Lycopene cyclase mutant protein as well as preparation method and application thereof

Abstract

The invention discloses lycopene cyclase mutant protein as well as a preparation method and application thereof. The invention provides a mutant protein (a mutant protein of lycopene cyclase). The mutant protein is obtained by mutating an amino acid of a target site in a protein before mutation into other amino acids; the pre-mutation protein has segments shown as the first site to the 239 site in SEQ ID NO: 5; the target site is located at the 98th site of SEQ ID NO: 5. The mutant protein provided by the invention has higher enzyme activity, so that a target object can be synthesized more efficiently, and the mutant protein has important application prospects in biotechnology and industrial production. According to the method, the yield of the carotenoid can be remarkably increased, the production cost is reduced, wide application of the carotenoid in various fields is promoted, and huge economic and social benefits are achieved.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a lycopene cyclase mutant protein and a preparation method and application thereof. Background Art

[0002] Carotenoids are a class of natural pigments that are widely found in nature and have important biological functions and wide application value. These pigments not only give plants, algae and some microorganisms bright colors, but also play an important role in photosynthesis, and have multiple health benefits such as anti-oxidation and immune enhancement. Therefore, carotenoids have a wide range of application needs in the food, medicine, cosmetics and other industries.

[0003] The MVA pathway is one of the pathways for the synthesis of IPP (isopentenyl pyrophosphate) and DMAPP (dimethylallylpyrophosphate). In the MVA pathway, acetyl-CoA is synthesized into IPP through the catalytic action of acetyl-CoA acetyltransferase (AtoB), 3-hydroxy-3-methylglutaryl CoA synthase (ERG13), 3-hydroxy-3-methylglutaryl CoA reductase (HMG1), mevalonate kinase (ERG12), phosphomevalonate kinase (ERG8) and mevalonatediphosphate decarboxylase (MVD1). Isopentenyl diphosphate isomerase (IDI) catalyzes IPP to generate the isomer DMAPP. ERG20 and GGS are isofunctional enzymes, both belonging to the FPP / GGPP synthase family. They are bifunctional enzymes with both dimethylallyltransferase and geranyltransferase activities. They first catalyze DMAPP and IPP to synthesize GPP (geranylpyrophosphate), and then catalyze GPP and IPP to generate FPP (farnesyl diphosphate). Geranylgeranyl pyrophosphate synthase (GGPP synthase, GGPPS) catalyzes the condensation of FPP and IPP to generate GGPP (Geranylgeranylpyrophosphate).

[0004] CarRP, whose full name is bifunctional lycopene cyclase / phytoene synthase, is a bifunctional enzyme that contains two functional domains, namely CarRP-R (with lycopene cyclase activity) at the N-terminus and CarRP-P (with phytoene synthase activity) at the C-terminus. CarRP-P is responsible for synthesizing two molecules of GGPP into phytoene. Phytoene is converted into lycopene by the action of phytoene desaturase (carB). Lycopene is cyclized to form γ-carotene and β-carotene by the action of CarRP-R. β-carotene is synthesized into carotenoids such as canthaxanthin, zeaxanthin and astaxanthin by the action of β-carotene ketolase (CrtW) and β-carotene hydroxylase (CrtZ). CarRP plays a vital role in carotenoid synthesis. However, the current production efficiency of natural carotenoids is low and it is difficult to meet the needs of industrial production.

[0005] In order to improve the production efficiency of carotenoids, researchers have tried to modify CarRP through genetic engineering to enhance its catalytic activity and yield. Among them, mutating the lycopene cyclase functional domain of CarRP is a potential strategy to improve the efficiency of carotenoid synthesis. Summary of the invention

[0006] The present invention aims to screen out mutant proteins that can significantly improve the synthesis efficiency of target substances (canthaxanthin and β-carotene) by performing site-directed saturation mutagenesis on specific amino acids in the lycopene cyclase functional domain of CarRP.

[0007] The invention provides a lycopene cyclase mutant protein and a preparation method and application thereof.

[0008] The present invention provides a mutant protein (a mutant protein of lycopene cyclase), named as CarRP-R mutant protein, which is obtained by mutating the amino acid at the target site in the pre-mutation protein to other amino acids; the pre-mutation protein has the segment shown in positions 1 to 239 of SEQ ID NO: 5; the target site is located at position 98 of SEQ ID NO: 5. The CarRP-R mutant protein is obtained by mutating the amino acid at the target site in the pre-mutation protein from arginine to other amino acids. Specifically, the pre-mutation protein is shown in positions 1 to 239 of SEQ ID NO: 5. Specifically, the pre-mutation protein is a wild-type lycopene cyclase.

[0009] The present invention also provides a mutant protein (a mutant protein of a bifunctional lycopene cyclase / phytoene synthase), named as a CarRP mutant protein, which is obtained by mutating the amino acid at the target site in the pre-mutation protein to other amino acids; the pre-mutation protein has a segment shown in SEQ ID NO: 5; the target site is located at position 98 of SEQ ID NO: 5. The CarRP mutant protein is obtained by mutating the amino acid at the target site in the pre-mutation protein from arginine to other amino acids. Specifically, the pre-mutation protein is as shown in SEQ ID NO: 5. Specifically, the pre-mutation protein is a wild-type bifunctional lycopene cyclase / phytoene synthase.

[0010] Specifically, any of the other amino acids mentioned above is a basic amino acid, a neutral amino acid or an acidic amino acid.

[0011] Specifically, any of the above other amino acids is an aliphatic amino acid, a heterocyclic amino acid or an aromatic amino acid.

[0012] Specifically, any of the above other amino acids is alanine, histidine, tyrosine, serine or threonine.

[0013] The present invention also protects the gene encoding the CarRP-R mutant protein.

[0014] Specifically, the gene is as follows (c1) or (c2) or (c3):

[0015] (c1) a DNA molecule whose coding region is shown in positions 1 to 717 of SEQ ID NO: 3;

[0016] (c2) a DNA molecule having more than 95% identity with (c1);

[0017] (c3) A DNA molecule that hybridizes to (c1) under stringent conditions.

