Modified Klenow fragment and application

Abstract

The invention relates to a modified Klenow fragment and application thereof, in particular to a modified Klenow fragment, and at least one position or a functional equivalent position in F762, A842, I709 and P603 on an amino acid sequence of the modified Klenow fragment comprises at least one amino acid replacement mutation. The DNA polymerase activity of the modified Klenow fragment provided by the invention is higher than that of a wild type Klenow fragment, and when the modified Klenow fragment is applied to sequencing, the sequencing capability and the sequencing data quality can be improved, such as increasing the reading length and / or reducing the proportion of continuous and repeated bases.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology. Specifically, the present invention relates to a modified Klenow fragment and its application.

[0002] Background

[0003] Klenow enzyme, also called Klenow fragment or Klenow large fragment, is the fragment with larger molecular weight of the two fragments obtained after Escherichia coli DNA polymerase I is treated with subtilisin or trypsin. Klenow fragment retains the 5ˊ-3ˊ polymerase and 3ˊ-5ˊ exonuclease activity of DNA polymerase I, but lacks 5ˊ-3ˊ exonuclease activity, and is often used to fill in the ends of single-stranded DNA. In addition, the exo-Klenow fragment, which is also commonly used in experiments, is a mutant of the Klenow fragment, which is a Klenow fragment without exonuclease activity. The enzyme is also often expressed as Klenow fragment (3'→5'exo-).

[0004] Klenow fragments or exo-Klenow fragments can undergo polymerization reaction / amplification at 37 degrees Celsius, so the temperature control requirements for experimental equipment, etc. for amplification reactions using Klenow fragments or exo-Klenow fragments are relatively low; and, compared with DNA polymerase I, Klenow fragments or exo-Klenow fragments have a smaller molecular weight, so it is relatively easy to synthesize the corresponding nucleic acid sequence to construct an expression vector, which is convenient for preparation and conducive to industrial application.

[0005] The amplification effect of Klenow fragment or exo-Klenow fragment is related to the characteristics of the polymerase itself, including synthesis ability, fidelity / correction ability, specificity / enzyme activity and stability, and is also related to the reaction environment including reaction conditions, such as sequencing buffer, nucleotide type, solid medium surface structure (adsorption effect with enzyme), etc. It may be because the Klenow fragment is not resistant to high temperature, has low polymerization ability, or the overall performance of the enzyme is relatively weak, so the amplification platforms including sequencing platforms on the market currently rarely use this enzyme, and rarely modify this enzyme.

[0006] Improving or adjusting certain aspects of the performance of the Klenow fragment will help increase its industrial applicability. Summary of the invention

[0007] The inventors used wild-type Klenow fragments and commercially available Klenow fragment kits for testing and found that the wild-type Klenow fragments or their common mutant exo-Klenow fragments cannot obtain good results in nucleic acid sequence amplification, especially in sequencing reactions. For example, when these enzymes are used for nucleotide extension reactions such as sequencing, the sequencing indicators such as the average sequencing read length and the amount of effective data obtained are less than ideal; moreover, compared with commercially available Klenow fragments, the performance of wild-type Klenow fragments and exo-Klenow fragments in sequencing is relatively weaker.

[0008] The present invention aims to solve at least one of the above technical problems at least to a certain extent.

[0009] To this end, the first aspect of the present invention provides a modified Klenow fragment, wherein at least one position of F762, A842, I709 and P603 or a functionally equivalent position on the amino acid sequence of the modified Klenow fragment contains at least one amino acid substitution mutation. Here, the amino acid position numbering on the amino acid sequence of the modified Klenow fragment is based on DNA polymerase I (UniPRotKB accession number: P00582, https: / / www.uniPRot.org / uniPRot / P00582), such as F762, indicating that there is a mutation in F (phenylalanine) at position 762 of the amino acid sequence of DNA polymerase I on the amino acid sequence of the modified Klenow fragment.

[0010] In some examples, the amino acid substitution mutation is selected from at least one of the substitution mutations functionally equivalent to F762Y, A842K, A842H, A842R, I709K, I709H, I709R and P603K. In some examples, for example, the missense mutation of the modified Klenow fragment is any one of the following 1)-14): 1) F762Y; 2) A842K; 3) I709K; 4) F762Y and A842K; 5) F762Y, A842K and P603K; 6) A842K and I709K; 7) F762Y and I709K; 8) F762Y, A842K and I709K; 9) A842H and I709K; 10) A842K and I709H; 11) A842H and I709H; 12) A842R and I709K; 13) A842K and I709R; 14) A842R and I709R. In other examples, the modified Klenow fragment is a mixed enzyme, for example, a mixture of two or more modified Klenow fragments in 1)-14) above.

[0011] The modified Klenow fragments provided in this aspect of the present invention all have higher synthesis capabilities including faster synthesis speed and / or higher affinity with the substrate. When used in sequencing, they show stronger compatibility with modified nucleotides and / or growing DNA chains, which is conducive to obtaining longer read lengths and / or increasing the proportion of high-quality data.

[0012] Regarding the naming rules for mutations, this article adopts the rules established by the Human Genome Variation Society (HGVS mutation naming rules) which are recognized in the field, such as p.Trp26Cys, which means that the Trp at position 26 is replaced by Cys with protein as the reference sequence; unless otherwise specified, the mutations mentioned in this article are all amino acid mutations, and the reference sequence is protein. When these mutations are expressed in writing, "p." is omitted.

[0013] It can be understood that mutations with the same function can be represented in a variety of different ways. For example, based on different types of reference sequences, such as genomic DNA and protein as reference sequences, the same mutation has different representations. For another example, using part or all of the same protein as the reference sequence, the position numbers of the mutations may be different. Based on the specific reference sequence information, those skilled in the art can know and identify different representations, including the same mutation at the same functional position represented by different position numbers. These modified Klenow fragments that represent the same mutation as provided in this aspect of the present invention in different representations all belong to the modified Klenow fragments referred to in this aspect of the present invention.

[0014] In order to intuitively show the performance of the modified Klenow fragments provided by the inventors after mutation, testing, and repeated screening and verification, in some examples, the modified Klenow fragment (s) and the commercial Klenow fragment were respectively applied to sequencing, and the results were compared. The so-called commercial Klenow enzymes include NEB's Klenow fragment (NEB, catalog number M0407B) and Vazyme's Klenow fragment (Novagen, catalog number N105-C1); in addition, the characteristics of the modified Klenow fragment (s) were tested experimentally and compared with those of the wild-type Klenow fragment.

[0015] The so-called wild-type Klenow fragment is the same as the generally referred to wild type, and refers to the most common type in the natural population as opposed to the mutant type; in some examples, in order to facilitate the preparation of a Klenow fragment with a known sequence that does not affect the enzyme reaction performance at the end of the wild-type amino acid sequence, the Klenow fragment with a known sequence is also called a wild-type or a tagged wild-type Klenow fragment; in some examples, in order to facilitate the preparation of a modified Klenow fragment with a known sequence that does not affect the enzyme reaction performance at the end of the modified Klenow fragment amino acid sequence, the modified Klenow fragment with a known sequence is also called a modified Klenow fragment or a tagged modified Klenow fragment or a tagged mutant Klenow fragment.

[0016] The so-called sequencing refers to the use of the reaction properties of the Klenow fragment to connect nucleotides with detectable signals to the ends of the nucleotide fragments, and confirm the type of the connected nucleotides or bases based on the type of detectable signals detected. The so-called detectable signals include fluorescent signals, such as Cy5, Cy3, etc.

