA-GFP, PATag RFP, Dendra2, Timer, PAmCherry, Kaede (green), Kaeda (red), KikGR1 (green), KikGR1 (red), PS-CFP2, mEos2 (green), mEos2 (red), mEos3.2 (green), mEos3.2 (red), PSmOrange, Dropna, or any combination thereof.

[0019] In some embodiments of the present invention, the fluorescent protein in a) is different from the fluorescent protein in b), for example, when the fluorescent protein in a) is monomeric green fluorescent protein, the fluorescent protein in b) may be blue fluorescent protein BFP.

[0020] In some embodiments of the present invention, the nuclear localization signal module is a polypeptide.

[0021] In some embodiments of the present invention, the nuclear localization signal module includes the SV40 NLS sequence, and the SV40 NLS sequence may be replaced by other protein nuclear localization signals.

[0022] In some embodiments of the present invention, the amino acid sequence of the nuclear localization signal module is shown in SEQ ID NO:6.

[0023] In some embodiments of the invention, the binding moiety that specifically binds to glycogen in a) is fused to the spectroscopically detectable reporter moiety.

[0024] In some embodiments of the present invention, the binding module that specifically binds to glycogen in b) is fused with the spectroscopically detectable reporter module and the nuclear localization signal module.

[0025] In some embodiments of the invention, the spectroscopically detectable reporter moiety is located at the C-terminus of the binding moiety that specifically binds to glycogen.

[0026] The inventors found in previous tests that when a spectroscopically detectable reporter module (fluorescent protein) is placed at the N-terminus of CBM20, it significantly affects the binding of CBM20 to glycogen and cannot be used to indicate glycogen.

[0027] In some embodiments of the present invention, the nuclear localization signal module is located at the N-terminus of the binding module that specifically binds to glycogen.

[0028] In some embodiments of the present invention, a) and b) are linked via a polypeptide with self-cleavage ability or an internal ribosome entry site sequence.

[0029] In some embodiments of the present invention, the polypeptide having self-cleavage ability comprises 2A peptide.

[0030] In some embodiments of the present invention, the 2A peptide includes at least one of T2A, E2A and F2A.

[0031] In some embodiments of the present invention, a tag sequence is connected to the N-terminus or C-terminus of the carbohydrate binding module.

[0032] In some embodiments of the present invention, the tag sequence includes an HA tag or a Flag tag, which can be used for affinity purification of proteins.

[0033] In some embodiments of the present invention, the amino acid sequence of the HA tag is MYPYDVPDYA (SEQ ID NO: 14), and the nucleotide sequence is atgtacccatacgatgttcctgactatgcg (SEQ ID NO: 13).

[0034] In some embodiments of the present invention, the amino acid sequence of the Flag tag is MDYKDDDDK (SEQ ID NO: 16), and the nucleotide sequence is atggactacaaggacgacga cgacaag (SEQ ID NO: 15).

[0035] In some embodiments of the present invention, the N-terminus of the binding module that specifically binds to glycogen in a1) is connected to an HA tag; the N-terminus of the binding module that specifically binds to glycogen in a1) is connected to a Flag tag.

[0036] In some embodiments of the present invention, the amino acid sequence of the probe is shown in SEQ ID NO:12.

[0037] In some embodiments of the present invention, the nucleotide sequence of the probe is shown in SEQ ID NO:11.

[0038] The above probe sequence specifically refers to the sequence combination of CBM20-AcGFP-P2A-NLS-CBM20-BFP formed by connecting the two parts a and b through the self-cleaving polypeptide P2A. The focus is on fusing CBM20, AcGFP, P2A, NLS, and BFP in a specific order to form a dFluoGPS glycogen probe. The a part and the b part of the probe can also be prepared separately, or the a and b parts can be prepared separately and transfected into the same cell to detect intracellular cytoplasmic and nuclear glycogen, but separate detection will increase the complexity of the operation process.