[0018] The stringent conditions mentioned above may be using a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS, hybridizing at 65° C. and washing the membrane in a DNA or RNA hybridization experiment.

[0019] The present invention also protects the gene encoding the CarRP mutant protein.

[0020] Specifically, the gene is as follows (d1) or (d2) or (d3):

[0021] (d1) a DNA molecule whose coding region is shown in SEQ ID NO: 3;

[0022] (d2) a DNA molecule having more than 95% identity with (d1);

[0023] (d3) A DNA molecule that hybridizes to (d1) under stringent conditions.

[0024] The stringent conditions mentioned above may be using a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS, hybridizing at 65° C. and washing the membrane in a DNA or RNA hybridization experiment.

[0025] The present invention also protects an expression cassette, a DNA molecule, a recombinant vector or a recombinant microorganism having any of the above genes.

[0026] Specifically, the expression cassette consists of P TEFin The promoter initiates transcription of the gene and is HMG1 The terminator terminates the transcription of the gene.

[0027] Specifically, the DNA molecule having the gene is a donor DNA molecule. Specifically, the donor DNA molecule has L-arm, the expression cassette and R-arm in sequence from upstream to downstream. L-arm is the upstream homology arm, and R-arm is the downstream homology arm. The upstream homology arm and the downstream homology arm are used to integrate the expression cassette into the target site. Specifically, the target site is the intC3 site. The L-arm is the upstream homology arm obtained by PCR amplification using a template, and the template and the primers used for PCR amplification are shown in the pintC3-CarRP plasmid part in Table 3. The R-arm is the downstream homology arm obtained by PCR amplification using a template, and the template and the primers used for PCR amplification are shown in the pintC3-CarRP plasmid part in Table 3.

[0028] Specifically, the recombinant vector having the gene is a recombinant vector having the expression cassette. Specifically, the recombinant vector having the gene is a recombinant vector having the donor DNA molecule. Specifically, the recombinant vector may be pintC3-CarRPtb 98-78 Plasmid, pintC3-CarRPtb98-97 、Plasmid pintC3-CarRPtb 98-72 Plasmid, pintC3-CarRPtb 98-59 Plasmid or pintC3-CarRPtb 98-75 Compared with pintC3-CarRP plasmid, pintC3-CarRPtb 98-78 The only difference between the plasmids is that the codon encoding the 98th amino acid residue of CarRP has been replaced from the codon encoding arginine (AGA) to the codon encoding histidine (CAT). 98-97 The only difference between the plasmids is that the codon encoding the 98th amino acid residue of CarRP has been replaced from the codon encoding arginine (AGA) to the codon encoding alanine (GCG). 98-72 The only difference between the plasmids is that the codon encoding the 98th amino acid residue of CarRP has been replaced from the codon encoding arginine (AGA) to the codon encoding serine (TCT). 98-59 The only difference between the plasmids is that the codon encoding the 98th amino acid residue of CarRP has been replaced from the codon encoding arginine (AGA) to the codon encoding threonine (ACT). 98-75 The difference between the plasmids is that the codon encoding the 98th amino acid residue of CarRP has been replaced from the codon encoding arginine (AGA) to the codon encoding tyrosine (TAT). Construction method of pintC3-CarRP plasmid: L-arm (upstream homology arm obtained by PCR amplification using template, template and primers used for PCR amplification are shown in Table 3), P TEFin (P obtained by PCR amplification using template TEFin Promoter, template and primers used for PCR amplification are shown in Table 3), CarRP (CarRP gene obtained by PCR amplification using template, template and primers used for PCR amplification are shown in Table 3), T HMG1 (T obtained by PCR amplification using template HMG1terminator, template and primers used for PCR amplification are shown in Table 3), R-arm (downstream homology arm obtained by PCR amplification using the template, template and primers used for PCR amplification are shown in Table 3) and PUC57-GG were sequentially connected by Golden Gate cloning technology to obtain the pintC3-CarRP plasmid.

[0029] Specifically, the donor DNA molecule is the following segment in the recombinant vector: a segment starting from L-arm and ending at R-arm and having a gene encoding the CarRP mutant protein. Specifically, the donor DNA molecule is a linear DNA molecule having a gene encoding the CarRP mutant protein obtained by digesting the recombinant vector with restriction endonuclease SwaI.

[0030] Specifically, the recombinant microorganism having the gene is a recombinant microorganism having the expression cassette. Specifically, the recombinant microorganism having the gene is a recombinant microorganism having the donor DNA molecule. Specifically, the recombinant microorganism may be a recombinant bacterium. Specifically, the recombinant bacterium may be a recombinant bacterium obtained by introducing the gene into the chassis strain. Specifically, the recombinant bacterium may be a recombinant bacterium obtained by introducing the recombinant vector into the chassis strain. Specifically, the recombinant bacterium may be a recombinant bacterium obtained by integrating the gene into the genomic DNA of the chassis strain. Specifically, the recombinant bacterium may be a recombinant bacterium obtained by integrating the expression cassette of the gene into the genomic DNA of the chassis strain. Specifically, the recombinant bacterium may be a recombinant bacterium obtained by integrating the gene into the intC3 site of the genomic DNA of the chassis strain. Specifically, the recombinant bacterium may be a recombinant bacterium obtained by integrating the expression cassette of the gene into the intC3 site of the genomic DNA of the chassis strain. Specifically, the recombinant bacterium may be a recombinant bacterium obtained by replacing the segment from the beginning of L-arm to the end of R-arm in the genomic DNA of the chassis strain with a donor DNA molecule. Specifically, the recombinant bacteria can be a recombinant bacteria in which the donor DNA molecule is integrated into the intC3 site of the genomic DNA obtained by co-transforming the digestion product obtained by digesting the recombinant vector with SwaI and the pintC3-N20 plasmid into competent cells of the chassis strain.

[0031] The present invention also protects the use of biological materials in preparing products;

[0032] The functions of the product are as follows (b1) and / or (b2) and / or (b3):

[0033] (b1) as lycopene cyclase;

[0034] (b2) as a bifunctional lycopene cyclase / phytoene synthase;

[0035] (b3) Preparation of carotenoids.

[0036] The invention also protects the use of biological materials in preparing carotenoids.

