Construction method and application of high-nucleoside-yield strain

Abstract

The invention provides a construction method and application of a high-nucleoside-yield strain. A gene encoding a transcription inhibition factor ccpN in a microorganism is subjected to initiation codon weakening GTG to TTG (or in other ways, the activity of the protein encoded by the ccpN is reduced compared with that of a wild type) or gene fragment deletion (or in other ways, the protein encoded by the ccpN is inactive), so that the nucleoside production capacity of the strain is enhanced compared with that of an unmodified strain.

Description

Technical Field

[0001] The invention relates to the fields of bioengineering and microbial fermentation, and in particular to a construction method of a high-yield nucleoside strain and its application. Background Art

[0002] Nucleoside is a general term for a class of glycosides. Nucleoside is a component of nucleic acid and nucleotide. Nucleoside is formed by the condensation of D-ribose or DZ-deoxyribose with pyrimidine base or purine base. Nucleoside is generally a colorless crystal, insoluble in common organic solvents, easily soluble in hot water, with a melting point of 160-240°C. Nucleosides generated from D-ribose are called ribonucleosides, which participate in the composition of RNA, and nucleosides generated from D-α-deoxyribose are called deoxyribonucleosides, which participate in the composition of DNA. D-ribose condenses with adenine, guanine, cytosine, thymine or uracil to generate the corresponding adenine ribonucleoside, guanine ribonucleoside, cytosine ribonucleoside, thymine ribonucleoside and uracil ribonucleoside, which are respectively referred to as adenosine (A), guanosine (G), cytidine (C), thymidine (T) and uridine (U).

[0003] Guanosine (guanosine) and inosine (inosine) play a wide range of roles in the food and pharmaceutical industries. In the food field, guanosine and inosine are important precursors of disodium guanylate and disodium inosinate, respectively. Disodium guanylate and disodium inosinate are used in combination as food flavor enhancers, and are widely used in condiments such as chicken essence and soy sauce. In the pharmaceutical field, guanosine and inosine can be used as pharmaceutical intermediates for a variety of antiviral drugs, such as acyclovir, triazole nucleoside, and sodium guanosine triphosphate, which all require guanosine as a synthetic raw material. Inosine is an important precursor of inosinic acid, and inosinic acid can be used as a precursor for the synthesis of adenosine (AMP) and guanylate (GMP), which is suitable for leukopenia, thrombocytopenia, various heart diseases, acute and chronic hepatitis, cirrhosis, etc. caused by various reasons. In addition, it can also treat central retinitis and optic atrophy.

[0004] Adenosine is adenine nucleoside, and its chemical name is 6-amino-9-β-D-ribofuranosyl-9-hydrogen purine. It is the product of adenine nucleotide dephosphorylation and is an important nucleotide derivative. Adenosine is an endogenous nucleoside that is found throughout human cells. It can directly enter the myocardium and generate adenosine acid through phosphorylation, and participate in myocardial energy metabolism. It also participates in dilating coronary vessels and increasing blood flow. Adenosine has physiological effects on the cardiovascular system and many other systems and tissues of the body. In addition to being used as a specific drug for treating the heart, adenosine is also an important intermediate for the synthesis of adenosine triphosphate (ATP), adenine, adenosine acid, and adenosine arabinoside, and is widely used in the pharmaceutical and other industries.

[0005] At present, microbial fermentation is the main method for producing nucleosides, and the main microorganisms used include Bacillus subtilis, Bacillus amyloliquefaciens or Bacillus pumilus. In the process of selecting and transforming the growing strains, ultraviolet mutagenesis and diethyl sulfate mutagenesis breeding are used to selectively select high-yielding strains of nucleosides; or according to the metabolic pathways and regulatory mechanisms of nucleotides in bacteria, the genetic background and characteristics of the strains are deeply understood, and the strains are purposefully transformed through metabolic engineering methods to obtain production strains with excellent traits and high nucleoside production. However, the fermentation performance of nucleoside strains is still poor, and the conversion rate of nucleosides is still low, which cannot meet the needs of large-scale industrial production. Summary of the invention

[0006] The purpose of the present invention is to provide a construction method of a high-nucleoside-producing strain and its application.