[0039] The second aspect of the present invention provides a biological material related to the probe of the first aspect of the present invention, wherein the biological material comprises at least one of b1) to b12):

[0040] b1) a nucleic acid molecule encoding the probe of the first aspect of the present invention;

[0041] b2) an expression cassette containing the nucleic acid molecule described in b1);

[0042] b3) a recombinant vector containing the nucleic acid molecule described in b1);

[0043] b4) a recombinant vector containing the expression cassette described in b2);

[0044] b5) a recombinant cell containing the nucleic acid molecule described in b1);

[0045] b6) a recombinant cell containing the expression cassette described in b2);

[0046] b7) a recombinant cell containing the recombinant vector described in b3);

[0047] b8) a recombinant cell containing the recombinant vector described in b4);

[0048] b9) a recombinant microorganism containing the nucleic acid molecule described in b1);

[0049] b10) a recombinant microorganism containing the expression cassette described in b2);

[0050] b11) a recombinant microorganism containing the recombinant vector described in b3);

[0051] b12) A recombinant microorganism containing the recombinant vector described in b4).

[0052] In some embodiments of the present invention, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:11.

[0053] In some embodiments of the invention, the transgenic animal cell line does not contain reproductive material.

[0054] In some embodiments of the present invention, the vector comprises a promoter, and the promoter is operably linked to the nucleic acid molecule.

[0055] In some embodiments of the present invention, the vector is independently selected from a non-pathogenic viral vector and a viral vector.

[0056] In some embodiments of the present invention, the viral vector comprises at least one of a lentiviral vector, an adenoviral vector, a baculoviral vector, a retroviral vector, a poxvirus vector, a Sendai virus vector, and a herpes simplex virus vector.

[0057] In some embodiments of the present invention, the non-viral vector includes at least one of a plasmid vector, a cationic polymer vector, chitosan, polyethyleneimine, a nanoparticle vector, and a liposome.

[0058] In some embodiments of the present invention, the vector is a plasmid vector, a phagemid, a viral vector (such as a PCDH lentiviral plasmid vector), a cell vector, a phage, a cosmid, a F cosmid, or an artificial chromosome.

[0059] In some embodiments of the present invention, the plasmid vector may be an optional plasmid, and the viral vector may be an optional virus.

[0060] In some embodiments of the present invention, the recombinant expression vector uses pET-28a as the original expression vector.

[0061] In some embodiments of the present invention, the cells include prokaryotic cells and eukaryotic cells; the cells are not new species of plants or animals.

[0062] In some embodiments of the present invention, the prokaryotic cells include Escherichia coli, Streptomyces, Bacillus subtilis and other bacteria well known in the art that can be used to express target proteins.

[0063] In some embodiments of the present invention, the eukaryotic cell comprises at least one of a yeast cell, a mammalian cell, a plant cell and an insect cell.

[0064] The third aspect of the present invention provides the use of the probe of the first aspect of the present invention or the biomaterial of the second aspect of the present invention in c1) or c2):

[0065] c1) Detection of glycogen;

[0066] c2) Preparing a product for detecting glycogen.

[0067] In some embodiments of the present invention, the product includes but is not limited to reagents, kits, and chips.

[0068] In some embodiments of the present invention, the detection of glycogen includes quantitative / qualitative detection of glycogen and monitoring / localization of glycogen in tissues / cells.

[0069] The fourth aspect of the present invention provides a product, comprising the probe according to the first aspect of the present invention or the biomaterial according to the second aspect of the present invention.

[0070] In some embodiments of the present invention, the product includes but is not limited to reagents, kits, and chips.

[0071] In some embodiments of the present invention, the product is used for the detection of glycogen.

[0072] In some embodiments of the present invention, the detection of glycogen includes quantitative / qualitative detection of glycogen and monitoring / localization of glycogen in tissues / cells.

[0073] The fifth aspect of the present invention provides a method for detecting glycogen, comprising the step of using the probe of the first aspect of the present invention, the biological material of the second aspect of the present invention or the product of the fourth aspect of the present invention to detect a sample to be detected.

[0074] In some embodiments of the present invention, the detection of glycogen includes quantitative / qualitative detection of glycogen, and monitoring / localization of glycogen in tissues / cells.

[0075] In some embodiments of the present invention, the method further comprises the step of detecting the fluorescent signal using an instrument capable of detecting the fluorescent signal (such as a fluorescent microscope).

[0076] This method can rapidly, effectively and in real time detect glycogen in the cytoplasm and nucleus of living cells through fluorescence microscopy technology, and can be applied to qualitative detection at the subcellular level of various types of cells.

[0077] The beneficial effects of the present invention are:

[0078] The present invention provides a probe (dFluoGPS glycogen probe), which can form fluorescent aggregates after the glycogen binding module binds to glycogen in the cytoplasm and nucleus through the binding module and nuclear localization signal specifically binding to glycogen, thereby qualitatively detecting glycogen at the subcellular level with high sensitivity.