[0037] Any of the above biological materials is any of the above CarRP-R mutant proteins, any of the above CarRP mutant proteins, any of the above genes encoding CarRP-R mutant proteins, any of the above genes encoding CarRP mutant proteins, any of the above expression cassettes, any of the above donor DNA molecules, any of the above recombinant vectors or any of the above recombinant microorganisms.

[0038] The present invention also protects the use of any of the above CarRP-R mutant proteins as lycopene cyclase.

[0039] The present invention also protects the use of any of the above-mentioned CarRP mutant proteins as a bifunctional lycopene cyclase / phytoene synthase.

[0040] The carotenoid is β-carotene or a downstream product of β-carotene.

[0041] Exemplarily, the downstream product of β-carotene is canthaxanthin.

[0042] Exemplarily, the downstream products of β-carotene are canthaxanthin and / or zeaxanthin and / or astaxanthin.

[0043] Specifically, the chassis strain is a strain capable of synthesizing IPP and DMAPP.

[0044] Specifically, the chassis strain is a strain capable of synthesizing GGPP.

[0045] Specifically, the chassis strain is a strain capable of synthesizing phytoene.

[0046] Specifically, the chassis strain is a strain capable of synthesizing lycopene.

[0047] The chassis strains include, but are not limited to, Yarrowia lipolytica, Escherichia coli, Carynebacterium glutamicum, Bacillus subtilis, Bacillus megaterium, or Saxxharomyces cerevisiae.

[0048] Specifically, the chassis strain is a recombinant bacterium obtained by transforming the starting bacterium as follows: the target gene is integrated into the genomic DNA and the target protein is expressed; the target gene is a gene encoding the target protein; the target protein is ERG20 protein, ERG12 protein, GGPPS protein, IDI protein, HMG1 protein, GGS protein, CarB protein and HPcrtW protein.

[0049] Specifically, the chassis strain is a recombinant bacterium obtained by transforming the starting bacterium as follows: ERG20 gene, ERG12 gene, GGPPS gene, IDI gene, HMG1 gene, GGS gene, CarB gene and HPcrtW gene are integrated into the genomic DNA.

[0050] Specifically, the chassis strain is a recombinant bacterium obtained by transforming the starting bacteria as follows: ERG20 gene expression cassette, ERG12 gene expression cassette, GGPPS gene expression cassette, IDI gene expression cassette, HMG1 gene expression cassette, GGS gene expression cassette, CarB gene expression cassette and HPcrtW gene expression cassette are integrated into the genomic DNA.

[0051] Specifically, the chassis strain is a recombinant bacterium obtained by subjecting the starting bacterium to the following transformations (a1) to (a5):

[0052] (a1) The ERG20 gene expression cassette and the ERG12 gene expression cassette were integrated into the intE3 site of the genomic DNA;

[0053] (a2) The GGPPS gene expression cassette and the IDI gene expression cassette were integrated into the intE1 site of the genomic DNA;

[0054] (a3) The HMG1 gene expression cassette and the GGS gene expression cassette were integrated into the intF1 site of the genomic DNA;

[0055] (a4) CarB gene expression cassette and HPcrtW gene expression cassette were integrated into the intC2 site of genomic DNA;

[0056] (a5) The CarB gene expression cassette and the HPcrtW gene expression cassette were integrated into the intF2 site of the genomic DNA.

[0057] The ERG20 gene is a gene encoding the ERG20 protein. The ERG12 gene is a gene encoding the ERG12 protein. The GGPPS gene is a gene encoding the GGPPS protein. The IDI gene is a gene encoding the IDI protein. The HMG1 gene is a gene encoding the HMG1 protein. The GGS gene is a gene encoding the GGS protein. The CarB gene is a gene encoding the CarB protein. The HPcrtW gene is a gene encoding the HPcrtW protein. As a specific form, the GGPPS gene is the GGPPxd gene.

[0058] The starting bacteria may specifically be Yarrowia lipolytica Po1g.

[0059] The starting bacteria may specifically be Yarrowia lipolytica YL002.

[0060] The starting bacteria can specifically be a recombinant bacterium obtained by transforming Yarrowia lipolytica Polg as follows: replacing the KU70 gene in the genomic DNA with a DNA molecule having a Cas9 gene expression cassette and a hygromycin resistance gene expression cassette and knocking out the URA3 gene in the genomic DNA.

[0061] Specifically, the chassis strain is the recombinant strain WM001 obtained by sequentially operating Yarrowia lipolytica YL002 according to steps 2 to 6 of Example 2.

[0062] ERG12: Gene symbol: YALI1_B21004g; YL No: YALI0B16038g; GeneID: 2906793; The amino acid sequence of ERG12 protein in NCBI number: XP_500956.1 (10-SEP-2024); The nucleotide sequence of ERG12 gene in NCBI number: XM_500956.3 (10-SEP-2024).

[0063] ERG20: Gene symbol: YALI1_E06759g; YL No: YALI0E05753g; GeneID: 2912329;

[0064] The amino acid sequence of ERG20 protein is numbered in NCBI: XP_503599.1 (10-SEP-2024); the nucleotide sequence of ERG20 gene is numbered in NCBI: XM_503599.3 (10-SEP-2024).

[0065] IDI: Gene symbol: YALI1_F06018g; YL No: YALI0F04015g; GeneID: 2907710; The amino acid sequence of IDI protein in NCBI is numbered: XP_504974.3 (10-SEP-2024); The nucleotide sequence of IDI gene in NCBI is numbered: XM_504974.3 (10-SEP-2024).

[0066] HMG1: Gene symbol: YALI1_E05731g; YL No: YALI0E04807g; GeneID: 2912214; The amino acid sequence of HMG1 protein in NCBI is numbered: XP_503558.1 (10-SEP-2024); The nucleotide sequence of HMG1 gene in NCBI is numbered: XM_503558.3 ​​(10-SEP-2024).

[0067] GGS: Gene symbol: YALI1_D21022g; YL No: YALI0D17050g; Gene ID: 2911219; The amino acid sequence of GGS protein in NCBI is numbered: XP_502923.1 (10-SEP-2024); The nucleotide sequence of GGS gene in NCBI is numbered: XM_502923.3 (10-SEP-2024).