[0017] In the description of the performance of the enzyme involved below, including the effect obtained by applying to sequencing, unless otherwise specified, the so-called BRR (base repeat ratio) is the ratio of repeated bases, which means the ratio of the number of bases corresponding to a certain position to be detected that is detected to emit a continuous signal or a signal continuously to the total number of bases. This term is defined because it is rare for a normal sequence to contain multiple continuous repeated bases. For example, it is rare for a normal sequence to contain one or more segments containing 5 or more continuous repeated bases. Determining the numerical value of the defined term can reflect to a certain extent the possibility that the measured data is objective / true. Sequencing generally includes multiple rounds of reactions (cycles) to determine a sequence (read segment) with a specific length. A base extension reaction of four nucleotides is defined as one round of reaction. In some examples, the four nucleotides are added to the reaction system twice or more to achieve one round of reaction, that is, one round of reaction includes multiple base extension reactions (repeat). For a normal sequence, in N consecutive base extension reactions, N is a natural number greater than 2, such as 8. The possibility that a certain position will send a reaction signal or that all bases / nucleotides can be read is very low. If the position is read as a base / nucleotide for 8 consecutive times, it is more likely that nucleotide adsorption or nucleotide-polymerase is present at the position. Complex adsorption, so in 8 consecutive base extension reactions, the position is detected to have a reaction signal. Usually, the continuously detected reaction signals all point to the same base; in other examples, four nucleotides are added to the reaction system at the same time to realize one round of reaction, that is, one round of reaction includes one base extension reaction. For normal sequences, in N consecutive base extension reactions, N is a natural number greater than 2, such as 6. A certain position is detected to emit the same signal 6 times in a row or is identified as a 6bp repeated base. Compared with the actual existence of the 6bp repeated base in the sequence to be tested, it is more likely that there is nucleotide adsorption or nucleotide-polymerase complex adsorption at the position, thus continuously emitting the same signal. Regarding the calculation of BRR, in some examples, for example, N is set to 8. In a certain sequencing, the total number of bases / nucleotides identified is 1000. Three consecutive repeated sequences of not less than 8 are identified, such as 8, 10 and 9 bases respectively. Then, the corresponding BRR is (8+10+9) / 1000. Generally, the lower the BRR, the lower the adsorption.

[0018] In one example, the amino acid sequence of the so-called modified Klenow fragment contains a substitution mutation that is functionally equivalent to F762Y. The DNA polymerase activity of the Klenow fragment containing the F762Y mutation (such as the Klenow fragment numbered PR1 in the example) is significantly higher than that of the wild-type Klenow fragment (such as the Klenow fragment numbered PR0 in the example). In multiple tests, the polymerase activity of PR1 is 1.62 times or more of that of PR0. 2+ The sequencing results in the solution were comparable to or better than those of the Klenow fragments of NEB and Vazyme, whose specific mutation sites were unknown. The average read lengths obtained by sequencing using PR1 were 1.17 times and 1.36 times that of the latter two enzymes, respectively.

[0019] In one example, the amino acid sequence of the modified Klenow fragment includes substitution mutations that are functionally equivalent to F762Y and A842K. Klenow fragments containing F762Y and A842K mutations (such as Klenow fragments numbered PR5 in the embodiment) have an improved DNA polymerase activity compared to the wild-type Klenow fragment PR0. In multiple tests, the DNA polymerase activity of PR5 is 1.29 times that of PR0. The sequencing results of PR5 are compared with the Klenow fragments of PR1 and Vazyme, respectively. The average read length obtained by sequencing using PR5 is 0.96 times and 1 times of the latter two enzymes, respectively, and the BRR (repeat base ratio) in the sequencing results is reduced compared to the two enzymes.

[0020] In one example, the amino acid sequence of the modified Klenow fragment contains substitution mutations that are functionally equivalent to F762Y and I709K. The Klenow fragment containing F762Y and I709K mutations (such as the Klenow fragment numbered PR8 in the embodiment) has improved DNA polymerase activity compared to the wild-type Klenow fragment PR0. In multiple tests, the DNA polymerase activity of PR8 is 1.33 times that of PR0. PR8 in the presence of Mg 2+ The sequencing results in the buffer containing Mn were compared with those of Vazyme's Klenow fragment. The average read lengths obtained by sequencing the two fragments were similar, but PR8 had a 2+ When sequencing is performed in a solution of , the sequencing read length is stagnant at short fragments.

[0021] In one example, the amino acid sequence of the modified Klenow fragment contains substitution mutations that are functionally equivalent to F762Y, A842K, and P603K. The Klenow fragment containing F762Y, A842K, and P603K mutations (such as the Klenow fragment numbered PR6 in the embodiment) has improved DNA polymerase activity compared to the wild-type Klenow fragment PR0. In multiple tests, the DNA polymerase activity of PR6 is 1.33 times that of PR0. The sequencing results of PR6 are compared with the Klenow fragment of Vazyme: PR6 has a higher activity in the presence of Mg 2+ When sequencing in buffer, the sequencing read length is stagnant at short fragments. 2+ The average read length obtained by sequencing using PR6 in the buffer was equivalent to that of the Klenow fragment of Vazyme, and the BRR of the PR6 sequencing result was 0.82 times that of the Klenow fragment of Vazyme.

[0022] In one example, the amino acid sequence of the modified Klenow fragment contains substitution mutations that are functionally equivalent to F762Y, A842K, and I709K. The Klenow fragment containing F762Y, A842K, and I709K mutations (such as the Klenow fragment numbered PR9 in the embodiment) has significantly improved DNA polymerase activity compared to the wild-type Klenow fragment PR0. In multiple tests, the DNA polymerase activity of PR9 is 1.67 times that of PR0. The sequencing results of PR9 are compared with the Klenow fragment of Vazyme: PR9 has a significant improvement in the activity of DNA polymerase in the presence of Mn 2+ When sequencing in buffer, the sequencing read length is stagnant at short fragments. 2+ The sequencing can be performed effectively in a buffer of , but the average read length obtained by sequencing is shorter than that of Vazyme's Klenow fragment.

[0023] In one example, the amino acid sequence of the modified Klenow fragment contains a substitution mutation that is functionally equivalent to A842K or A842H or A842R, and the substituted amino acid is a basic amino acid. The Klenow fragment containing the A842K mutation (such as the Klenow fragment numbered PR2 in the embodiment) has an improved DNA polymerase activity compared to the wild-type Klenow fragment PR0. In multiple tests, the DNA polymerase activity of PR2 is 1.05 times that of PR0. 2+ The sequencing effect in the buffer of the enzyme was better than that of the Klenow fragment of NEB and the Klenow fragment of Vazyme. The average sequencing read length was 1.03 times and 1.04 times that of the latter two enzymes, respectively. 2+ Sequencing in buffer containing Mg is better than that in buffer containing Mg 2+ of buffer.

[0024] In one example, the amino acid sequence of the modified Klenow fragment contains substitution mutations that are functionally equivalent to A842K and I709, wherein the substitution mutation type of I709 may be I709K, I709H, or I709R. The Klenow fragment containing A842K and I709K mutations (such as the Klenow fragment numbered PR7 in the embodiment) has significantly improved DNA polymerase activity compared to the wild-type Klenow fragment PR0. In multiple tests, the DNA polymerase activity of PR7 was 1.43 times that of PR0. The average read length obtained by sequencing PR7 is 1.15 times that of Vazyme's Klenow fragment; the BRR in the PR7 sequencing results is lower than that of Vazyme's Klenow fragment and PR3. The amplification ability of PR7 is different under different buffer conditions. 2+ The amplification ability is the strongest under the conditions containing Mn 2+ Mg-free 2+ Under the condition of Mn, the amplification capacity is reduced and the sequencing read length stays at the short fragment; at the same time, 2+ Mg 2+ Under the condition of simultaneous presence, PR7 can be effectively amplified, and the average read length obtained by sequencing is longer than that of the Klenow fragment of Vazyme.