[0007] To achieve the purpose of the present invention, in a first aspect, the present invention provides a modified microorganism, wherein the activity of the transcription repressor ccpN is reduced or lost compared to an unmodified microorganism, and the microorganism has an enhanced nucleoside production capacity compared to an unmodified microorganism.

[0008] In the present invention, the reference sequence number of the transcription repressor ccpN in NCBI is NP_390403.1.

[0009] Furthermore, the activity reduction or loss of the transcriptional repressor ccpN in the microorganism is achieved by selecting from the following 1)-3), or an optional combination:

[0010] 1) Reducing or losing the transcriptional repressor ccpN by changing the amino acid sequence of the transcriptional repressor;

[0011] 2) reducing or losing the transcriptional repressor ccpN by changing the nucleotide sequence encoding the transcriptional repressor ccpN;

[0012] 3) Loss of the transcriptional repressor ccpN by knocking out the coding sequence of the transcriptional repressor ccpN.

[0013] Furthermore, mutagenesis, site-directed mutagenesis or homologous recombination are used to reduce the expression of the gene encoding the transcription repressor ccpN or knock out the gene encoding the transcription repressor ccpN.

[0014] In a specific embodiment of the present invention, the reduction or loss of the activity of the transcriptional repressor ccpN is achieved in the following manner: the start codon of the gene encoding the transcriptional repressor ccpN is mutated from gtg to ttg.

[0015] The microorganism can be Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus or Escherichia coli, etc. For example, the starting strain is B. subtilis 168, B. subtilis A5 (the construction method of strain B. subtilis A5 is shown in CN110257315B), Ba 836 (see CN112574934A).

[0016] In a second aspect, the present invention provides a method for constructing a nucleoside-producing strain, the method comprising: utilizing genetic engineering means to inactivate or weaken the coding gene of the transcriptional repressor ccpN in the microorganism.

[0017] The weakening is achieved by selecting from the following a) to c), or any combination thereof:

[0018] a) reducing or losing the transcriptional repressor ccpN by changing the amino acid sequence of the transcriptional repressor;

[0019] b) reducing or losing the transcriptional repressor ccpN by changing the nucleotide sequence encoding the transcriptional repressor ccpN;

[0020] c) Loss by knocking out the coding sequence of the transcriptional repressor ccpN.

[0021] The weakening method can be selected from at least one of mutagenesis, site-directed mutagenesis, homologous recombination, and the like.

[0022] Preferably, the weakening is achieved in the following manner: the start codon of the gene encoding the transcriptional repressor ccpN is mutated from gtg to ttg.

[0023] In a third aspect, the present invention provides a recombinant bacterium constructed according to the method.

[0024] In a fourth aspect, the present invention provides the use of the microorganism or the recombinant bacteria constructed according to the method in the fermentation production of nucleosides or nucleoside derivatives or in increasing the fermentation yield of nucleosides or nucleoside derivatives.

[0025] The nucleoside derivatives of the present invention include but are not limited to:

[0026] ① Adenosine and adenosine-related derivatives, such as adenosine triphosphate (ATP), adenine, adenylic acid, adenosine arabinoside, etc.;

[0027] ②Inosine and its derivatives, such as inosinic acid, guanylic acid, adenylic acid, etc.;

[0028] ③Guanosine and guanosine-related derivatives, such as guanine, guanylic acid, riboflavin, diacetylguanylic acid, etc.

[0029] In a fifth aspect, the present invention provides a method for producing nucleosides, the method comprising the steps of:

[0030] i) culturing the microorganism or the recombinant bacteria constructed according to the method to obtain a culture;

[0031] ii) collecting the produced nucleosides from the culture obtained in step i).

[0032] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0033] The present invention provides a Bacillus subtilis or Bacillus amyloliquefaciens, wherein the initiation codon of a gene encoding a transcriptional repressor ccpN in the cell is weakened GTG→TTG (or other methods so that the activity of the protein encoded by ccpN is reduced compared with the wild type) or the gene fragment is deleted (or other methods so that the protein encoded by ccpN is inactive), so that the ability of the strain to produce nucleosides is enhanced compared with that of an unmodified strain.