[0068] ERG12 protein, ERG20 protein, IDI protein, HMG1 protein and GGS protein are all endogenous proteins of Yarrowia lipolytica. ERG12 gene, ERG20 gene, IDI gene, HMG1 gene and GGS gene are all endogenous genes of Yarrowia lipolytica.

[0069] GGPPS: The GGPPS protein is numbered UniProtKB / Swiss-Prot: Q1L6K3 (31-OCT-2006) in NCBI; the nucleotide sequence of the GGPPS gene is numbered DQ016502.1 (01-MAY-2006) in NCBI. The GGPPS protein is derived from Phaffia rhodozyma (Xanthophyllomyces dendrorhous). The GGPPS gene is derived from Phaffia rhodozyma (Xanthophyllomyces dendrorhous). The gene (GGPPxd gene) obtained by codon optimization of the GGPPS gene is shown in SEQ ID NO: 1.

[0070] The NCBI number for CarB protein is KAF1801867.1 (29-APR-2020). The CarB protein is derived from phytoenedehydrogenase [Mucor lusitanicus]. The CarB gene is shown in SEQ ID NO: 2.

[0071] The CrtW protein is numbered UniProtKB / Swiss-Prot: Q39982.1 (02-OCT-2024) in NCBI. The CrtW protein is derived from Haematococcus lacustris. The CrtW gene is shown in SEQ ID NO: 4.

[0072] The mutant protein provided by the present invention has higher enzyme activity, so that the target compound can be synthesized more efficiently, and has important application prospects in biotechnology and industrial production. The present invention can not only significantly increase the yield of carotenoids and reduce production costs, but also promote the wide application of carotenoids in various fields, with huge economic and social benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0073] Figure 1 Flow chart for the construction of chassis strain WM001.

[0074] Figure 2 It is the HPLC chromatogram in Example 3.

[0075] Figure 3 It is the canthaxanthin content and β-carotene content in Example 3. DETAILED DESCRIPTION

[0076] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0077] The experimental methods in the following examples, unless otherwise specified, are conventional methods, carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources. Unless otherwise specified, the quantitative tests in the following examples are set up with three repeated experiments, and the results are averaged. The kit used for seamless cloning is Seamless Cloning Kit, Bio-Sky Company, product catalog number D7010M. pUC57 plasmid: GenScript Company, product catalog number SD1176. pUC57-Kan plasmid: GenScript Company.

[0078] Plasmid pURA-YL-IntC2 (Plasmid pURA-YL-IntC2) and Strain Po1g (Strain Po1g) are both recorded in the following literature: Meng Zhang, Qing Yan Li, Feiyu Fan, Fuping Lu and Xue Li Zhang, Combinatorial metabolic engineering and tolerance evolution of Yarrowialipolytica for improved γ-decalactone synthesis, Process Biochemistry. (2023) 132: 248–254.

[0079] SD-URA - Preparation method of the plate: 1.6 g of SD-URA was dissolved in 60 mL of water and sterilized by autoclave to obtain solution A; 4 g of agar powder was dissolved in 120 mL of water and sterilized by autoclave to obtain solution B; 20 g / 100 mL glucose aqueous solution was prepared with glucose and water, and then sterilized by filtration with a 0.22 μm pore size filter membrane to obtain 20 mL of solution C; 60 mL of solution A, 120 mL of solution B and 20 mL of solution C were mixed and poured onto the plate. SD-URA: FUNGENOME, product catalog number YGM003A-3.

[0080] The method for detecting the ability of the test bacteria to produce carotenoids is as follows:

[0081] A single colony of the test bacteria was inoculated into a test tube containing 4 ml of YPD medium and cultured at 30°C and 250 rpm for 24 hours to obtain a seed solution. Then, 300 μl of the seed solution was inoculated into a test tube containing 15 ml of In a triangular flask (100 ml specification) of YPD medium, shake culture was carried out at 30°C and 250 rpm (the culture time in Example 3 was 96 h, and the culture time in Example 4 was 120 h); then, 200 μL of the bacterial solution was sampled, centrifuged at 13000 rpm for 3 min, the supernatant was discarded, the bacteria were washed with sterile water, and then 1 ml of acetone was added to resuspend the bacteria, glass beads with a diameter of 0.5 mm were added, and the culture was ground using a fully automatic sample rapid grinder (70 Hz oscillation for 60 s, interruption for 10 s, a total of 10 cycles), and then centrifuged at 13000 rpm for 10 min, and the supernatant was collected; then, the supernatant was taken, filtered with a 0.22 μm pore size filter membrane, and the filtrate was collected; then, the filtrate was taken and the content of carotenoids was analyzed by high performance liquid chromatography (HPLC).

[0082] The HPLC parameters are as follows:

[0083] Chromatographic column: Agilent C18 column (250 mm × 4.6 mm, 5 μm) (Cat. No.: 880975-902);

[0084] Column temperature: 30°C;

[0085] Detector: VWD detector; Detection wavelength: 476nm;

[0086] Injection volume: 20 μL;

[0087] Mobile phase: a mixture of 21 parts by volume of acetonitrile, 21 parts by volume of methanol, and 8 parts by volume of dichloromethane;

[0088] Mobile phase flow rate: 1 mL / min;

[0089] Detection time: 30 minutes;

[0090] The peak times of various carotenoids (the peak times are determined by HPLC with standard products according to the same HPLC parameters): Canthaxanthin: 5.44min; Echinenone: 10.117min; Lycopene: 13.88min; γ-carotene: 17.76min; β-carotene: 22.78min. Canthaxanthin standards with different contents are subjected to HPLC with the same HPLC parameters, and a standard curve equation is prepared. The canthaxanthin content in the filtrate is determined according to the standard curve equation. β-carotene standards with different contents are subjected to HPLC with the same HPLC parameters, and a standard curve equation is prepared. The β-carotene content in the filtrate is determined according to the standard curve equation.

[0091] Example 1: Construction of recombinant plasmid

[0092] 1. Construction of cloning series plasmids

[0093] The cloning series plasmids are: pUC57-GGPPxd plasmid, pUC57-CarB plasmid, pUC57-CarRP plasmid and pUC57-HPcrtW plasmid.