[0025] In one example, the amino acid sequence of the modified Klenow fragment contains a substitution mutation that is functionally equivalent to I709K. The Klenow fragment containing the I709K mutation (such as the Klenow fragment numbered PR3 in the embodiment) has significantly improved DNA polymerase activity compared to the wild-type Klenow fragment PR0. In multiple tests, the PR3 DNA polymerase activity was 1.67 times that of PR0. The average read length obtained by sequencing PR3 is 1.01 times that of NEB's Klenow fragment, and the average read lengths of the two are comparable. PR3 can effectively reduce BRR, and the BRR in the PR3 sequencing results is 0.65 times that of NEB's Klenow fragment. PR3 contains Mn 2+ The sequencing reads in the sequencing buffer are seriously stuck at short fragments.

[0026] In one example, the amino acid sequence of the modified Klenow fragment contains a substitution mutation that is functionally equivalent to P603K. The Klenow fragment containing the I709K mutation (such as the Klenow fragment numbered PR4 in the embodiment) has significantly improved DNA polymerase activity compared to the wild-type Klenow fragment PR0. In multiple tests, the DNA polymerase activity of PR4 is 1.24 times that of PR0. PR4 contains Mn 2+The sequencing effect in the buffer containing Mg2+ was better than that in the buffer containing Mg2+. The average read length obtained by PR4 in buffer I was stuck at the short length fragment, while PR4 in buffer containing Mn 2+ The average read length of sequencing was comparable to that of Vazyme's Klenow fragment when sequencing was performed in a buffer containing Mn. The BRRs in the sequencing results of the two enzymes were comparable. 2+ The average read length obtained by sequencing in the buffer was 1.07 times that of Vazyme's Klenow fragment.

[0027] In one example, the modified amino acid sequence of the Klenow fragment further comprises a substitution mutation functionally equivalent to C907A and / or substitution mutations functionally equivalent to D355A and E357A.

[0028] In one example, at least one end of the amino acid sequence of the modified Klenow fragment carries a known sequence with a length of less than 12 amino acids (12aa), and the known sequence can be located at the C-terminus or N-terminus of the amino acid sequence of the Klenow fragment. In the present invention, the known sequence is located at the N-terminus of the amino acid sequence of the Klenow fragment. The known sequence does not affect the activity of the Klenow fragment, and the added known sequence contains 6-10 histidine residues, such as GSSHHHHHHSSG (SEQ ID NO: 1) and HHHHHHHHHH (SEQ ID NO: 7). The histidine (H) in this known sequence is used to bind to Ni in a purification column containing Ni for purification of proteins containing this tag. In the present invention, small molecules of glycine and serine with flexible structures of N are added to the N-terminus and C-terminus of the known sequence, which can effectively reduce the influence of the known sequence on the activity of the Klenow fragment.

[0029] The second aspect of the present invention provides a nucleic acid molecule encoding the modified Klenow fragment provided in the first aspect of the present invention. There may be multiple situations for the nucleotide codons at the amino acid mutation site, such as TAT ​​and / or TAC can be selected for tyrosine codons, and AAA and / or AAG can be selected for lysine codons. The nucleotide sequence corresponding to the unmutated Klenow fragment site is consistent with the nucleotide sequence of 324-928aa of DNA polymerase I (UniPRotKB: P00582).

[0030] The third aspect of the present invention provides an expression vector, which comprises the nucleic acid molecule provided by the second aspect of the present invention. The vector used can be used to store the target nucleotide fragment, such as pET-28a and related series vectors.

[0031] The fourth aspect of the present invention provides a host cell, which comprises the expression vector provided by the third aspect of the present invention. The host cell can be used to express the vector protein, such as Escherichia coli cell BL21.

[0032] The fifth aspect of the present invention provides the use of the modified Klenow fragment provided in the first aspect of the present invention in a nucleic acid sequence extension reaction, wherein the nucleic acid sequence extension reaction includes conventional PCR, nucleic acid sequencing and DNA end-filling experiments, wherein DNA refers to a deoxyribonucleic acid chain, including cDNA. Compared with the wild-type Klenow, the modified Klenow fragment has improved polymerase activity and is well compatible with the sequencing system, so that effective sequencing can be performed, and the sequencing quality is improved, such as an increase in the average read length obtained by sequencing.

[0033] The sixth aspect of the present invention provides a method for incorporating nucleotides into DNA, comprising (a) any one of the modified Klenow fragments provided in the first aspect of the invention or a mixture thereof, (b) DNA and (c) a nucleotide solution interacting with each other. The nucleotides in the nucleotide solution are nucleotides or nucleotide analogs modified with fluorescent molecules, such as nucleotides disclosed in PCT / CN2018 / 118259 or nucleotides suitable for two sequencing platforms disclosed by Illumina, etc. The preferred nucleotide types are nucleotides disclosed in PCT / CN2018 / 118259 or nucleotides of similar structures thereof. The binding in the present invention refers to connecting nucleotides to the ends of nucleotide sequences using the polymerase activity of the modified Klenow fragments.

[0034] Conventional Klenow amplification reaction solution cannot effectively amplify the modified Klenow fragment during sequencing. The modified Klenow fragment has its own appropriate nucleotide solution, wherein the nucleotide solution contains Mg 2+ and / or Mn 2+ In one example, when the modified Klenow fragment used in the method of incorporating nucleotides into DNA is a Klenow fragment numbered PR2, PR3, PR7, PR8 or PR9 in the embodiment, the nucleotide solution contains Mg 2+ But does not contain Mn 2+ , and Mg 2+ The concentration of Mn is 5 mM to 10 mM. When the modified Klenow fragment used in the method of incorporating nucleotides into DNA is the Klenow fragment numbered PR1, PR2, PR4, PR5 or PR6 in the embodiment, the nucleotide solution contains Mn 2+ But does not contain Mg 2+ , and Mn 2+The concentration of Mg is 0.1 mM to 5 mM. When the modified Klenow fragment used in the method of incorporating nucleotides into DNA is PR7 in the embodiment, the nucleotide solution contains Mg 2+ and Mn 2+ , where Mg 2+ The concentration of Mn is 5mM~10mM, 2+ The concentration is 0.1mM~5mM.

[0035] The sixth aspect of the present invention provides a kit for incorporating nucleotides into DNA, the kit comprising at least one modified Klenow fragment provided by the first aspect of the present invention.

[0036] In one example, the kit comprises a modified Klenow fragment (such as PR1) containing a substitution mutation functionally equivalent to F762Y and a nucleotide solution, wherein the nucleotide solution comprises nucleotides labeled with fluorescent molecules and 0.1 mM to 5 mM Mn 2+ , and does not contain Mg 2+ .

[0037] In one example, the kit comprises a modified Klenow fragment (such as PR5) containing substitution mutations functionally equivalent to F762Y and A842K and a nucleotide solution, wherein the nucleotide solution comprises nucleotides labeled with fluorescent molecules and 5 mM to 10 mM Mg 2+ , and does not contain Mn 2+ .

[0038] In one example, the kit comprises a modified Klenow fragment (such as PR8) containing substitution mutations functionally equivalent to I709K and F762Y and a nucleotide solution, wherein the nucleotide solution comprises nucleotides labeled with fluorescent molecules and 5 mM to 10 mM Mg 2+ , and does not contain Mn 2+ .

[0039] In one example, the kit comprises a modified Klenow fragment (such as PR6) containing substitution mutations functionally equivalent to F762Y, A842K and P603K and a nucleotide solution, wherein the nucleotide solution comprises nucleotides labeled with fluorescent molecules and 0.1 mM to 5 mM Mn 2+ , and does not contain Mg 2+ .