[0079] The present invention provides a method for detecting glycogen, which can qualitatively detect glycogen at a subcellular level with high sensitivity. Compared with the traditional chemical detection method and PAS staining method, the dFluoGPS glycogen probe has higher sensitivity and specificity (Table 1). Specifically: the current glycogen detection method generally uses the traditional PAS staining (Periodic Acid-Schiff staining) and anthrone chemical quantitative detection method to detect intracellular glycogen. Experiments have shown that the anthrone chemical detection method cannot sensitively detect glycogen in the cell nucleus. PAS staining has a non-specific staining background and cannot indicate glycogen in the cell nucleus. The method provided by the present invention can simultaneously detect glycogen in the cytoplasm and the cell nucleus, and has a higher sensitivity (or signal-to-noise ratio) in detecting glycogen at the subcellular level.

[0080] Table 1 compares the effect of the method of the present invention and the existing method on detecting glycogen

[0081] BRIEF DESCRIPTION OF THE DRAWINGS

[0082] Figure 1 Schematic diagram of the genetic structure of the dFluoGPS glycogen probe.

[0083] Figure 2 This is a schematic diagram of the working principle of the dFluoGPS glycogen probe.

[0084] Figure 3 This is the map of the dFluoGPS glycogen probe expression vector.

[0085] Figure 4The response of dFluoGPS glycogen probe to glycogen at the subcellular level; wherein, A is the fluorescence micrograph of glycogen detection of dFluoGPS glycogen probe in A549 cells, B is the Western blot detection result of GYS1 gene knockout cells, C is the detection result of glycogen in A549 cells by dFluoGPS glycogen probe, D is the expression of cGPS and nGPS in A549 cells, E is the result of determination of glycogen content in wild-type cells and GYS1 gene knockout cells by anthrone colorimetric reagent; in the figure, ns means no significant difference, *** means p < 0.001.

[0086] Figure 5 dFluoGPS specifically binds to glycogen; A is dFluoGPS MT Schematic diagram of the probe genetic coding gene structure, B is dFluoGPS MT Fluorescence micrograph of the probe detecting glycogen in A549 cells. C is cGPS W334A and nGPS W334A Expression in A549 cells, D is dFluoGPS glycogen probe and dFluoGPS MT The detection results of the probe on glycogen in A549 cells; in the figure, *** represents p < 0.001.

[0087] Figure 6 dFluoGPS glycogen probe responds to glycogen depletion; A is a fluorescence micrograph of glycogen detection in A549 cells by dFluoGPS glycogen probe after glucose starvation, and B is a fluorescence micrograph of glycogen detection in A549 cells by FluoGPS glycogen probe after Forskolin treatment; in the figure, *** represents p < 0.001.

[0088] Figure 7 Anthrone chemical detection method (A) and PAS staining method (B) were used to detect glycogen in the cell nucleus; in the figure, ns means no significant difference, *** means p < 0.001.

[0089] Figure 8 The dFluoGPS glycogen probe can effectively detect glycogen at the subcellular level in other cells (HeLa and 293T); A is the dFluoGPS glycogen probe that can effectively detect glycogen at the subcellular level in a variety of wild-type cells, and B is the dFluoGPS glycogen probe that can effectively detect glycogen at the subcellular level in a variety of glycogen synthase (GYS1) gene-deficient (GYS1-KO) cells. DETAILED DESCRIPTION

[0090] The present invention is further described in detail below through specific examples.

[0091] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0092] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0093] Terminology explanation:

[0094] Glycogen: Glucose in cells is a polymer of sugar molecules connected by α-1,4- and α-1,6-glycosidic bonds under the action of metabolic enzymes such as glycogen synthase (GS) and glycogen branching enzyme (GBE). It is an important energy storage substance in organisms. When the body's blood sugar or energy supply is insufficient, glycogen will quickly break down to provide energy for the body's life activities.

[0095] Carbohydrate-binding module (CBM): Carbohydrate-binding module (CBM) is a protein domain that has the ability to fold autonomously and can specifically recognize and bind to polysaccharides such as glycogen and cellulose.

[0096] Fluorescent probe: A fluorescent protein molecule genetically encoded by a DNA molecule of a specific sequence, whose location and intensity changes can detect specific biological signal molecules in real time.