[0094] The DNA molecule shown in SEQ ID NO: 1 is obtained by codon optimization of the GGPPS gene, and is named the GGPPxd gene. The DNA molecule shown in SEQ ID NO: 2 is the CarB gene. The DNA molecule shown in SEQ ID NO: 3 is the CarRP gene. The DNA molecule shown in SEQ ID NO: 4 is the crtW gene.

[0095] Insert the DNA molecule shown in SEQ ID NO: 1 into the pUC57 plasmid to obtain the pUC57-GGPPxd plasmid. Insert the DNA molecule shown in SEQ ID NO: 2 into the pUC57 plasmid to obtain the pUC57-CarB plasmid. Insert the DNA molecule shown in SEQ ID NO: 3 into the pUC57 plasmid to obtain the pUC57-CarRP plasmid. Insert the DNA molecule shown in SEQ ID NO: 4 into the pUC57 plasmid to obtain the pUC57-HPcrtW plasmid. When constructing the above four plasmids, the insertion sites of the DNA molecules are all between "cctcgcgaatgcatctagat" and "atcggatcccgggcccgtcg" in the pUC57 plasmid.

[0096] 2. Construction of gRNA series plasmids

[0097] The gRNA series plasmids are: pintE3-N20 plasmid, pintE1-N20 plasmid, pintC2-N20 plasmid, pintF2-N20 plasmid, pintF1-N20 plasmid and pintC3-N20 plasmid.

[0098] Construction method of pintE3-N20 plasmid: Using pURA-YL-IntC2 plasmid as template, PCR amplification was performed using a primer pair consisting of gRNA-F (universal primer) and IntE3-N20-R to obtain a circular plasmid, namely the recombinant plasmid pintE3-N20.

[0099] Compared with the construction method of the pintE3-N20 plasmid, the construction method of the pintE1-N20 plasmid differs only in that IntE3-N20-R is replaced by IntE1-N20-R. Compared with the construction method of the pintE3-N20 plasmid, the construction method of the pintC2-N20 plasmid differs only in that IntE3-N20-R is replaced by IntC2-N20-R. Compared with the construction method of the pintE3-N20 plasmid, the construction method of the pintF2-N20 plasmid differs only in that IntE3-N20-R is replaced by IntF2-N20-R. Compared with the construction method of the pintE3-N20 plasmid, the construction method of the pintF1-N20 plasmid differs only in that IntE3-N20-R is replaced by intF1-N20-R. Compared with the construction method of the pintE3-N20 plasmid, the construction method of the pintC3-N20 plasmid differs only in that IntE3-N20-R is replaced by IntC3-N20-R.

[0100] The primer sequences are shown in Table 1. The underlined sequence in the primer is the reverse complementary sequence of the guide RNA.

[0101] Table 1

[0102]

[0103] 3. Construction of donor DNA plasmid series

[0104] The plasmid names of the donor DNA series plasmids, the element composition of the donor DNA molecules in each plasmid, and the target integration sites of the donor DNA molecules in the genomic DNA are shown in Table 2.

[0105] Table 2 Information on integrated genes and integration sites

[0106]

[0107]

[0108] Note: P represents promoter, the subscript of P represents promoter name, T represents terminator, the subscript of T represents terminator name, L-arm represents upstream homology arm, and R-arm represents downstream homology arm.

[0109] Using pUC57-Kan plasmid as template, PCR amplification was performed using a primer pair consisting of PUC57-CPEC-F and PUC57-CPEC-R, and the PCR amplification product was recovered, which was the linear plasmid backbone (named PUC57-CPEC).

[0110] The construction method of pintE3-ERG12-ERG20 plasmid is as follows: L-arm (the upstream homology arm obtained by PCR amplification using the template, the template and the primers used for PCR amplification are shown in Table 3), P TEFin (P obtained by PCR amplification using template TEFin Promoter, template and primers used for PCR amplification are shown in Table 3), ERG20 (ERG20 gene was obtained by PCR amplification using the template, template and primers used for PCR amplification are shown in Table 3), T cyc1 (T obtained by PCR amplification using template cyc1 The terminator, template and primers used for PCR amplification are shown in Table 3), P lip2 (P obtained by PCR amplification using template lip2 Promoter, template and primers used for PCR amplification are shown in Table 3), ERG12 (ERG12 gene obtained by PCR amplification using the template, template and primers used for PCR amplification are shown in Table 3), T HMG1 (T obtained by PCR amplification using template HMG1terminator, template and primers used for PCR amplification are shown in Table 3), R-arm (downstream homology arm obtained by PCR amplification using the template, template and primers used for PCR amplification are shown in Table 3) and PUC57-CPEC were sequentially connected by seamless cloning to obtain the pintE3-ERG12-ERG20 plasmid. In the pintE3-ERG12-ERG20 plasmid, the donor DNA molecule with the ERG20 gene expression cassette and the ERG12 gene expression cassette is between the two SwaI restriction sites.

[0111] The construction method of pintF1-HMG1-GGS plasmid is as follows: L-arm (the upstream homology arm obtained by PCR amplification using the template, the template and primers used for PCR amplification are shown in Table 3), P EXP (Use the template to obtain P by PCR EXP Promoter, template and primers used for PCR amplification are shown in Table 3), HMG1-T HMG1 (The HMG1 gene and T HMG1 The DNA molecules of the terminator, the templates and the primers used for PCR amplification are shown in Table 3), P GPD (P obtained by PCR amplification using template GPD Promoter, template and primers used for PCR amplification are shown in Table 3), GGS-T GGS (The GGS gene and T GGS The DNA molecule of the terminator, the template and the primers used for PCR amplification are shown in Table 3), R-arm (the downstream homology arm obtained by PCR amplification using the template, the template and the primers used for PCR amplification are shown in Table 3) and PUC57-CPEC were sequentially connected by seamless cloning to obtain the pintF1-HMG1-GGS plasmid. In the pintF1-HMG1-GGS plasmid, the donor DNA molecule with the HMG1 gene expression cassette and the GGS gene expression cassette is between the two SwaI restriction sites.