[0040] In one example, the kit comprises a modified Klenow fragment (such as PR9) containing substitution mutations functionally equivalent to F762Y, A842K and I709K and a nucleotide solution, wherein the nucleotide solution comprises nucleotides labeled with fluorescent molecules and 5 mM to 10 mM Mg 2+ , and does not contain Mn2+ .

[0041] In one example, the kit comprises a modified Klenow fragment (such as PR2) containing a substitution mutation functionally equivalent to A842K or A842H or A842R and a nucleotide solution, wherein the nucleotide solution comprises nucleotides labeled with fluorescent molecules and 5mM to 10mM Mg 2+ , and does not contain Mn 2+ , or the nucleotide solution contains nucleotides labeled with fluorescent molecules and 0.1mM to 5mM Mn 2+ , and does not contain Mg 2+ .

[0042] In one example, the kit comprises a modified Klenow fragment (such as PR7) containing substitution mutations functionally equivalent to A842K and I709K, or A842H and I709K, and a nucleotide solution, wherein the nucleotide solution comprises nucleotides labeled with fluorescent molecules and 5 mM to 10 mM Mg 2+ and 0.1mM~5mM Mn 2+ Alternatively, the nucleotide solution contains 5mM to 10mM Mg 2+ , and does not contain Mn 2+ .

[0043] In one example, the kit comprises a modified Klenow fragment (such as PR3) containing a substitution mutation functionally equivalent to I709K and a nucleotide solution, wherein the nucleotide solution comprises nucleotides labeled with fluorescent molecules and 5mM to 10mM Mg 2+ And does not contain Mn 2+ .

[0044] In one example, the kit comprises a modified Klenow fragment (such as PR4) containing a substitution mutation functionally equivalent to P603K and a nucleotide solution, wherein the nucleotide solution comprises nucleotides labeled with fluorescent molecules and 0.1 mM to 5 mM Mn 2+ , and does not contain Mg 2+ .

[0045] The seventh aspect of the present invention provides the use of the above-mentioned kit in a nucleic acid sequence extension reaction, which includes conventional PCR, nucleic acid sequencing and DNA end-filling experiments, wherein DNA refers to a deoxyribonucleic acid chain, including cDNA.

[0046] The modified Klenow fragment provided in any aspect or any embodiment of the present invention has a higher DNA polymerase activity than the wild-type Klenow fragment, and can significantly improve the efficiency of the polymerization reaction;

[0047] The modified Klenow fragment provided by any aspect or any embodiment of the present invention has different degrees of improvement in sequencing effect compared with the Klenow fragment of the commercial kit in different aspects, such as longer average read length, lower BRR, etc.;

[0048] In addition, it should be noted that in some examples, the modified Klenow fragments provided by any aspect or any embodiment of the present invention show preferences for different reaction conditions. For example, some modified Klenow fragments are more suitable for the reaction under the condition of only the catalytic ion Mn 2+ The amplification reaction is carried out in a buffer containing Mg, such as a Klenow fragment containing a mutation of P603K; for example, some modified Klenow fragments are suitable for both 2+ The catalytic ion is also suitable for containing Mg 2+ and Mn 2+ The amplification reaction is performed in a buffer containing catalytic ions, such as the Klenow fragment containing the A842K and I709K mutations. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 SDS-PAGE electrophoresis of wild-type Klenow fragment PR0: lanes 1, 2, and 3 are protein molecule marker, PR0 purified in step 2, and PR0 diluted 20 times after purification in step 2, respectively;

[0050] Figure 2 SDS-PAGE electrophoresis of the modified Klenow fragment PR1: lanes 1, 2, and 3 are protein molecule marker, PR1 purified in step 2, and PR1 purified in step 2 diluted 20 times, respectively;

[0051] Figure 3 SDS-PAGE electrophoresis of the modified Klenow fragment PR2: lanes M, 1, and 2 are protein molecule marker, PR2 purified in step 2, and PR2 purified in step 2 diluted 20 times, respectively;

[0052] Figure 4 SDS-PAGE electrophoresis of the modified Klenow fragment PR3: lanes 1, 2, and 3 are protein molecule marker, PR3 purified in step 2, and PR3 purified in step 2 diluted 20 times, respectively;

[0053] Figure 5 SDS-PAGE electrophoresis of the modified Klenow fragment PR4: lanes 1, 2, and 3 are protein molecule marker, PR4 purified in step 2, and PR4 purified in step 2 diluted 20 times, respectively;

[0054] Figure 6SDS-PAGE electrophoresis of the modified Klenow fragment PR5: lanes 1, 2, and 3 are protein molecule marker, PR5 purified in step 2, and PR5 purified in step 2 diluted 20 times, respectively;

[0055] Figure 7 SDS-PAGE electrophoresis of the modified Klenow fragment PR6: lanes M, 1, and 2 are protein molecule marker, PR6 purified in step 2, and PR6 purified in step 2 diluted 20 times, respectively;

[0056] Figure 8 SDS-PAGE electrophoresis of the modified Klenow fragment PR7: lanes 1, 2, and 3 are protein molecule marker, PR7 purified in step 2, and PR7 purified in step 2 diluted 20 times, respectively;

[0057] Fig. 9 SDS-PAGE electrophoresis of the modified Klenow fragment PR8: Lane 23, 1, 2, 3 are protein molecule marker, PR8 purified in step 2, and PR8 purified in step 2 diluted 20 times, respectively;

[0058] Fig.10 SDS-PAGE electrophoresis of the modified Klenow fragment PR9: lanes 1, 2, and 3 are protein molecule marker, PR9 purified in step 2, and PR9 purified in step 2 diluted 20 times, respectively;

[0059] Fig.11 Gel electrophoresis of PR0 endonuclease activity detection: Lanes M, 1, and 2 are DNA molecule marker, negative control, and PR0, respectively;

[0060] Fig.12 Gel electrophoresis of the modified Klenow fragment PR1 endonuclease activity detection: lanes M, 1, and 2 are DNA molecule marker, negative control, and PR1, respectively;

[0061] Fig.13 Gel electrophoresis of the modified Klenow fragment PR2 endonuclease activity detection: lanes M, 1, and 2 are DNA molecule marker, negative control, and PR2, respectively;

[0062] Fig.14 Gel electrophoresis of the modified Klenow fragment PR3 endonuclease activity detection: lanes M, 1, and 2 are DNA molecule marker, negative control, and PR3, respectively;

[0063] Fig.15Gel electrophoresis of the modified Klenow fragment PR4 endonuclease activity detection: lanes 1, 2, and 3 are DNA molecule marker, negative control, and PR4, respectively;

[0064] Fig.16 Gel electrophoresis of the modified Klenow fragment PR5 endonuclease activity detection: lanes 1, 2, and 3 are DNA molecule marker, negative control, and PR5, respectively;

[0065] Fig.17 Gel electrophoresis of the modified Klenow fragment PR6 endonuclease activity detection: Lanes M, 1, and 2 are DNA molecule marker, negative control, and PR6, respectively;

[0066] Fig.18 Gel electrophoresis of the modified Klenow fragment PR7 endonuclease activity detection: lanes 1, 2, and 3 are DNA molecule marker, negative control, and PR7, respectively;

[0067] Fig.19 Gel electrophoresis of the modified Klenow fragment PR8 endonuclease activity detection: lanes 1, 2, and 3 are DNA molecule marker, negative control, and PR8, respectively;

[0068] Fig. 20 Gel electrophoresis of the modified Klenow fragment PR9 endonuclease activity detection: lanes 1, 2, and 3 are DNA molecule marker, negative control, and PR9, respectively;