[0034] Mutant strain B. subtilis A0057 (ccpN G1T The adenosine production of the mutant strains B.subtilis A0058 (ccpN strain) and B.subtilis A0059 (△ccpN strain) increased from 5.1 g / L to 5.9 g / L and 6.2 g / L, respectively, and the inosine production increased from 0.8 g / L to 1.1 g / L and 1.4 g / L, respectively, compared with the starting strain B.subtilis 168. G1T The adenosine production of the two strains (strain) and B.subtilis A0060 (△ccpN strain) was increased from 7.9 g / L to 8.5 g / L and 9.0 g / L, respectively, and the inosine production was increased from 1.0 g / L to 1.5 g / L and 1.9 g / L, respectively, compared with the original strain B.subtilis A5. The ccpN start codon in a guanosine-producing strain was weakened or knocked out to obtain the modified strains B.a8429 (ccpN G1T strain) and B.a8430 (△ccpN strain), the guanosine production increased from 2g / L to 2.7g / L and 3.5g / L respectively; at the same time, the strain's ability to produce inosine was tested, which increased from 0.6g / L to 1.2g / L and 1.6g / L respectively.

[0035] The above mutations can be applied to Bacillus subtilis and Bacillus amyloliquefaciens, but are not limited to the above two strains. They can also be applied to host bacteria such as Bacillus pumilus and Escherichia coli to produce nucleosides such as inosine, guanosine, adenosine, etc. or corresponding nucleoside derivatives such as hypoxanthine, inosinic acid, guanine, guanylic acid, riboflavin, diacetylguanylic acid, etc. DETAILED DESCRIPTION

[0036] The present invention aims to provide a method for producing purine nucleosides using ccpN mutant bacteria, wherein ccpN in the microorganism is weakened or inactivated so that its ability to produce purine nucleosides is enhanced.

[0037] The study found that by modifying the transcriptional repressor ccpN (encoded by the ccpN gene) of Bacillus subtilis or Bacillus amyloliquefaciens, the microorganism can efficiently and quickly generate adenine nucleosides, guanine nucleotides or inosine nucleosides, and successfully created a new microorganism capable of efficiently producing nucleosides, thereby completing the present invention.

[0038] The ccpN gene is weakened or inactivated, and the weakening or inactivation methods include weakening the start codon or gene knockout, etc., so that the activity of the protein encoded by ccpN is reduced or inactive compared with the wild type, but it is not limited to the above-mentioned modification methods.

[0039] The present invention is the first to modify the ccpN gene in Bacillus subtilis or Bacillus amyloliquefaciens to obtain corresponding mutants capable of efficiently producing nucleosides, and successfully create microorganisms capable of efficiently producing nucleosides.

[0040] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are all based on conventional experimental conditions, such as Sambrook et al. Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or the conditions recommended by the manufacturer's instructions.

[0041] The primer names and primer sequences involved in the following examples are shown in Table 1.

[0042] Table 1 Primer names and sequence information

[0043] Primer Name Primer Sequence (5′-3′) <![CDATA[ccpN G1T -1f]]> acaaaataaggatcctctagaattcttcttgaccgcaactg <![CDATA[ccpN G1T -1r]]> gtttatttagttcgatcgtactcaAcaccttttcacttcatagctatgta <h2 style=";text-align:left;direction:ltr"><![CDATA[ccpN <h2 style=";text-align:left;direction:ltr"> G1T <h2 style=";text-align:left;direction:ltr"> -2f]]><h2 style=";text-align:left;direction:ltr"> tacatagctatgaagtgaaaaggtgTtgagtacgatcgaactaaataaac <![CDATA[ccpN G1T -2r]]> gccaagcttgcatgcctgcagggaatccgatacaacatagatgatg △ccpN-1f acaaaataaggatcctctagaattcttcttgaccgcaactg △ccpN-1r tgtgaacagggaccgatgtcaccttttcacttcatagctatgta △ccpN-2f tacatagctatgaagtgaaaaggtgacatcggtccctgttcaca △ccpN-2r gccaagcttgcatgcctgcagtagacgttcttgacacgcc pckA-F agccttattaacatgtccaa pckA-R tcgtgctttcttcctccac <![CDATA[B8ccpN G1T -1f]]> acaaaataaggatcctctagaaggttctcaggatccgtacg <![CDATA[B8ccpN G1T -1r]]> tatttaattcgatcgtactcaccaActttatggaagggtttatttatcta <h2 style=";text-align:left;direction:ltr"><![CDATA[B8ccpN <h2 style=";text-align:left;direction:ltr"> G1T <h2 style=";text-align:left;direction:ltr"> -2f]]><h2 style=";text-align:left;direction:ltr"> tagataaataaacccttccataaagTtggtgagtacgatcgaattaaata <![CDATA[B8ccpN G1T -2r]]> gccaagcttgcatgcctgcagagtctgatactacgtaaatgatgc B8△ccpN-1f acaaaataaggatcctctagaaggttctcaggatccgtacg B8△ccpN-1r aataatatgaaccggtattgaggcctttatggaagggtttatttatcta B8△ccpN-2f tagataaataaacccttccataaaggcctcaataccggttcatattatt B8△ccpN-2r gccaagcttgcatgcctgcagagcaggatgatatcggcttttaa B8pckA-F agcgttactcgcaagtcc B8pckA-R ctgtgcttttttcacgaacg