[0112] Using pUC57-Kan plasmid as template, PCR amplification was performed using a primer pair consisting of PUC57-bsaI-GCTC-F and PUC57-bsaI-CTGG-R, and the PCR amplification product was recovered, which was the linear plasmid backbone (named PUC57-GG).

[0113] Construction method of pintE1-GGPPxd-IDI plasmid: L-arm (upstream homology arm obtained by PCR amplification using template, template and primers used for PCR amplification are shown in Table 3), P TEFin (P obtained by PCR amplification using template TEFinPromoter, template and primers used for PCR amplification are shown in Table 3), GGPPxd (GGPPxd gene obtained by PCR amplification using template, template and primers used for PCR amplification are shown in Table 3), T HMG1 (T obtained by PCR amplification using template HMG1 The terminator, template and primers used for PCR amplification are shown in Table 3), P EXP (P obtained by PCR amplification using template EXP Promoter, template and primers used for PCR amplification are shown in Table 3), IDI-T IDI (The IDI gene and T IDI The DNA molecule of the terminator, the template and the primers used for PCR amplification are shown in Table 3), R-arm (the downstream homology arm obtained by PCR amplification using the template, the template and the primers used for PCR amplification are shown in Table 3) and PUC57-GG were sequentially connected by Golden Gate cloning technology to obtain the pintE1-GGPPxd-IDI plasmid. In the pintE1-GGPPxd-IDI plasmid, the donor DNA molecule with the GGPPxd gene expression cassette and the IDI gene expression cassette is between the two SwaI restriction sites.

[0114] Construction method of pintC2-CarB-HPcrtW plasmid: L-arm (upstream homology arm obtained by PCR amplification using template, template and primers used for PCR amplification are shown in Table 3), P EXP (P obtained by PCR amplification using template EXP Promoter, template and primers used for PCR amplification are shown in Table 3), CarB (CarB gene obtained by PCR amplification using template, template and primers used for PCR amplification are shown in Table 3), T HMG1 (T obtained by PCR amplification using template HMG1 The terminator, template and primers used for PCR amplification are shown in Table 3), P TEFin (P obtained by PCR amplification using template TEFin Promoter, template and primers used for PCR amplification are shown in Table 3), HPcrtW (HPcrtW gene obtained by PCR amplification using the template, template and primers used for PCR amplification are shown in Table 3), T cyc1 (T obtained by PCR amplification using template cyc1terminator, template and primers used for PCR amplification are shown in Table 3), R-arm (downstream homology arm obtained by PCR amplification using the template, template and primers used for PCR amplification are shown in Table 3) and PUC57-GG were sequentially connected by Golden Gate cloning technology to obtain pintC2-CarB-HPcrtW plasmid. In the pintC2-CarB-HPcrtW plasmid, the donor DNA molecule with CarB gene expression cassette and HPcrtW gene expression cassette is between the two SwaI restriction sites.

[0115] The construction method of pintF2-CarB-HPcrtW plasmid is basically the same as the construction method of pintC2-CarB-HPcrtW plasmid, and the only difference is L-arm and R-arm; L-arm (upstream homology arm obtained by PCR amplification using template, template and primers used for PCR amplification are shown in Table 3), R-arm (downstream homology arm obtained by PCR amplification using template, template and primers used for PCR amplification are shown in Table 3); pintF2-CarB-HPcrtW plasmid is obtained. In the pintF2-CarB-HPcrtW plasmid, between the two SwaI restriction sites is a donor DNA molecule with CarB gene expression cassette and HPcrtW gene expression cassette.

[0116] Construction method of pintC3-CarRP plasmid: L-arm (upstream homology arm obtained by PCR amplification using template, template and primers used for PCR amplification are shown in Table 3), P TEFin (P obtained by PCR amplification using template TEFin Promoter, template and primers used for PCR amplification are shown in Table 3), CarRP (CarRP gene obtained by PCR amplification using template, template and primers used for PCR amplification are shown in Table 3), T HMG1 (T obtained by PCR amplification using template HMG1 terminator, template and primers used for PCR amplification are shown in Table 3), R-arm (downstream homology arm obtained by PCR amplification using the template, template and primers used for PCR amplification are shown in Table 3) and PUC57-GG were sequentially connected by Golden Gate cloning technology to obtain pintC3-CarRP plasmid. In the pintC3-CarRP plasmid, the donor DNA molecule with the CarRP gene expression cassette is between the two SwaI restriction sites.

[0117] Table 3

[0118]

[0119]

[0120]

[0121]

[0122] In Table 3, "Polg total DNA" refers to the total DNA of Yarrowia lipolytica Polg.

[0123] Example 2: Construction of chassis strain WM001

[0124] The construction flow chart of chassis strain WM001 is shown in Figure 1 .

[0125] 1. Construction of recombinant bacteria YL002

[0126] Using Yarrowia lipolytica Po1g as the starting strain, the KU70 gene in its genomic DNA was replaced with a DNA molecule having a Cas9 gene expression cassette and a hygromycin resistance gene expression cassette to obtain the recombinant strain YL001. Using the recombinant strain YL001 as the starting strain, the URA3 gene was knocked out to obtain the recombinant strain YL002. The recombinant strain YL002 (Strain YL002) is recorded in the following literature: Meng Zhang, Qing Yan Li, Feiyu Fan, Fuping Lu and Xue Li Zhang, Combinatorial metabolic engineering and tolerance evolution of Yarrowia lipolytica for improved γ-decalactone synthesis, Process Biochemistry. (2023) 132: 248–254.

[0127] 2. Construction of recombinant strain YL045

[0128] Take the pintE3-ERG12-ERG20 plasmid, cut it with restriction endonuclease SwaI, and co-transform the digestion product and pintE3-N20 plasmid into the competent cells of the recombinant bacteria YL002. After incubation for 1 hour, coat the cells with SD-URA - The plate was cultured at 30°C for 2 days, and the grown colonies were picked and identified by PCR to obtain the recombinant bacteria with the ERG20 gene expression cassette and the ERG12 gene expression cassette integrated into the intE3 site of the genomic DNA, which was named the recombinant bacteria YL045.