[0069] Fig.21 PR1-Mn 2+ (Mg in PR1 sequencing buffer 2+ Replaced by Mn 2+ ), NEB enzyme, Vazyme enzyme sequencing results comparison chart;

[0070] Fig. 22 PR2, PR2-Mn 2+ (Mg in PR2 sequencing buffer 2+ Replaced by Mn 2+ ), NEB enzyme, Vazyme enzyme sequencing results comparison chart;

[0071] Fig.23 Comparison of sequencing results of PR3, NEB enzyme, and Vazyme enzyme;

[0072] Figure 24-1 PR4-Mn 2+ (Mg in PR4 sequencing buffer 2+ Replaced by Mn 2+ ), Vazyme enzyme sequencing results comparison chart; Figure 24-2Comparison of PR4 and Vazyme enzyme sequencing results;

[0073] Fig.25 PR5-Mn 2+ (Mg in PR5 sequencing buffer 2+ Replaced by Mn 2+ ), PR1-Mn 2+ (Mg in PR1 sequencing buffer 2+ Replaced by Mn 2+ ), Vazyme enzyme sequencing results comparison chart;

[0074] Fig.26 PR6, PR6-Mn 2+ (Mg in PR6 sequencing buffer 2+ Replaced by Mn 2+ ), Vazyme enzyme sequencing results comparison chart;

[0075] Figure 27-1 Comparison of sequencing results of PR7 under different reaction conditions and Vazyme enzyme sequencing results; Figure 27-2 Comparison of PR7 and PR3 sequencing results;

[0076] Fig.28 PR8, PR8-Mn 2+ (Mg in PR8 sequencing buffer 2+ Replaced by Mn 2+ ), Vazyme enzyme sequencing results comparison chart;

[0077] Fig.29 PR9, PR9-Mn 2+ (Mg in PR8 sequencing buffer 2+ Replaced by Mn 2+ ), comparison chart of Vazyme enzyme sequencing results. Example

[0078] The present invention will be described below with reference to specific embodiments and the accompanying drawings. It should be noted that these embodiments are merely illustrative and should not be construed as limiting the present invention. Where specific techniques or conditions are not specified in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. Where the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased on the market.

[0079] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, unless they are contradictory.

[0080] 1. Preparation of recombinant bacteria

[0081] 324-928aa of DNA polymerase I (UniPRotKB: P00582) is the amino acid fragment corresponding to Klenow enzyme. The modified Klenow fragment in this embodiment has a tag sequence and a methionine at the N-terminus of the amino acid fragment of Klenow enzyme. The modified Klenow fragment is: methionine-tag sequence-amino acids at positions 324-928 of DNA polymerase I. The tag sequence consists of 12 amino acids: glycine-2 serines-6 histidines-2 serines-glycine (GSSHHHHHHSSG) (SEQ ID NO.1), and the nucleotide sequence corresponding to the tag sequence is: GGCAGCAGCCACCACCACCACCACCACAGCAGCGGT (SEQ ID NO.2), and the nucleotide corresponding to methionine is ATG. The nucleotide sequence of the wild-type Klenow fragment in this embodiment is consistent with the nucleotide sequence corresponding to amino acids 324-928 of DNA polymerase I (UniPRotKB: P00582).

[0082] The coding gene of the modified Klenow fragment was synthesized, and the DNA fragment between the NcoI and XhoI recognition sequences of pET-28a (Novagen) was replaced with the coding gene of the modified Klenow fragment to obtain a recombinant vector, which was named V-PR. V-PR was introduced into Escherichia coli BL21 (DE3) (Tiangen Biochemical Technology (Beijing) Co., Ltd.) to obtain a recombinant bacterium, which was named BL21-V-PR. BL21-V-PR expressed the modified Klenow fragment PR.

[0083] When there is no mutation in the Klenow encoding gene, the Klenow fragment expressed by BL21-V-PR is PR0.

[0084] The nucleotide sequence containing mutations in the Klenow coding gene region was synthesized, and the modified Klenow fragments encoded and expressed were PR1, PR2, PR3, PR4, PR5, PR6, PR7, PR8, and PR9. The mutation sites and mutation types of the modified Klenow fragments are shown in Table 1 below:

[0085] Table 1

[0086]

[0087] 2. Preparation of Klenow fragment PR

[0088] 2.1 Inducible expression

[0089] The recombinant bacteria BL21-V-PR obtained in step 1 was inoculated into 5ml Kan-LB medium (Kan-LB medium is a liquid medium with a kanamycin concentration of 50 μg / ml obtained by adding kanamycin to LB medium) and cultured at 37°C, 220rpm, overnight; the obtained bacterial solution was inoculated into 30ml Kan-LB medium at 1:50 and cultured at 37°C, 220rpm, 4h; the obtained bacterial solution was inoculated into 250ml Kan-LB medium at 1:50 and cultured at 37°C, 220rpm for about 4h; when the OD600 value reached about 0.6, IPTG was added to the cultured bacterial solution until its final concentration in the bacterial solution was 0.5mM, and then cultured at 30°C, 220rpm overnight (about 16h); BL21-V-PR bacteria were collected at 8000rpm for 10min. At the same time, no IPTG was added as a blank control, and uninduced BL21-V-PR bacteria were collected.

[0090] 2.2 Bacterial cell disruption and purification

[0091] Take the BL21-V-PR bacteria in step 2.1, and resuspend the bacteria with affinity solution A at a ratio of 1 g bacteria: 20 ml affinity solution (50 mM Tris, 200 mM NaCl, 5% Glycerol, PH 7.5) to obtain a bacterial resuspension 1; add phenylmethylsulfonyl fluoride, Triton X-100 and lysozyme to the bacterial resuspension 1 to obtain a bacterial resuspension 2, wherein the final concentrations of phenylmethylsulfonyl fluoride, Triton X-100 and lysozyme in the bacterial resuspension 2 are 0.25 mM, 0.5% (volume percentage concentration) and 2.5 mg / 100 mL, respectively; incubate the bacterial resuspension 2 at room temperature for 30 min, ultrasonicate at 40% power (about 400 W) for 2 s and stop for 2 s for a total of 30 min, centrifuge the ultrasonic product at 12000 rpm and 4°C for 30 min, and collect the supernatant.

[0092] After filtering the supernatant with a 0.45 μm syringe filter (Life Sciences), the supernatant was loaded onto a Ni column affinity chromatography (affinity chromatography pre-packed column HisTrap HP, 5 ml, 17-5248-02, GE healthcare). After loading, the supernatant was equilibrated with affinity buffer 1 (50 mM Tris, 200 mM NaCl, 10 mM imidazole, 5% Glycerol, PH 7.4) for 10 CV; eluted with 3% affinity buffer 2 (50 mM Tris, 1 M NaCl, 500 mM imidazole, 5% Glycerol, PH 7.4) for 5 CV; and eluted with 50% affinity buffer 2 for 5 CV, and the Ni column affinity chromatography eluate corresponding to the peak value greater than or equal to 100 mAU was collected.

[0093] The eluate corresponding to the peak value greater than or equal to 100mAU was dialyzed overnight with ion buffer 1 (25mM Tris, 50mMNaCl, 5% Glycerol, PH 7.4), and then the dialyzed solution was loaded at a certain flow rate for cation exchange chromatography (ion exchange prepacked column HiTrap SP HP, 5ml, 17-1152-01, GE healthcare), and after loading, equilibrated with ion buffer 1 for 10CV; eluted with 3% ion buffer 2 (50mM Tris, 1MNaCl, 5% Glycerol, PH 7.40) for 5CV; and eluted with 50% ion buffer 2 for 5CV. The SP column cation exchange chromatography eluate corresponding to the peak value greater than or equal to 100mAU was collected, and the collected eluate was placed in a dialysis bag (spectrumlabs, 131267) in the dialysate (20mM Tris, 200mM After dialysis for 24 hours in KCl, 0.2 mM EDTA, 5% Glycerol), the solution was quantified to 0.5 mg / ml and contained 50% glycerol to obtain the purified Klenow fragment PR solution. The obtained Klenow fragments PR were PR0, PR1, PR2, PR3, PR5, PR6, PR7, PR8, and PR9, respectively.