[0044] Example 1 ccpN in Bacillus subtilis G1T Construction of strains

[0045] The genome of B. subtilis 168 (wild fungus) or a laboratory-constructed adenosine-producing strain B. subtilis A5 (strain B. subtilis A5, see CN110257315B) was used as a template and ccpN was used to generate the adenosine-producing strain. G1T -1f / ccpN G1T -1r,ccpN G1T -2f / ccpN G1T -2r primer pair, pfu high-fidelity DNA polymerase amplified the upstream and downstream homologous arms of the ccpN gene. The obtained fragments were recovered by gel recovery and fused, and the ccpN was amplified. G1T The full-length fragment was recovered by gel extraction (the nucleotide sequence of the corresponding ORF frame is shown in SEQ ID NO: 1, and the amino acid sequence is shown in SEQ ID NO: 2). The pKSU plasmid (pKSU plasmid was kindly donated by Professor Wang Shufang of Nankai University, see A markerless gene replacement method for B. amyloliquefaciens LL3 and its use in genome reduction and improvement of poly-γ-glutamic acid production [J], Applied Microbiology and Biotechnology, 2014, 98 (21): 8963-8973. Zhang W, Gao W, Feng J, et al DOI: 10.1007 / s00253-014-5824-2) was double-digested with XbaI / PstI and recovered by gel extraction. The linearized plasmid and ccpN were assembled using the assembly kit. G1T The fragments were assembled and transformed into TransT1 competent cells, and then the recombinant plasmid pKSU-ccpN was obtained by identification and screening. G1T . Transformed into Bacillus subtilis 168 or B. subtilis A5 strain, screened transformants at 30°C using LB plates containing 2.5 μg / mL chloramphenicol, inoculated the obtained transformants into 5 ml LB liquid culture medium, cultured at 42°C 200 rpm for 12 h and propagated for one generation, diluted and spread on LB plates containing 5 μg / mL chloramphenicol to obtain primary recombinants; inoculated the primary recombinants into 5 ml LB liquid culture medium, cultured at 42°C 200 rpm for 12 h and propagated for one generation, diluted and spread on LB plates containing 0.8 μM 5-FU to screen secondary recombinants, and screened to obtain ccpN G1T The point mutation strains were named B. subtilis A0057 and B. subtilis A0058.

[0046] Example 2 ccpN in Bacillus amyloliquefaciens G1T Construction of strains

[0047] To determine whether ccpN mutation can increase guanosine production, we mutated ccpN in a laboratory-constructed guanosine-producing strain Ba 836 (see CN112574934A). G1T -1f / B8ccpN G1T -1r,B8ccpN G1T -2f / B8ccpN G1T -2r primer pair was used to amplify the upstream and downstream homology arms, and the obtained fragments were collected and fused to obtain B8ccpN G1T The full-length fragment was recovered by gel recovery (the nucleotide sequence of the corresponding ORF frame is shown in SEQ ID NO: 3, and the amino acid sequence is shown in SEQ ID NO: 4). The recombinant plasmid pKSU-B8ccpN was obtained according to the construction method in Example 1. G1T . Transformed into Ba 836 strain, screened and obtained B8ccpN G1T The strain was named B.a8429.

