Staphylococcus vorus X9 with antibiotic degradation function and application of staphylococcus vorus X9 in antibiotic degradation

Abstract

The invention discloses staphylococcus vorus X9 with an antibiotic degradation function and application of the staphylococcus vorus X9 in antibiotic degradation, and belongs to the technical field of microorganisms. The staphylococcus vorus X9 is preserved in the China General Microbiological Culture Collection Center (CGMCC), and the preservation number is CGMCC No.32162. The strain has an excellent degradation effect on erythromycin and oxytetracycline, so that the strain has application value and prospect in the field of antibiotic degradation. Therefore, the compound can be prepared into a microbial agent which is used for purifying an environment polluted by antibiotics.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to a strain of Staphylococcus vorticellii X9 with the function of degrading antibiotics and use thereof in degrading antibiotics. Background Art

[0002] The pollution problem of antibiotics has become more serious due to their widespread use. Current medical and animal husbandry production depends on the supply of antibiotics. This dependence has led to the extensive use of antibiotics, which has further led to the pollution of antibiotic residues as well as antibiotic-resistant bacteria (ARB) and genes (ARG) entering soil and water bodies through fertilizer application in agricultural fields and through wastewater treatment processes. Therefore, both wastewater treatment plants and animal husbandry are considered to be important sources of ARB and ARG. These polluted habitats have high densities of commensal and environmental bacteria, providing a favorable environment for the selection, development and spread of antibiotic resistance. Antibiotics as well as ARB and ARG are now regarded as emerging pollutants. The overuse of antibiotics is not limited to human health care, but also occurs in other fields such as aquaculture, animal husbandry and veterinary applications. Since antibiotics also have harmful effects on non-target species, their accumulation in the environment threatens the survival of other organisms and may cause bacterial strains to develop resistance.

[0003] Biodegradation refers to the process of degrading organic matter in the environment through the biological action of living microorganisms, recycling waste, and decomposing organic matter into nutrients. In this process, mineralized complex compound molecules are transformed into simple forms, such as CO2, H2O and other inorganic compounds. Compared with other non-biological degradation methods, biodegradation is relatively low in cost in actual production and life, clean and pollution-free, and environmentally friendly. Therefore, it is of great significance to seek a microorganism that can degrade antibiotics. Summary of the invention

[0004] The invention provides a strain of Staphylococcus warneri X9, which is deposited in the General Microbiological Center of China Microbiological Culture Collection Administration, with a deposit number of CGMCC No.32162.

[0005] The present invention provides a microbial preparation, which contains the above-mentioned Staphylococcus woersii X9.

[0006] The above-mentioned microbial preparation is prepared by the following method:

[0007] Staphylococcus vorticella X9 was inoculated into MRS liquid medium and placed in a shaker at 37°C for 48 h. 600 When the ratio is 1.2, the microbial agent is obtained.

[0008] The present invention provides the use of the above-mentioned Staphylococcus woersii X9 or its microbial preparation in degrading antibiotics; the antibiotics are preferably erythromycin and / or oxytetracycline.

[0009] The invention provides a method for degrading antibiotics, comprising the following steps: inoculating a microbial preparation into a sample containing the antibiotics, and performing fermentation culture to degrade the antibiotics in the sample.

[0010] In the above degradation method, the inoculation amount of the microbial preparation is selected from 0.5 to 2%, preferably 1%.

[0011] In the above degradation method, the antibiotic is selected from erythromycin and / or oxytetracycline.

[0012] In the above degradation method, the fermentation culture conditions are: static culture at 37°C for 48 hours.

[0013] The beneficial effects of the present invention are:

[0014] The present invention isolates and obtains a strain of Staphylococcus woermannii, which has excellent degradation effects on erythromycin and oxytetracycline, and thus has application value and prospects in the field of antibiotic degradation. Therefore, it can be prepared into a microbial agent for purifying an environment contaminated by antibiotics. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 is the colony morphology of strain X9;

[0016] Figure 2 Phylogenetic tree of strain X9 based on 16S rDNA. DETAILED DESCRIPTION

[0017] Bacterial isolation and identification:

[0018] In May 2023, soil from the surface to 5 cm deep was collected at the original manure accumulation area around Wucheng County, Dezhou City, Shandong Province (115.9869 east longitude, 37.2642 north latitude), and the samples were placed in self-sealing bags and stored in a 4°C refrigerator in the laboratory. Mix the soil samples, accurately weigh 25g of the soil samples, add them to 250mL of MRS broth culture medium, and culture them at 37°C for 48h to obtain bacterial culture solution. 1mL of bacterial culture solution was inoculated into MRS broth containing 2mL of 0.05mg / mL erythromycin and 0.1mg / mL oxytetracycline, respectively, and cultured at 37°C for 48h. The obtained bacterial solution was streaked on MRS solid culture medium containing erythromycin or oxytetracycline, and cultured at 37°C for 48h. Single colonies were picked and streaked on plates containing antibiotics, and the colonies grown on both solid plates were purified three times and then preserved. A strain of bacteria was obtained, and the strain was numbered X9.