[0097] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0098] Example 1d Construction and expression of FluoGPS glycogen probe expression vector

[0099] (1) Design of dFluoGPS glycogen probe

[0100] Schematic diagram of the genetic structure of the dFluoGPS glycogen probe Figure 1As shown, it includes three parts: Part A is a fusion gene composed of a glycogen binding sequence gene CBM20 (nucleotide sequence such as SEQ ID NO: 1, amino acid sequence such as SEQ ID NO: 2) and a monomeric green fluorescent protein encoding gene AcGFP (nucleotide sequence such as SEQ ID NO: 3, amino acid sequence such as SEQ ID NO: 4), which is used for the detection of cytoplasmic glycogen (cytosol glycogen probe, cGPS); Part B is a fusion gene composed of a nuclear localization signal SV40 NLS sequence (nucleotide sequence such as SEQ ID NO: 5, amino acid sequence such as SEQ ID NO: 6), a glycogen binding sequence gene CBM20 and a blue fluorescent protein encoding gene BFP (nucleotide sequence such as SEQ ID NO: 7, amino acid sequence such as SEQ ID NO: 8), which is used for the detection of nuclear glycogen (nuclear glycogen probe, nGPS); Part A and Part B are composed of a connecting portion encoded by a self-cleaving polypeptide P2A sequence (nucleotide sequence such as SEQ ID NO: 9, amino acid sequence such as SEQ ID NO: 10), so as to realize the simultaneous detection of glycogen in the cytoplasm and the nucleus at the subcellular level.

[0101] The nucleotide sequence of the dFluoGPS glycogen probe is shown in SEQ ID NO:11, and the amino acid sequence is shown in SEQ ID NO:12. This sequence contains the glycogen binding domain CBM20 sequence and the fluorescent protein gene sequence. The CBM20 sequence is derived from the human STBD1 gene, and is fused with the monomeric fluorescent protein AcGFP and BFP gene coding sequences through DNA recombination technology to obtain the dFluoGPS reporter gene. The fluorescent protein can also be replaced with any other monomeric fluorescent protein to produce the same biological detection effect. The construction of the dFluoGPS coding sequence is a fusion gene obtained by molecular cloning and connection after gene fragment synthesis, and can also be constructed by direct synthesis. After obtaining the sensor gene sequence, it is cloned into a specific eukaryotic cell expression vector, and then the vector is introduced into the cell by viral transduction or gene transfection to express the protein encoded by it. When the probe binds to glycogen, a microscopic fluorescent aggregate is formed, and then the function of the glycogen probe is exerted. The CBM20 and fluorescent protein DNA sequences of STBD1 are synthesized from a biological company.

[0102] The working principle of dFluoGPS glycogen probe is shown in the figure Figure 2As shown in the figure, the dFluoGPS glycogen probe is mainly based on the specific binding of the glycogen binding region CBM20 and the glycogen molecule, and at the same time, by adding a nuclear localization signal, the probe can enter the cell nucleus to detect nuclear glycogen. By fusing CBM20 in the cytoplasm to express green fluorescent protein and CBM20 in the nucleus to express blue fluorescent protein, it is possible to simultaneously detect glycogen in the cytoplasm and the nucleus in living cells. Among them, cGPS and nGPS can also be prepared separately and transfected into cells at the same time to detect glycogen in the cytoplasm and the nucleus, but it increases the complexity of the operation.

[0103] (2) Construction of dFluoGPS glycogen probe expression vector

[0104] CBM20, AcGFP and BFP fragments were amplified by polymerase chain reaction (PCR), and PCDH lentiviral plasmid vector and PCR fragment were digested with restriction endonucleases for 1 hour. The digested products were recovered and purified using a nucleic acid purification kit, and then the digested plasmid vector and fragments were connected at 22°C for 1 hour using T4 DNA ligase. Finally, the ligation products were transformed using Stabl3 competent bacteria. After culturing for 12 hours, single clones were picked for identification to obtain the correctly expressed dFluoGPS glycogen probe expression vector. The vector construction map of dFluoGPS glycogen probe is shown in the figure. Figure 3 shown.