[0048] Example 3 Construction of ΔccpN strain in Bacillus subtilis

[0049] Using the genome of B.subtilis 168 or strain B.subtilis A5 as a template, using △ccpN-1f / △ccpN-1r, △ccpN-2f / △ccpN-2r primer pairs, pfu high-fidelity DNA polymerase amplification to obtain the upstream and downstream homologous arms of the ccpN gene. The obtained fragments were gel-recovered and fused, and the full-length fragment of △ccpN was amplified and gel-recovered (the nucleotide sequence of the corresponding ORF frame is shown in SEQ ID NO: 5, and the amino acid sequence is shown in SEQ ID NO: 6). The plasmid pKSU-△ccpN was constructed according to the construction method in Example 1, and it was transformed into the B.subtilis A5 strain. The obtained strains were named B.subtilis A0059 and B.subtilis A0060.

[0050] Example 4 Construction of ΔccpN strain in Bacillus amyloliquefaciens

[0051] Using the genome of Ba 836 strain as a template, the upper and lower homologous arms were amplified by primer pairs B8△ccpN-1f / B8△ccpN-1r and B8△ccpN-2f / B8△ccpN-2r, and the obtained fragments were collected and fused, and the full-length fragment of B8△ccpN was amplified and recovered by gel (the nucleotide sequence of the corresponding ORF frame is shown in SEQ ID NO: 7, and the amino acid sequence is shown in SEQ ID NO: 8). The recombinant plasmid pKSU-B8△ccpN was constructed according to the method in Example 1, and transformed into Ba 836, and the B8△ccpN strain obtained by screening was B.a8430.

[0052] Example 5 Comparison of pckA transcription levels in engineered strains

[0053] The transcriptional repressor ccpN binds to the promoter of pckA to prevent its expression. In order to prove whether the ccpN-related mutation affects the transcription level of pckA, the engineered strains (B. subtilis A0057-60, B.a8429-30) and their corresponding control strains (B. subtilis 168, B. subtilis A5, Ba 836) obtained above were cultured overnight in LB medium, the cells were collected, and total RNA was extracted according to the instructions of the kit TakaRa RNAiso Plus Code No.9108, and the kit TakaRa PrimeScript TM RT reagent Kit Code No.RR037A instructions for reverse transcription, transcribe RNA into cDNA, and finally follow the kit TakaRa TB Premix Ex Taq TM II Code No.RR820A instruction manual to prepare the PCR reaction system (primers: pckA-F / R and B8pckA-F / R), perform Real Time PCR reaction and data analysis.

[0054] The results of the determination of pckA transcription levels are shown in Table 2. From the results, it can be seen that the transcription levels of pckA in the engineered strains B. subtilis A0057 and B. subtilis A0058 are 6.3 and 6.1 times that of the control strains, respectively; the transcription levels of pckA in the engineered strains B. subtilis A0059 and B. subtilis A0060 are 8.7 and 8.6 times that of the control strains, respectively; the transcription levels of pckA in the engineered strains Ba 8429 and B.a430 are 5.8 and 7.1 times that of the control strain Ba 836, respectively.

[0055] Table 2 Ratio of pckA transcription levels between engineered strains and control strains

[0056] Strain Name Ratio of pckA Transcription Level B.subtilis A0057 6.3 B.subtilis A0058 6.1 B.subtilis A0059 8.7 B.subtilis A0060 8.6 B.a 8429 5.8 B.a 8430 7.1

[0057] Example 6 Verification of the nucleoside production performance of mutant strains

[0058] 1. Culture the bacteria stored in glycerol overnight at 37°C and isolate a single colony.

[0059] 2. Pick a single colony and inoculate it into 30 mL of seed culture medium (20 g / L glucose, 6 g / L yeast powder, 5 g / L corn steep liquor powder, 2 g / L potassium dihydrogen phosphate, 0.5 g / L magnesium sulfate, 0.02 g / L ferrous sulfate, 0.01 g / L manganese sulfate, pH 7.0-7.2, sterilize at 121°C for 20 min. Cultivate at 110 rpm and 34°C for 5-6 h).

[0060] 3. Transfer the inoculum to 30 ml fermentation medium (glucose 80 g / L, yeast powder 3.5 g / L, potassium dihydrogen phosphate 5 g / L, ammonium sulfate 20 g / L, manganese sulfate 0.01 g / L, magnesium sulfate 5 g / L, sodium glutamate 13 g / L, corn steep liquor powder 15 g / L, calcium carbonate 25 g / L, pH 7.2-7.4, sterilized at 121°C for 20 min) at a 10% v / v inoculum amount, shake at 130 rpm, and culture at 35°C for 48 h or 72 h (B. subtilis A0057-60 and its control strains B. subtilis 168 and B. subtilis A5 were fermented for 48 h, and B. a8429-30 and its control strain Ba 836 were fermented for 72 h).