[0019] According to the method described in the Bergey's Manual of Bacterial Identification (8th edition), the morphological characteristics and physiological and biochemical characteristics of strain X9 were identified. The specific results are as follows:

[0020] (1) Morphological characteristics

[0021] Strain X9 was inoculated on MRS solid medium and cultured at 37°C for 48 hours. The colony morphology included single, double, short chain or irregular grape-like arrangement. Figure 1 shown.

[0022] (2) Biological characteristics

[0023] The bacteria are purple after Gram staining, indicating that they are Gram-positive bacteria.

[0024] (3) Genetic characteristics

[0025] 16S rDNA sequencing: The DNA of the strain to be tested was extracted using a bacterial genome kit and PCR amplified using 16S rDNA universal primers 27F and 1492R.

[0026] Primer 27F (5′-3′): AGAGTTTGATCCTGGCTCAG;

[0027] Primer 1492R (5′-3′): TACGGTTACCTTGTTACGACTT;

[0028] The amplification system was (50 μL): 2 μL DNA template, 21 μL ddH2O, 1 μL primer 27F, 1 μL primer 1492R, and 25 μL 2xMix.

[0029] Amplification reaction conditions:

[0030] Pre-denaturation at 95°C for 5 min, 95°C for 30 s → 55°C for 40 s → 72°C for 10 s, 35 cycles, and finally extension at 72°C for 10 min.

[0031] Primer synthesis and sequencing were completed by Qingdao Ruibo Xingke Biotechnology Co., Ltd.

[0032] The sequencing results are as follows:

[0033] 16S rDNA sequence:

[0034]

[0035] A BLAST comparison was performed on the NCBI website, and a phylogenetic tree was constructed using MEGA 11 using the 16S rDNA sequences of the model strain and strain X9, as shown in Figure 2 As shown, the results showed that strain X9 belongs to the genus Staphylococcus. Combined with its morphological and biological characteristics, the bacteria was identified as Staphylococcus warneri. The bacteria was deposited in the General Microbiology Center of China Microorganism Culture Collection Committee (referred to as CGMCC, address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code 100101) on October 9, 2024, with the deposit number CGMCC No. 32162.

[0036] Other materials used in the present invention, if not otherwise stated, can be obtained through commercial channels. Other terms used in the present invention, unless otherwise specified, generally have the meanings commonly understood by those of ordinary skill in the art. The present invention is further described in detail below in conjunction with specific examples and with reference to data. The following examples are only for illustrating the present invention, and are not intended to limit the scope of the present invention in any way.

[0037] Example 1

[0038] Antibiotic degradation function verification:

[0039] Erythromycin stock solution was prepared with anhydrous ethanol at 0.5 mg / mL, and oxytetracycline hydrochloride stock solution was prepared with sterile water at 1 mg / mL.

[0040] The steps for preparing the microbial preparation are as follows:

[0041] The slant-stored Staphylococcus aureus X9 was inoculated into MRS liquid culture medium and cultured at 37°C for 48 h. 600 When the ratio is 1.2, the microbial agent is obtained.

[0042] The microbial preparation was inoculated into 10mL MRS liquid culture medium containing erythromycin (5μg / mL) or oxytetracycline (10μg / mL) at an inoculum of 1%, and cultured at 37℃ for 48h, then centrifuged at 12000r / min for 5min, all the supernatant was taken, 5 times the volume of acetonitrile was added, vortexed for 1min to fully mix, centrifuged at 12000r / min for 5min, 7.5mL of supernatant was filtered through a 0.22μm organic filter membrane and then rotary evaporated. After rotary evaporation at 60℃ for 25min, 400μL of anhydrous ethanol was added to the bottle, vortexed for 2min and then ultrasonicated for 10min, repeated three times, and the fermentation broth was concentrated 87 times. The concentrated solution was drawn into a centrifuge tube, and the supernatant was taken for high-performance liquid chromatography analysis after centrifugation at 12000r / min. The degradation rate of erythromycin and oxytetracycline by Staphylococcus vorticus X9 was calculated.

[0043] HPLC chromatographic conditions:

[0044] (1) Chromatographic conditions of erythromycin

[0045] Chromatographic column: C18 column (2.1mm×50mm); mobile phase: acetonitrile:phosphate buffer (20:80~80:20); flow rate: 0.3mL / min; injection volume: 5μL; column temperature: 30℃; detection wavelength: 210nm.