[0105] Example 2d Response of FluoGPS Glycogen Probe to Changes in Glycogen Content in Living Cells and Proof of Concept (POC)

[0106] In order to confirm that the dFluoGPS glycogen probe can detect the spatial distribution of glycogen in real time at the subcellular level, this example inhibited glycogen synthesis through glycogen synthesis inhibitor treatment, glucose starvation and genetic manipulation to confirm the concept. W334A The mutant control confirmed its specificity in binding to glycogen, and compared with the traditional glycogen detection method, it was confirmed that the dFluoGPS glycogen probe has a higher sensitivity. Finally, the dFluoGPS glycogen probe can be used to specifically detect glycogen in a variety of cells. The details are as follows:

[0107] (1) Response of dFluoGPS glycogen probe to glycogen

[0108] In order to verify the response of dFluoGPS glycogen probe to glycogen at the subcellular level, this example uses A549 cells, which are known to synthesize glycogen in the nucleus and cytoplasm. At the same time, CRISPR / Cas9 gene editing technology was used to knock out the glycogen synthase (GYS1) gene in A549 cells, and the gene deletion caused A549 cells to be unable to synthesize glycogen.

[0109] Wild A549 (WT) and GYS1 knockout cells (denoted as GYS1-KO or KO) were evenly plated in 6-well plates, with 5×10^5 cells per well. After 12 hours of cell attachment and growth, the dFluoGPS glycogen probe was transfected into the cells by PEI transfection. After 36 hours, 10% of the cells were evenly plated in 96-well glass-bottom plates. After 24 hours of attachment and growth, the expression of dFluoGPS in the two cells was observed by fluorescence microscopy. At the same time, the remaining 90% of the cells were collected for western blot protein level detection.

[0110] The specific process of cell PEI transfection is as follows: linear polyethyleneimine (Polyethylenimine, PEI) is used as the transfection reagent of plasmid. One day before transfection, the cells are digested with Trypsin-EDTA of appropriate concentration, and the cells are spread on the cell culture dish after blowing evenly with DMEM complete medium without antibiotics, and placed in a constant temperature incubator at 37°C and 5% CO2 for cultivation for 12 to 16 hours. The cell density before transfection is about 60 to 70%, and the transfection system is configured according to the ratio of 1 μg plasmid to 2 μL PEI, and the plasmid and PEI are fully mixed, and the room temperature is left to stand for 20 minutes. The transfection system is added to the cells, and the mixing is gently shaken back and forth, and the cell supernatant is sucked away after being placed in a constant temperature incubator at 37°C and 5% CO2 for 12 hours, and the DMEM complete medium without antibiotics is replaced to continue to cultivate. The expression of the plasmid can be observed under a fluorescent microscope within 24 to 48 hours of transfection.

[0111] Fluorescence microscopy results showed that the dFluoGPS glycogen probe was present as aggregates (punctate cells) in the cytoplasm and nucleus of more than 80% of wild-type cells, while in KO cells, both fluorescent proteins were diffuse, with only less than 20% of cells showing punctate aggregates ( Figure 4 Western blot results showed that GYS1 was not expressed in GYS1 knockout cells (KO). Figure 4 (middle B).

[0112] Wild-type A549 (WT) and GYS1 knockout cells (KO) were evenly plated in 6-well plates, with 5×10^5 cells per well. After 12 hours of cell attachment, nuclear-cytoplasmic separation experiments were performed to detect the localization expression of dFluoGPS in the cytoplasm and nucleus. At the same time, the traditional anthrone colorimetric reagent and PAS staining method (PAS kit staining method) were used to determine the glycogen content in normal cells and GYS1 knockout cells.

[0113] The specific process of nuclear cytoplasm separation experiment is as follows: Wash cells 1-2 times with 4℃ pre-cooled PBS in a culture dish, resuspend cells with Hypotonic buffer, and incubate on ice for 20-30 minutes. Add 10% NP-40 to a final concentration of 1%, vortex mix for 0.5-1 minute, centrifuge at 3000rpm at 4℃ for 10 minutes, the supernatant is the cytoplasmic component, and the precipitate is the nuclear component. Transfer the supernatant to a new 1.5mL centrifuge tube, wash the precipitate twice with 10 times the volume of Hypotonic buffer, centrifuge at 3000rpm at 4℃ for 10 minutes each time. Add High salt buffer to the nuclear precipitate, incubate on ice for 30 minutes, and ultrasonically disrupt. Centrifuge at 13000g at 4℃ for 10 minutes. The supernatant is the protein in the nuclear component, and the precipitate is insoluble protein and cell debris.