[0061] 4. Use liquid chromatography to detect the glycosides produced in the fermentation broth (Table 3).

[0062] Table 3 Evaluation results of adenosine, inosine and guanosine production by shake flask fermentation of mutant strains (mean of three replicates)

[0063]

[0064]

[0065] The experimental results in Table 2 and Table 3 show that ccpN G1T or △ccpN can increase the transcription level of pckA, and ultimately lead to an increase in the ability of the corresponding mutant strain to produce nucleosides.

[0066] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made on the basis of the present invention. Therefore, these modifications or improvements made on the basis of not departing from the spirit of the present invention all belong to the scope of protection claimed by the present invention.

Claims

1. A modified microorganism, characterized in that Compared with an unmodified microorganism, the activity of the transcriptional repressor ccpN of the microorganism is reduced or lost, and the microorganism has an enhanced nucleoside production capacity compared with an unmodified microorganism; The reference sequence number of the transcription repressor ccpN on NCBI is NP_390403.

1.

2. The microorganism according to claim 1, characterized in that The activity reduction or loss of the transcriptional repressor ccpN in the microorganism is achieved by selecting from the following 1)-3), or an optional combination: 1) Reducing or losing the transcriptional repressor ccpN by changing the amino acid sequence of the transcriptional repressor; 2) reducing or losing the transcriptional repressor ccpN by changing the nucleotide sequence encoding the transcriptional repressor ccpN; 3) Loss of the transcriptional repressor ccpN by knocking out the coding sequence of the transcriptional repressor ccpN.

3. The microorganism according to claim 2, characterized in that The method of mutagenesis, site-directed mutagenesis or homologous recombination is used to reduce the expression of the gene encoding the transcription repressor ccpN or knock out the gene encoding the transcription repressor ccpN.

4. The microorganism according to claim 1, characterized in that The reduction or loss of the activity of the transcriptional repressor ccpN is achieved in the following manner: the start codon of the gene encoding the transcriptional repressor ccpN is mutated from gtg to ttg.

5. The microorganism according to any one of claims 1 to 4, characterized in that The microorganism is Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus or Escherichia coli.

6. A method for constructing a nucleoside-producing strain, characterized in that: The method comprises: using genetic engineering means to inactivate or weaken the coding gene of the transcription inhibitor ccpN in the microorganism; The weakening is achieved by selecting from the following a) to c), or any combination thereof: a) reducing or losing the transcriptional repressor ccpN by changing the amino acid sequence of the transcriptional repressor; b) reducing or losing the transcriptional repressor ccpN by changing the nucleotide sequence encoding the transcriptional repressor ccpN; c) lost by knocking out the coding sequence of the transcriptional repressor ccpN; The reference sequence number of the transcription repressor ccpN on NCBI is NP_390403.

1.

7. The method according to claim 6, characterized in that The weakening method is selected from at least one of mutagenesis, site-directed mutagenesis, and homologous recombination; Preferably, the weakening is achieved by: the start codon of the gene encoding the transcriptional repressor ccpN is mutated from gtg to ttg; The microorganism is Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus or Escherichia coli.

8. The recombinant bacteria constructed according to the method of claim 6 or 7.

9. Use of the microorganism according to any one of claims 1 to 5 or the recombinant bacterium according to claim 8 in the fermentation production of nucleosides or nucleoside derivatives or in increasing the fermentation yield of nucleosides or nucleoside derivatives; The nucleosides or nucleoside derivatives include adenosine, adenosine triphosphate, adenine, adenylic acid, adenosine arabinoside, inosine, inosinic acid, guanylic acid, adenylic acid, guanosine, guanine, guanylic acid, riboflavin, and diacetylguanylic acid.

10. A method for producing nucleosides, characterized in that: The method comprises the following steps: i) culturing the microorganism according to any one of claims 1 to 5 or the recombinant bacterium according to claim 8 to obtain a culture; ii) collecting the produced nucleosides from the culture obtained in step i).

Images