[0094] 3. PR protein detection

[0095] (1) SDS-PAGE electrophoresis

[0096] 20 μl of the modified Klenow fragment PR obtained in step 2 with a concentration of 1 mg / ml was mixed with 20 μl of loading buffer (Shenggong, C508321-0205) to obtain liquid 1, 10 μl of the modified Klenow fragment PR obtained in step 2 with a concentration of 0.05 mg / ml was mixed with 10 μl of loading buffer to obtain liquid 2, and 10 μl of liquid 1 and liquid 2 were respectively taken for SDS-PAGE electrophoresis. The results are as follows: Figure 1 The purity of the modified Klenow fragment PR after purification was greater than 95%. The purity of the modified Klenow fragments PR1, PR2, PR3, PR4, PR5, PR6, PR7, PR8, and PR9 were all greater than 95%. The results were as follows: Figure 2 , Figure 3 , Figure 4 , Figure 5 , Figure 6 , Figure 7 , Figure 8 , Fig. 9 , Fig.10 .

[0097] (2) Endonuclease activity detection

[0098] The endonuclease activity of the modified Klenow fragment PR obtained in step 2 was detected using the reaction system in Table 2:

[0099] Table 2

[0100]

[0101] Reaction buffer 1: 10 mM Tris, 10 mM KCl, 1 mM MgSO4, pH 7.4.

[0102] After the reaction system in Table 2 was incubated at 37°C for 4 hours, 1 μl of 0.5M EDTA was added to terminate the reaction. The reaction product was purified using a GelExtraction Kit (omegabio-tek). The PR-modified Klenow fragment was replaced with water as a negative control (NC). Then 1% agarose gel electrophoresis was performed. The main band of the pUC19 plasmid was not degraded, and the band was consistent with that of the gel electrophoresis diagram of the negative control, proving that the PR-modified Klenow fragment had no endonuclease contamination, and PR0, PR1, PR2, PR3, PR4, PR5, PR6, PR7, PR8, and PR9 had no endonuclease contamination. The results are as follows: Fig.11 , Fig.12 , Fig.13 , Fig.14 , Fig.15 , Fig.16 , Fig.17 , Fig.18 , Fig.19 , Fig. 20 .

[0103] (3) DNase activity detection

[0104] In this experiment, the DNase activity was detected using the kit AM1970M from Thermo Fisher Scientific.

[0105] Experimental procedure: Resuspend DNaseAlert Substrate (Thermo Fisher Scientific) in 1 ml TE buffer (Thermo Fisher Scientific, catalog number: AM1970M) to ensure that the substrate is completely dissolved. Take the resuspended DNaseAlert Substrate and add 5 μl per well to the 384-well plate. Add 40 μl of the modified Klenow fragment PR enzyme obtained in step 2 to the sample well and mix well. Set up negative and positive controls. The negative control is to replace the PR1 modified Klenow fragment enzyme solution with an equal volume of nuclease-free water. The positive control is to dilute 10× Nuclease Alert Buffer (invitrogen) 10 times to 1× solution with nuclease-free water, and then dilute the standard DNase I (Thermo Fisher Scientific, catalog number: AM1970M) five times with 1× solution, take 2.5 μl and add it to the positive control well. At the same time, add 37.5 μl of nuclease-free water to make up the system and shake to mix well.

[0106] After incubation at 37°C for 10 min, the cells were detected using a Gen5 microplate reader. Based on the fluorescence value detected, the DNase activity of the modified Klenow fragment PR was calculated to be 0.002 U / μl, and there was no DNASE activity. The DNase activities of PR1, PR2, PR3, PR4, PR5, PR6, PR7, PR8, and PR9 were 0.001 U / μl, 0.001 U / μl, 0.001 U / μl, 0.002 U / μl, 0.002 U / μl, 0.001 U / μl, 0.001 U / μl, and 0.002 U / μl, respectively.

[0107] 4. Detection of DNA polymerase activity of modified Klenow fragment PR using dNTP as substrate

[0108] Using enzyme dilution buffer (20mM pH 7.4 Tris and 100mM KCl, solvent is water), 20μl of the modified Klenow fragment PR (0.5mg / ml) obtained in step 2 was diluted in a round-bottom 96-well plate according to a gradient of 8, 16, 30, 64, and 128 times, and finally the modified Klenow fragment PR diluted 128 times was obtained, and then the reaction was carried out according to the reaction system in Table 3.

[0109] Table 3

[0110] Components volume annealedmixture 2.5μl 10mM dNTP 1.25μl Dilute 128 times the modified Klenow fragment PR 3μl Reaction Buffer 2 12.5μl <![CDATA[H 2 The]]> 5.75μl

[0111] Reaction buffer 2: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl 2 and 100 μg / ml BSA, pH 7.9, at 25°C. The components and proportions of the annealed mixture in Table 3 are shown in Table 4:

[0112] Table 4

[0113] Components volume 30μM template 2.5μl 30μM primer 2.5μl 2*reaction buffer (reaction buffer) 12.5μl <![CDATA[H 2 The]]> 7.5μl

[0114] H 2 O was used as a negative control, and three parallels were set up. The reaction system was placed in a PCR instrument and incubated at 37°C for 30 minutes, and then quickly placed on ice. 1μl 50mM EDTA was used to terminate the reaction. Among them, 2*reaction buffer: 10mM Tris, 50mMNaCl, pH 7.4; template: ATCTGAGGACACGGCCGTGTATTACTGTGCGAAGAGCATTGCTGCATCCAGTTTGCAAAGT (SEQ ID NO.3); primer: TAGACTCCTGT (SEQ ID NO.4).

[0115] After the reaction, take 2μl of the final reaction solution to a 96-well plate pre-added with 38μl TE buffer, blow and mix with a pipette tip, then take 10μl to a black flat-bottom 96-well plate pre-added with 40μl TE buffer; dilute 500ng / mlλDNA in other wells of this 96-well plate by 2-fold gradient, and take 50μl of the dilution solution of each dilution gradient as a standard to a new well. Use TE buffer to dilute Picogreen (Thermo Fisher Scientific) dye 200 times, take 50μl and add it to the above sample wells, mix well, and stand at room temperature in the dark for 2 minutes. Detect fluorescence at an excitation light of 480nm and an emission light of 520nm. The detection results show that the polymerized dNTP amount of PR0 in the 128-fold diluted enzyme solution is 0.21 nmol; the polymerized dNTP amounts of PR1, PR2, PR3, BG8, PR5, PR6, PR7, PR8, and PR9 are 0.34 nmol, 0.22 nmol, 0.35 nmol, 0.26 nmol, 0.27 nmol, 0.28 nmol, 0.3 nmol, 0.28 nmol, and 0.35 nmol, respectively. DNA polymerase activity ratio = ratio of the detected polymerized dNTP amounts. The specific calculation results are shown in Table 5:

[0116] Table 5

[0117]

[0118]

[0119] The calculation results showed that compared with PR0, the polymerase activity of other PR mutants was improved.