[0129] 3. Construction of recombinant strain YL046

[0130] Take the pintE1-GGPPxd-IDI plasmid, cut it with restriction endonuclease SwaI, and co-transform the digestion product and pintE1-N20 plasmid into the competent cells of the recombinant bacteria YL045. After incubation for 1 hour, coat the cells with SD-URA - The plate was cultured at 30°C for 2 days, and the grown colonies were picked and identified by PCR to obtain the recombinant bacteria with the GGPPxd gene expression cassette and the IDI gene expression cassette integrated into the intE1 site of the genomic DNA, which was named the recombinant bacteria YL046.

[0131] 4. Construction of recombinant bacteria YL050

[0132] Take the pintF1-HMG1-GGS plasmid, cut it with restriction endonuclease SwaI, and co-transform the digestion product and pintF1-N20 plasmid into the competent cells of the recombinant bacteria YL046. After incubation for 1 hour, coat the cells with SD-URA - The plate was cultured at 30°C for 2 days, and the grown colonies were picked and identified by PCR to obtain the recombinant bacteria with the HMG1 gene expression cassette and the GGS gene expression cassette integrated into the intF1 site of the genomic DNA, which was named the recombinant bacteria YL050.

[0133] 5. Construction of recombinant strain YL051

[0134] Take the pintC2-CarB-HPcrtW plasmid, cut it with restriction endonuclease SwaI, and co-transform the digestion product and pintC2-N20 plasmid into competent cells of recombinant bacteria YL050. After incubation for 1 hour, coat the cells with SD-URA - The plate was cultured at 30°C for 2 days, and the grown colonies were picked and identified by PCR to obtain the recombinant bacteria with the CarB gene expression cassette and the HPcrtW gene expression cassette integrated into the intC2 site of the genomic DNA, which was named the recombinant bacteria YL051.

[0135] VI. Construction of recombinant strain WM001

[0136] Take the pintF2-CarB-HPcrtW plasmid, cut it with restriction endonuclease SwaI, and co-transform the digestion product and pintF2-N20 plasmid into competent cells of recombinant bacteria YL051. After incubation for 1 hour, coat the cells with SD-URA - The plate was cultured at 30°C for 2 days, and the grown colonies were picked and identified by PCR to obtain the recombinant bacteria with the CarB gene expression cassette and the HPcrtW gene expression cassette integrated into the intF2 site of the genomic DNA, which was named the recombinant bacteria WM001.

[0137] The characteristics of the starting bacteria and each recombinant bacteria are described in Table 4.

[0138] Table 4

[0139] Name of the starting bacteria or recombinant bacteria Feature description Po1g MATa,leu2-270,ura3-302::URA3,xpr2-332,axp-2 YL001 Po1g-Δku70::Cas9-HY YL002 Po1g-Δku70::Cas9-HY,Δura3 YL045 YL002-intE3::ERG12-ERG20 YL046 YL045-intE1::GGPPxd-IDI YL050 YL046-intF1::HMG1-GGS YL051 YL050-intC2::CarB-crtW WM001 YL051-intF2::CarB-crtW

[0140] Example 3: Screening of mutant proteins

[0141] 1. Construction of reference strains

[0142] Take the pintC3-CarRP plasmid, cut it with restriction endonuclease SwaI, and co-transform the digestion product and pintC3-N20 plasmid into the competent cells of the recombinant bacteria WM001. After incubation for 1 hour, coat the cells with SD-URA - The plate was incubated at 30°C for 2 days, and the grown colonies were picked and identified by PCR to obtain a recombinant bacterium with the wild-type CarRP gene expression cassette integrated into the intC3 site of the genomic DNA, which was named the recombinant bacterium WM001-1. The wild-type CarRP gene is the CarRP gene shown in SEQ ID NO: 3, encoding the wild-type CarRP protein shown in SEQ ID NO: 5.

[0143] In the wild-type CarRP protein, amino acid residues 1-239 constitute CarRP-R (having lycopene cyclase activity), and amino acids 246-614 constitute CarRP-P (having phytoene synthase activity).

[0144] 2. Screening of mutant proteins

[0145] 1. Using the pintC3-CarRP plasmid as a template, a saturation mutation was performed on the codon encoding the 98th amino acid residue of CarRP to obtain a library composed of mutant plasmids (single-point saturation mutation, including at least 20 amino acid types, 3-fold coverage, so at least 60 single colonies are required for a full coverage mutation library. Therefore, in order to ensure full coverage of mutation types, the mutation library includes at least 200 single colonies).

[0146] 2. Take the library prepared in step 1, digest it with restriction endonuclease SwaI, and co-transform the digestion product and pintC3-N20 plasmid into the competent cells of the recombinant bacteria WM001. After incubation for 1 hour, coat the cells with SD-URA - Plates were incubated at 30°C for 2 days.

[0147] 3. After completing step 2, pick 100 red colonies (named clones 98-1 to 98-100) and streak them into a new SD-URA plate. - Plates were incubated at 30°C for 2 days.

[0148] 4. After completing step 3, select 30 strains with deep red color as test bacteria.

[0149] 5. Detect the ability of the test bacteria to produce carotenoids (use the recombinant bacteria WM001-1 as a reference strain of the test bacteria to detect its ability to produce carotenoids).

[0150] The HPLC chromatogram of the recombinant strain WM001-1 is shown in Figure 2 A. The HPLC chromatogram of the exemplary test bacteria (clone 98-97) is shown in Figure 2 B.

[0151] The canthaxanthin content and β-carotene content in the filtrate are shown in Figure 3 , the unit is mg / L.

[0152] The clones with high yield were selected, and the genomic DNA of each clone strain was extracted for sequencing. Based on the sequencing results, the mutant protein of CarRP was discovered.