[0114] Anthrone colorimetric glycogen determination experimental operation: collect cells into 1.5mL centrifuge tubes, divide them into two tubes, discard the supernatant after centrifugation; add equal volumes of glycogen extract (30% KOH solution) or RIPA buffer, ultrasonically disrupt the cells, and boil at 95℃ for 1-2 hours; take out and cool, centrifuge at 12000rpm for 5 minutes at room temperature, and take the supernatant for testing. Weigh 0.01g of anthrone powder, add 600μL ddH2O, add 2.4mL concentrated sulfuric acid dropwise to mix, and prepare the anthrone reaction solution. Take 20μL of cell supernatant and add 260μL of anthrone reaction solution, boil at 95℃ for 15 minutes, cool and take 100μL to transfer to the ELISA plate, and measure the absorbance at a wavelength of 620nm.

[0115] Cell glycogen PAS staining assay (PAS kit (purchased from Solarbio, catalog number G1281) staining method) Experimental operation: Fix the cells with PAS fixative for 10 to 15 minutes, wash off the fixative with distilled water and dry the slices. Add oxidant and oxidize at room temperature for 15 to 20 minutes. Wash twice with distilled water for 2 minutes each. Add or immerse in Schiff staining solution and stain at room temperature in the dark for 10 to 20 minutes. Wash twice with sodium sulfite solution for 2 minutes each. Rinse with running water for 5 minutes. After drying the slices, observe the staining under a microscope.

[0116] The results showed that in WT cells, cGPS was mainly expressed in the cytoplasm, while nGPS was only expressed in the nucleus ( Figure 4 D). The glycogen content in normal cells and GYS1 gene knockout cells was determined using a traditional anthrone colorimetric reagent. The results showed that the glycogen content in cells dropped to an undetectable level after GYS1 gene knockout ( Figure 4 These results indicate that the dFluoGPS glycogen probe can form high-resolution fluorescent aggregates by binding to glycogen at the subcellular level in living cells.

[0117] (2) dFluoGPS glycogen probe specifically binds to glycogen in living cells

[0118] Previous studies have shown that the 334th amino acid of CBM is a key site for glycogen binding. In order to further confirm the specificity of dFluoGPS for glycogen binding, the 334th amino acid of CBM was mutated from tryptophan to alanine (W334A) in this example to construct a probe dFluoGPS that does not bind to glycogen. MT ( Figure 5 A, the construction process is the same as dFluoGPS). dFluoGPS was transfected by PEI MT The protein was transfected into A549 cells and its expression and glycogen binding were observed.

[0119] Results show dFluoGPS MT It has no glycogen binding ability and is diffuse in the cytoplasm and nucleus, while dFluoGPS can bind to glycogen and form bright aggregates ( Figure 5 Further nuclear-cytoplasmic separation experiments were performed to detect dFluoGPS MT Expression in cells, the results showed that cGPS W334A Mainly expressed in the cytoplasm, nGPS W334A Only expressed in the nucleus ( Figure 5 (C) These results indicate that dFluoGPS can specifically bind to glycogen to form high-resolution fluorescent aggregates to identify glycogen at the subcellular level in living cells, with good specificity.

[0120] (3) Response of dFluoGPS glycogen probe to glycogen depletion

[0121] When cells are cultured in a medium without glucose, the glycogen in the cells will be rapidly consumed. In order to explore the response of the dFluoGPS glycogen probe when glycogen is depleted in cells, in this example, A549 cells expressing the dFluoGPS glycogen probe were dispersed into a 96-well glass-bottomed dish, with 5000 cells / 100 μL culture medium (DMEM medium containing 10% FBS) in each well. After the cells were attached for 24 hours and cultured, they were changed to a medium without glucose for 6 hours, and the glycogen in the cytoplasm and nucleus after glucose starvation was detected.

[0122] The results are as follows Figure 6 As shown in A, after glucose starvation, it can be observed that the green fluorescence in the cytoplasm becomes diffuse. Compared with the glycogen in the cytoplasm, the glycogen aggregation points in the cell nucleus are more tolerant to glucose starvation, and a small amount of glycogen aggregation points still exist after starvation.

[0123] Forskolin is a commonly used adenylate cyclase activator that activates PKA kinase by increasing the level of cellular cAMP, thereby promoting glycogenolysis. In this example, after A549 cells expressing dFluoGPS glycogen probe were treated with 10 μM Forskolin for 12 hours, it was found that the glycogen aggregation points in the cells were significantly reduced, and the fluorescence signal was diffuse in both the cytoplasm and the nucleus (such as Figure 6 Middle B), indicating that the dFluoGPS glycogen probe can respond to drug-induced glycogen depletion.