[0046] (2) Chromatographic conditions of oxytetracycline hydrochloride

[0047] Chromatographic column: C18 column (2.1mm×50mm); mobile phase: methanol: 3M phosphate buffer (20:80~80:20); flow rate: 0.3mL / min; injection volume: 5μL; column temperature: 30℃; detection wavelength: 355nm.

[0048] The HPLC peak area is proportional to the solution concentration, so the peak area is used to calculate the degradation rate in the present invention, and the formula is as follows:

[0049] Degradation rate % = (antibiotic peak area of ​​culture supernatant before X9 fermentation - antibiotic peak area of ​​culture supernatant after X9 fermentation) / antibiotic peak area of ​​culture supernatant before X9 fermentation * 100;

[0050] The test results are shown in Table 1:

[0051] Table 1 Antibiotic degradation rate of strain X9

[0052]

[0053] As shown in Table 1, the degradation rate of strain X9 for oxytetracycline reached 67.6%, and the degradation rate for erythromycin was as high as 97.3%, which showed excellent antibiotic degradation effect.

[0054] Example 2

[0055] This example discusses the main factors affecting the degradation of antibiotics by strains in farmland in North China, such as temperature (20°C, 25°C, 30°C, 35°C, 37°C), pH (6, 7, 8, 9, 10) and inoculum size (0.5%, 1%, 1.5%, 2%, 2.5%). The initial conditions of each influencing factor are temperature 37°C, pH 5.7, and inoculum size 1%. When performing a single factor experiment, only one of the factors is changed, and the other factors are the same as the initial conditions. The fermentation medium adopts MRS liquid medium, and its pH is 5.7.

[0056] The specific operation is as follows: inoculate the Staphylococcus aureus X9 stored on the slant into MRS liquid culture medium, place it in a shaker, and culture it at 37°C for 48 hours to obtain the microbial agent seed liquid. At this time, OD 600 According to the single-factor experimental design, it was inoculated into the fermentation medium of each experimental group and cultured at the corresponding temperature for 48 hours. After the experiment, the growth of the strain and the degradation of antibiotics in the fermentation liquid of each experimental group were measured.

[0057] In the fermentation medium containing erythromycin, the optimal growth temperature of strain X9 is 30℃, the optimal pH is 8, and the optimal inoculum size is 1%. In the fermentation medium containing oxytetracycline, the optimal growth temperature of strain X9 is 37℃, the optimal pH is 7, and the optimal inoculum size is 1%. After the fermentation, the fermentation liquid of each experimental group was concentrated 87 times by rotary evaporation, and the antibiotics contained in all the concentrated liquids were still below the detection limit, which shows that the strain has good universality to the environment and can degrade antibiotics to ng / L level and below.

[0058] The above is only a preferred embodiment of the present invention, and does not limit the present invention in other forms. Any technician familiar with the profession may use the above disclosed technical content to change or modify it into an equivalent embodiment with equivalent changes. However, any simple modification, equivalent change and modification made to the above embodiment according to the technical essence of the present invention without departing from the technical solution of the present invention still belongs to the protection scope of the technical solution of the present invention.

Claims

1. A strain of Staphylococcus warneri X9, characterized in that: The strain is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the deposit number being CGMCC No.32162.

2. A microbial preparation, characterized in that: The preparation contains the Staphylococcus woermannii X9 according to claim 1.

3. The microbial preparation according to claim 2, characterized in that Prepared by the following method: The Staphylococcus vorticella X9 described in claim 1 was inoculated into MRS liquid culture medium, placed in a shaker, and cultured at 37°C for 48 hours. 600 When the ratio is 1.2, the microbial agent is obtained.

4. Use of the Staphylococcus vorticelli X9 described in claim 1 or the microbial preparation described in claim 2 in degrading antibiotics.

5. The use according to claim 4, characterized in that: The antibiotics are erythromycin and / or oxytetracycline.

6. A method for degrading antibiotics, characterized in that: The method comprises the following steps: inoculating the microbial preparation according to claim 2 into a sample containing antibiotics, and performing fermentation culture to degrade the antibiotics in the sample.

7. The method according to claim 6, characterized in that The inoculation amount of the microbial preparation is selected from 0.5 to 2%.

8. The method according to claim 7, characterized in that The inoculation amount of the microbial preparation was 1%.

9. The method according to claim 6, characterized in that The antibiotic is selected from erythromycin and / or oxytetracycline.

10. The method according to claim 6, characterized in that The fermentation culture conditions are: static culture at 37° C. for 48 hours.

Images