[0153] Example 4: Directed preparation of recombinant bacteria and verification of production performance of recombinant bacteria

[0154] 1. Directed preparation of 5 recombinant bacteria

[0155] Preparation of pintC3-CarRPtb 98-78 Compared with pintC3-CarRP plasmid, pintC3-CarRPtb 98-78 The only difference between the plasmids is that the codon encoding the 98th amino acid residue of CarRP has been replaced from the codon encoding arginine (AGA) to the codon encoding histidine (CAT). 98-78 The plasmid was digested with restriction endonuclease SwaI, and the digestion product and pintC3-N20 plasmid were co-transfected into competent cells of the recombinant bacterium WM001. After incubation for 1 hour, SD-URA was applied - The plate was incubated at 30°C for 2 days, and the grown colonies were picked and identified by PCR to obtain the recombinant bacteria with the mutant CarRP gene expression cassette integrated into the intC3 site of the genomic DNA, which was named recombinant bacteria 98-78.

[0156] Preparation of pintC3-CarRPtb 98-97 Compared with pintC3-CarRP plasmid, pintC3-CarRPtb 98-97 The only difference between the plasmids is that the codon encoding the 98th amino acid residue of CarRP has been replaced from the codon encoding arginine (AGA) to the codon encoding alanine (GCG). 98-97The plasmid was digested with restriction endonuclease SwaI, and the digestion product and pintC3-N20 plasmid were co-transfected into competent cells of the recombinant bacterium WM001. After incubation for 1 hour, SD-URA was applied - The plate was incubated at 30°C for 2 days, and the grown colonies were picked and identified by PCR to obtain the recombinant bacteria with the mutant CarRP gene expression cassette integrated into the intC3 site of the genomic DNA, which was named recombinant bacteria 98-97.

[0157] Preparation of pintC3-CarRPtb 98-72 Compared with pintC3-CarRP plasmid, pintC3-CarRPtb 98-72 The only difference between the plasmids is that the codon encoding the 98th amino acid residue of CarRP has been replaced from the codon encoding arginine (AGA) to the codon encoding serine (TCT). 98-72 The plasmid was digested with restriction endonuclease SwaI, and the digestion product and pintC3-N20 plasmid were co-transfected into competent cells of the recombinant bacterium WM001. After incubation for 1 hour, SD-URA was applied - The plate was incubated at 30°C for 2 days, and the grown colonies were picked and identified by PCR to obtain the recombinant bacteria with the mutant CarRP gene expression cassette integrated into the intC3 site of the genomic DNA, which was named recombinant bacteria 98-72.

[0158] Preparation of pintC3-CarRPtb 98-59 Compared with pintC3-CarRP plasmid, pintC3-CarRPtb 98-59 The only difference between the plasmids is that the codon encoding the 98th amino acid residue of CarRP has been replaced from the codon encoding arginine (AGA) to the codon encoding threonine (ACT). 98-59 The plasmid was digested with restriction endonuclease SwaI, and the digestion product and pintC3-N20 plasmid were co-transfected into competent cells of the recombinant bacterium WM001. After incubation for 1 hour, SD-URA was applied - The plate was incubated at 30°C for 2 days, and the grown colonies were picked and identified by PCR to obtain the recombinant bacteria with the mutant CarRP gene expression cassette integrated into the intC3 site of the genomic DNA, which was named recombinant bacteria 98-59.

[0159] Preparation of pintC3-CarRPtb 98-75 Compared with pintC3-CarRP plasmid, pintC3-CarRPtb 98-75The only difference between the plasmids is that the codon encoding the 98th amino acid residue of CarRP has been replaced from the codon encoding arginine (AGA) to the codon encoding tyrosine (TAT). 98-75 The plasmid was digested with restriction endonuclease SwaI, and the digestion product and pintC3-N20 plasmid were co-transfected into competent cells of the recombinant bacterium WM001. After incubation for 1 hour, SD-URA was applied - The plate was incubated at 30°C for 2 days, and the grown colonies were picked and identified by PCR to obtain the recombinant bacteria with the mutant CarRP gene expression cassette integrated into the intC3 site of the genomic DNA, which was named recombinant bacteria 98-75.

[0160] 2. Verify the production performance of recombinant bacteria

[0161] The five recombinant bacteria prepared in step 1 were used as test bacteria (the recombinant bacteria WM001-1 constructed in Example 3 was used as a reference strain of the test bacteria) to detect the ability to produce carotenoids.

[0162] The canthaxanthin content and β-carotene content in the filtrate are shown in Table 5, and the unit is mg / L.

[0163] Table 5

[0164]

[0165] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A mutant protein, obtained by mutating the amino acid at the target site in the pre-mutation protein to other amino acids; the pre-mutation protein has the segment shown in positions 1 to 239 of SEQ ID NO: 5; the target site is located at position 98 of SEQ ID NO:

5.

2. A mutant protein, obtained by mutating the amino acid at the target site in the pre-mutation protein to other amino acids; the pre-mutation protein has the segment shown in SEQ ID NO: 5; the target site is located at position 98 of SEQ ID NO:

5.

3. The mutant protein according to claim 1 or 2, characterized in that: The other amino acids are alanine, histidine, tyrosine, serine or threonine.

4. A gene encoding the mutant protein according to any one of claims 1 to 3.

5. An expression cassette, DNA molecule, recombinant vector or recombinant microorganism having the gene according to claim 4.

6. Application of biomaterials in product preparation; The biological material is the mutant protein according to claim 1, 2 or 3, the gene according to claim 4, the expression cassette according to claim 5, the DNA molecule according to claim 5, the recombinant vector according to claim 5 or the recombinant microorganism according to claim 5; The functions of the product are as follows (b1) and / or (b2) and / or (b3): (b1) as lycopene cyclase; (b2) as a bifunctional lycopene cyclase / phytoene synthase; (b3) Preparation of carotenoids.

7. Use of the mutant protein according to claim 1 or 3 as lycopene cyclase.

8. Use of the mutant protein according to claim 2 or 3 as a bifunctional lycopene cyclase / phytoene synthase.

9. Application of biomaterials in the preparation of carotenoids; The biological material is the mutant protein according to claim 1, 2 or 3, the gene according to claim 4, the expression cassette according to claim 5, the DNA molecule according to claim 5, the recombinant vector according to claim 5 or the recombinant microorganism according to claim 5.

10. The use according to claim 6 or 9, characterized in that: The carotenoid is β-carotene or a downstream product of β-carotene.

Images