[0124] Therefore, the dFluoGPS glycogen probe is well able to respond to glycogen depletion induced by glucose starvation and drug treatment.

[0125] In summary, under conditions of glycogen depletion or synthesis deficiency, the dFluoGPS glycogen probe is diffuse in the cell; under conditions of normal glycogen synthesis, the dFluoGPS glycogen probe binds to glycogen in the cytoplasm and nucleus to form highly recognizable fluorescent aggregates of different colors. Whether it is drug treatment, physiological stimulation or gene regulation operation, the dFluoGPS glycogen probe can specifically and qualitatively detect glycogen in the nucleus and cytoplasm with high sensitivity. In addition, the dFluoGPS glycogen probe is based on a genetically encoded multicolor fluorescent protein, which can be applied to glycogen detection at the subcellular level of various cells, and has a good detection cost advantage compared to glycogen antibody immunofluorescence staining.

[0126] Example 3: Detection of intracellular glycogen using traditional PAS staining (Periodic Acid-Schiff staining) and anthrone chemical quantitative detection method

[0127] In order to compare the sensitivity of dFluoGPS glycogen probe with traditional methods, this example uses these two traditional methods to detect glycogen in normally cultured A549 glycogen synthase GYS1 (WT) cells and GYS1 (KO) cells. First, the cytoplasm and nuclear components in WT and KO cells were separated using nuclear cytoplasm separation technology, and the glycogen content in the cytoplasm and nucleus was detected using anthrone chemical detection method and PAS staining method, respectively.

[0128] The experimental procedure for the determination of glycogen by anthrone colorimetric method is the same as that in Example 2 (1).

[0129] Cell glycogen PAS staining assay (PAS kit staining method) Experimental operation: Fix the cells with PAS fixative for 10-15 minutes, wash off the fixative with distilled water and dry the slices. Add oxidant and oxidize at room temperature for 15-20 minutes. Wash twice with distilled water, 2 minutes each time. Add or immerse in Schiff staining solution and stain at room temperature in the dark for 10-20 minutes. Wash twice with sodium sulfite solution, 2 minutes each time. Rinse with running water for 5 minutes. After drying the slices, observe the staining under a microscope.

[0130] The traditional anthrone chemical detection method detects the glycogen content in the cytoplasm and nucleus respectively, and the results are as follows Figure 7 As shown in A, the glycogen content in the WT cytoplasm is more than 10 times higher than that in the KO cells, while the glycogen content in the cell nucleus is at a low level background for both WT and KO cells, with no significant difference. This result shows that the glycogen content in the cell nucleus is very low, and the anthrone chemical detection method cannot sensitively detect glycogen in the WT cell nucleus. As mentioned above, the dFluoGPS glycogen probe of the present invention can sensitively indicate glycogen in the cell nucleus, and has higher sensitivity than the traditional anthrone chemical detection method.

[0131] PAS staining was used to stain WT and KO cells, and DAPI was used to stain the cell nucleus. The purple-red dot-like aggregates in the cells were glycogen granules. Figure 7 As shown in B, there are different degrees of punctate aggregation in both WT and KO cells, and glycogen staining in the nucleus cannot be clearly observed, indicating that PAS staining has a nonspecific staining background and cannot indicate glycogen in the cell nucleus.

[0132] Therefore, compared with traditional anthrone chemical detection and PAS staining, the dFluoGPS glycogen probe has a higher sensitivity (or signal-to-noise ratio) in detecting glycogen at the subcellular level.

[0133] Example 4d FluoGPS glycogen probe is applied to various cell lines at the living cell level to effectively detect glycogen at the subcellular level

[0134] This example is used to verify whether the dFluoGPS glycogen probe can be used in various cell lines to effectively detect glycogen at the subcellular level at the living cell level, as follows:

[0135] The CRISPR / Cas9 gene editing technology was used to knock out the glycogen synthase (GYS1) gene in HeLa and 293T cells. The gene deletion resulted in the inability of HeLa and 293T cells (GYS1-KO) to synthesize glycogen.

[0136] Wild-type and GYS1-KO HeLa and 293T cells were evenly plated into 96-well glass-bottomed dishes, with 5000 cells / 100 μL culture medium (DMEM culture medium containing 10% FBS) in each well. After the cells were attached for 12 hours and cultured, the dFluoGPS glycogen probe was transfected into different cell lines by PEI (the process was the same as in Example 2), and the fluorescent aggregate signal was observed by fluorescence microscopy after 36 to 48 hours.