[0120] 5. Sequencing effect detection

[0121] PR1, PR2, PR3, BG8, PR5, PR6, PR7, PR8, and PR9 were sequenced on the GenoCare sequencing platform using the synthesized known sequences as templates. The control enzymes were NEB's Klenow fragment (Cat. No. M0407B) and Vazyme's Klenow fragment (N105-C1). The construction of the Genocare platform can refer to the contents disclosed in CN201610209150.2 and CN201710607295.2, and the sequencing process can refer to the sequencing process in the article https: / / doi.org / 10.1371 / journal.pone.0188181 (Single molecules sequencing of the M13 virus genome without amplification). The synthesized known sequence is 5'-TATTGATTCTCAAACTTACTCAAAATTAATTTTTAAATAACATTCTAACAAAATACCTCACTGGGTGC GGAAGAGAAAGAATACCATGCAGAAGGAGGCAAAGTA-3' (SEQ ID NO.5). The chip probe used for sequencing in this embodiment is 5'-TACTTTGCCTCCTTCTGCATGGTATTCTTTCTCTTCCGCACCCAG-3' (SEQ ID NO.6), and the probe 5' is fixed on the chip, and the probe 5' is connected to FAM fluorescence.

[0122] The sequencing process is:

[0123] 1) Hybridizing the template with the chip probe;

[0124] 2) Then, fluorescently labeled dNTP and Klenow enzyme were added to the chip, wherein the dNTP was stored in buffer I to form a nucleotide solution, wherein the composition of buffer I was 20 mM Tris-HCl, pH 8.8, 10 mM MgSO 4, 10 mM (NH 4 ) 2 SO 4 , 10 mM HCI, and 0.1% Triton X-100; 100 U of Klenow fragment was added to the chip;

[0125] 3) The sequencing reaction was performed at 37 degrees Celsius.

[0126] In order to eliminate the influence of the sequencing chip on the experimental results, the Klenow enzyme of this example and the control enzyme were sequenced and detected on the same sequencing chip.

[0127] Experimental results:

[0128] The sequencing results of the modified Klenow fragment were compared with those of the Klenow fragment of NEB and Vazyme to analyze the sequencing ability of the modified Klenow fragment.

[0129] PR1:

[0130] PR1 contains Mn 2+ The sequencing effect in the solution containing Mg is better than that in the solution containing Mg. 2+ The sequencing effect of PR1 was good in the solution containing Mn 2+ The sequencing effect of the solution was better than that of the Klenow fragment of NEB and the Klenow fragment of Vazyme, with the average read length being 1.17 times and 1.36 times that of the latter two enzymes, respectively. The specific sequencing results are as follows Fig.21 As shown, the horizontal axis is the sequencing read length, and the vertical axis represents the percentage of each sequencing read length in the total number of all sequencing read lengths; PR1-Mn 2+ : PR1 contains Mn 2+ Sequencing results in the sequencing buffer of 2+ The concentration of MgSO was 5 mM and the sequencing buffer was 10 mM MgSO 4 Replaced with 2 mM MnSO 4 or MnCl 2 NEB: sequencing results of Klenow fragment of NEB; Vazyme: sequencing results of Klenow fragment of Vazyme; PR1 in the presence of Mn 2+ The sequencing was performed twice in parallel in the solution.

[0131] PR2:

[0132] PR2 contains Mn 2+ The sequencing effect of PR2 in the buffer containing Mn was better than that of Klenow fragment of NEB and Klenow fragment of Vazyme. The average sequencing read length was 1.03 times and 1.04 times that of the latter two enzymes, respectively. 2+ Sequencing in buffer containing Mg is better than that in buffer containing Mg 2+ The specific sequencing results are as follows Fig. 22 As shown, the horizontal axis is the sequencing read length, and the vertical axis represents the percentage of each sequencing read length in the total number of all sequencing read lengths; PR2: sequencing results of PR2 in buffer I; PR2-Mn 2+ : PR2 contains Mn 2+ Sequencing results in the sequencing buffer of 2+ The concentration of MgSO was 0.5 mM and the sequencing buffer was 10 mM MgSO 4 Replaced with 5 mM MnSO4 or MnCl 2 The solution after PCR; NEB: sequencing results of Klenow fragment of NEB; Vazyme: sequencing results of Klenow fragment of Vazyme.

[0133] PR3:

[0134] Sequencing results of PR3: PR3 contains Mn 2+ The sequencing read length of PR3 was seriously stuck at the short fragment when sequenced in the sequencing buffer of 100 μg / mL. The average sequencing read length of PR3 was 1.01 times that of NEB's Klenow fragment when sequenced in buffer I. The average read lengths of the two fragments were comparable. At the same time, PR3 can effectively reduce the BRR in the sequencing results. The BRR is 0.65 times that of the Klenow fragment sequencing results of NEB. For specific sequencing results, see Fig.23 , Fig.23 The horizontal axis is the sequencing read length, and the vertical axis represents the percentage of each read length in the total number of all sequencing read lengths; PR3: sequencing results of PR3 in buffer I; NEB: sequencing results of Klenow fragments from NEB; PR3-Mn 2+ : PR3 contains Mn 2+ Sequencing results in the sequencing buffer of 2+ The concentration of MgSO was 5 mM and the sequencing buffer was 10 mM MgSO 4 Replaced with 5 mM MnSO 4 or MnCl 2 After the solution.

[0135] PR4:

[0136] The sequencing results of PR4 were compared with those of Vazyme's Klenow fragment. The average read length obtained by PR4 in buffer I was stagnant at short fragments; 2+ The average sequencing read length was comparable to that of Vazyme's Klenow fragment, and the BRRs in the sequencing results of the two enzymes were comparable. 2+ When sequencing in a buffer of , the average sequencing read length was 1.07 times that of Vazyme's Klenow fragment. Figure 24-1 , 24-2, the horizontal axis is the sequencing read length, and the vertical axis represents the percentage of each read length in the total number of all sequencing read lengths; PR4-Mn 2+ : PR4 contains Mn 2+ Sequencing results in the sequencing buffer of 2+ The concentration of MgSO was 5 mM and the sequencing buffer was 10 mM MgSO 4Replaced with 5 mM MnSO 4 or MnCl 2 PR4: sequencing results of PR4 in buffer I; Vazyme: sequencing results of Klenow fragment of Vazyme.

[0137] PR5:

[0138] PR5 contains Mn 2+ The sequencing results were compared with those of PR1 and Vazyme's Klenow fragments in the buffer. The BRR in the sequencing results of PR5 was lower than that of PR1 and Vazyme's Klenow fragments, and the average sequencing read length was equivalent to that of Vazyme's Klenow fragments. The specific sequencing results are shown in Table 6 and Fig.25 , Fig.25 The horizontal axis is the sequencing read length, and the vertical axis represents the percentage of each read length in the total number of all sequencing read lengths; PR1: sequencing results of PR1 in buffer I; PR5-Mn 2+ :In the presence of Mn 2+ Sequencing results in the sequencing buffer of 2+ The concentration of MgSO was 5 mM and the sequencing buffer was 10 mM MgSO 4 Replaced with 1 mM MnSO 4 or MnCl 2 The resulting solution; Vazyme: sequencing results of the Klenow fragment from Vazyme.

[0139] Table 6

[0140] <![CDATA[PR5-Mn 2+ / PR1]]> <![CDATA[PR5-Mn 2+ / Vazyme]]> BRR 0.78 0.96 Average length 0.96 1

[0141] PR6:

[0142] The sequencing results of PR6 were compared with those of Vazyme's Klenow fragment. When PR6 was sequenced in buffer I, the sequencing read length was stagnant at short fragments. 2+ The average read length obtained when sequencing in the buffer was comparable to that of Vazyme's Klenow fragment, and the BRR in the PR6 sequencing result was 0.82 times that of Vazyme's Klenow fragment. The specific sequencing results are shown in Table 7 and Fig.26 , Fig.26 The horizontal axis is the sequencing read length, and the vertical axis represents the percentage of each read length in the total number of all sequencing read lengths; PR6: sequencing results of PR1 in buffer I; PR6-Mn 2+ : PR6 contains Mn 2+ Sequencing results in the sequencing buffer of 2+The concentration of MgSO was 5 mM and the sequencing buffer was 10 mM MgSO 4 Replaced with 5mM MnSO 4 or MnCl 2 The resulting solution; Vazyme: sequencing results of the Klenow fragment from Vazyme.

[0143] Table 7

[0144] PR6 / Vazyme PR6-Mn2+ / Vazyme BRR 0.99 0.82 Average length 0.67 1.04

[0145] PR7:

[0146] The experimental results of multiple batches of PR7 and PR3 were compared and analyzed, and the sequencing results of PR7 and Vazyme's Klenow fragment were compared. When the sequencing buffer was buffer I, the average sequencing read length in the PR7 sequencing results was 1.15 times that of Vazyme's Klenow fragment, which was shorter than the average sequencing read length in the PR3 sequencing results; the BRR in the PR7 sequencing results was lower than that of Vazyme's Klenow fragment and PR3. The amplification ability of PR7 was different under different buffer conditions. 2+ The sequencing effect is best under the condition of Mn 2+ Mg-free 2+ Under the condition of Mn 2+ Mg 2+ Under the condition of , PR7 can be effectively sequenced, and the average sequencing read length is 1.12 times that of Vazyme's Klenow fragment. The specific sequencing results are shown in Table 8 and Figure 27-1 , 27-2, Figure 27-1 and 27-2 The horizontal axis is the sequencing read length, and the vertical axis represents the percentage of each read length in the total number of all sequencing read lengths; 2+ and PR7-Mn-Mg represent the sequencing results of PR7 in different sequencing buffers, PR7: sequencing results of PR7 in buffer I; PR7-Mn 2+ : PR7 contains Mn 2+ The sequencing results in the sequencing buffer of , wherein the sequencing buffer is 10mM MgSO in buffer I 4 Replaced by MnSO 4 or MnCl 2 The solution after that, and Mn 2+ The concentration is 5mM; PR7-Mn-Mg: PR7 contains Mn 2+ and Mg 2+The sequencing results were obtained in a sequencing buffer prepared by mixing 10 mM MgSO 4 The concentration of MnSO was reduced to 5 mM and 4 or MnCl 2 The concentration is 2 mM, and the other components are the same as buffer I; Vazyme: sequencing results of the Klenow fragment of Vazyme.

[0147] Table 8

[0148] PR7 / Vazyme PR7 / PR3 PR7-Mn / Vazyme PR7-Mn-Mg / Vazyme BRR 0.44 0.97 0.78 1.18 Average length 1.15 0.73 0.89 1.12

[0149] PR8:

[0150] When sequencing in buffer I, PR8 can be effectively sequenced. The average sequencing read length of PR8 sequencing results is 9.43, which is shorter than the average read length of Vazyme's Klenow fragment. 2+ When sequencing in a solution of , the sequencing read length stagnates at short fragments.

[0151] For detailed sequencing results, see Fig.28 , Fig.28 The horizontal axis is the sequencing read length, and the vertical axis represents the percentage of each read length in the total number of all sequencing read lengths; PR8: sequencing results of PR8 in buffer I; PR8-Mn 2+ : PR8 contains Mn 2+ Sequencing results in the sequencing buffer of 2+ The concentration of MgSO was 1 mM, and the sequencing buffer was 10 mM MgSO 4 Replaced with 5 mM MnSO 4 or MnCl 2 The resulting solution; Vazyme: sequencing results of the Klenow fragment from Vazyme.

[0152] PR9:

[0153] PR9 contains Mn 2+ When sequencing in buffer I, the sequencing read length stagnated at short fragments. The average sequencing read length in the PR9 sequencing result was 10.59, which was shorter than the average sequencing read length of Vazyme's Klenow fragment. PR9 can be effectively sequenced in buffer I. For specific sequencing results, see Fig.29 , PR9-Mn 2+ :G33 contains Mn 2+ Sequencing results in the sequencing buffer of 2+ The concentration of MgSO was 5 mM and the sequencing buffer was 10 mM MgSO 4 Replaced with 5 mM MnSO4 or MnCl 2 PR9: sequencing results of PR9 in buffer I; Vazyme: sequencing results of Klenow fragment of Vazyme.

[0154] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. A modified Klenow fragment, characterized in that The modified Klenow fragment is used for nucleic acid sequencing. Taking DNA polymerase I as a benchmark, the amino acid sequence of the modified Klenow fragment has amino acid substitution mutations, and the amino acid mutations are substitution mutations of A842K and I709K.

2. The modified Klenow fragment according to claim 1, characterized in that At least one end of the modified Klenow fragment amino acid sequence carries a known sequence of less than 12 aa in length; Optionally, the known sequence is located at the N-terminus of the modified Klenow fragment amino acid sequence; Optionally, the known sequence comprises 6-10 histidine residues; Optionally, the known sequence is selected from at least one of GSSHHHHHHSSG and HHHHHHHHHHH.

3. A nucleic acid molecule encoding the modified Klenow fragment according to claim 1 or 2. An expression vector comprising the nucleic acid molecule of claim 3 . A host cell comprising the vector according to claim 4 .

6. A method for incorporating nucleotides into DNA, characterized in that: The method comprises: (a) the modified Klenow fragment or a mixture of modified Klenow fragments as claimed in any one of claims 1 to 2, (b) DNA and (c) a nucleotide solution for interaction.

7. The method according to claim 6, characterized in that The nucleotides contained in the (c) nucleotide solution are nucleotides labeled with fluorescent molecules; Optionally, the (c) nucleotide solution comprises Mg 2+ and / or Mn 2+ ; Optionally, (a) comprises a modified Klenow fragment, wherein the modified Klenow fragment comprises a modified Klenow fragment functionally equivalent to an A842K substitution mutation, and (c) the nucleotide solution comprises Mn 2+ But does not contain Mg 2+ , the Mn 2+ The concentration is 0.1mM~5mM; Optionally, (a) comprises a modified Klenow fragment, wherein the amino acid sequence of the modified Klenow fragment comprises substitution mutations functionally equivalent to A842K and I709K; (c) the nucleotide solution comprises Mg 2+ and Mn 2+ , the Mg 2+ The concentration of Mn is 5mM to 10mM. 2+ The concentration is 0.1mM~5mM.

8. A kit for incorporating nucleotides into DNA, comprising the modified Klenow fragment according to claim 1 or 2.

9. The kit according to claim 8, characterized in that The kit also includes a nucleotide solution; Optionally, the nucleotides contained in the nucleotide solution are nucleotides labeled with fluorescent molecules; Optionally, the kit comprises a modified Klenow fragment and a nucleotide solution comprising Mg 2+ But does not contain Mn 2+ , the Mg 2+ The concentration is 5mM to 10mM; the amino acid sequence of the modified Klenow fragment has the following amino acid substitution mutation combination: substitution mutations of A842K and I709K; Optionally, the kit comprises a modified Klenow fragment and a nucleotide solution comprising Mg 2+ and Mn 2+ , the Mg 2+ The concentration of Mn is 5mM to 10mM. 2+ The concentration is 0.1 mM to 5 mM; the amino acid sequence of the modified Klenow fragment has the following two amino acid substitution mutations: A842K and I709K substitution mutations.

10. Use of any kit according to claim 8 or 9 in nucleic acid sequence extension reaction.

Images