[0137] like Figure 8 As shown in A, the glycogen probe in different WT cells showed punctate aggregation, and the glycogen in the cytoplasm and the nucleus could be clearly distinguished in the merged image, while the dFluoGPS in the glycogen synthesis-deficient (GYS1-KO) cells showed a diffuse state ( Figure 8 The above results show that the dFluoGPS glycogen probe is effective in a variety of cells and can be used in a variety of cell lines at the living cell level to effectively detect glycogen at the subcellular level.

[0138] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A probe comprising a) and b); in, a) comprising a binding module that specifically binds to glycogen and a reporter module that is detectable by spectroscopy; b) comprises a binding module that specifically binds to glycogen, a reporter module that is detectable by spectroscopy, and a nuclear localization signal module.

2. The probe according to claim 1, characterized in that The binding module that specifically binds to glycogen is a carbohydrate binding module; and / or, the spectroscopically detectable reporter module comprises a fluorescent protein; Preferably, the carbohydrate binding module comprises CBM20; Preferably, the fluorescent protein comprises ultraviolet fluorescent protein, blue fluorescent protein, cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein, red fluorescent protein, far-red fluorescent protein, near-infrared fluorescent protein, infrared fluorescent protein, sapphire fluorescent protein, long Stokes shift fluorescent protein, switchable fluorescent protein or any combination thereof; Preferably, a tag sequence is connected to the N-terminus or C-terminus of the carbohydrate binding module.

3. The probe according to claim 1, characterized in that The nuclear localization signal module is a polypeptide; Preferably, the nuclear localization signal module includes an SV40 NLS sequence; Preferably, the amino acid sequence of the nuclear localization signal module is as shown in SEQ ID NO:

6.

4. The probe according to any one of claims 1 to 3, characterized in that The binding module that specifically binds to glycogen in a) is fused with the reporter module that can be detected by spectroscopy; and / or, the binding module that specifically binds to glycogen in b) is fused with the reporter module that can be detected by spectroscopy and a nuclear localization signal module; Preferably, the spectroscopically detectable reporter module is located at the C-terminus of the binding module that specifically binds to glycogen; Preferably, the nuclear localization signal module is located at the N-terminus of the binding module that specifically binds to glycogen.

5. The probe according to any one of claims 1 to 3, characterized in that The a) and b) are linked by a polypeptide with self-cleavage ability or an internal ribosome entry site sequence; Preferably, the polypeptide having self-cleavage ability comprises 2A peptide; Preferably, the 2A peptide comprises at least one of T2A, E2A and F2A.

6. The probe according to claim 5, characterized in that The amino acid sequence of the probe is shown in SEQ ID NO:

12.

7. A biological material associated with the probe according to any one of claims 1 to 6, wherein the biological material comprises at least one of b1) to b12): b1) a nucleic acid molecule encoding the probe according to any one of claims 1 to 6; b2) an expression cassette containing the nucleic acid molecule described in b1); b3) a recombinant vector containing the nucleic acid molecule described in b1); b4) a recombinant vector containing the expression cassette described in b2); b5) a recombinant cell containing the nucleic acid molecule described in b1); b6) a recombinant cell containing the expression cassette described in b2); b7) a recombinant cell containing the recombinant vector described in b3); b8) a recombinant cell containing the recombinant vector described in b4); b9) a recombinant microorganism containing the nucleic acid molecule described in b1); b10) a recombinant microorganism containing the expression cassette described in b2); b11) a recombinant microorganism containing the recombinant vector described in b3); b12) A recombinant microorganism containing the recombinant vector described in b4).

8. Use of the probe according to any one of claims 1 to 6 or the biomaterial according to claim 7 in c1) or c2): c1) Detection of glycogen; c2) preparing a product for detecting glycogen.

9. A product comprising the probe according to any one of claims 1 to 6 or the biomaterial according to claim 7.

10. A method for detecting glycogen, comprising the step of using the probe according to any one of claims 1 to 6, the biological material according to claim 7 or the product according to claim 9 to detect a sample to be detected; Preferably, the detection of glycogen includes quantitative / qualitative detection of glycogen, and monitoring / localization of glycogen in tissues / cells.

Images