Application of GMPS gene in regulation and control of plant growth and development and geminivirus resistance and transgenic plant cultivation method

Abstract

The invention discloses application of a GMPS gene in regulation and control of plant growth and development and resistance to geminivirus and a transgenic plant cultivation method, the GMPS gene sequence is shown as SEQ ID NO: 1, and the geminivirus is TYLCV, TYLCCNV and TbCSV. An RNAi gene expression interference vector carrying a target gene segment is introduced into a target plant through an agrobacterium transformation method, a GMPS gene knocked-down plant is obtained, the growth and development of the gene knocked-down progeny plant are superior to those of a wild type material, infection of TYLCV, TYLCCNV and TbCSV can be remarkably relieved, and the GMPS gene knocked-down progeny plant can be used for preparing a GMPS gene knocked-down progeny plant. The compound has the effects of promoting plant growth and resisting geminivirus in a broad spectrum.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular to the application of plant GMPS gene in regulating plant growth and development and resisting geminiviruses, and a method for cultivating transgenic plants. Background Art

[0002] Geminiviruses are a type of single-stranded circular DNA virus in the form of doublet particles. With the development of global economic trade and the large-scale migration of virus-transmitting insects, Geminiviruses have occurred on a large scale in crops around the world, causing devastating impacts on agricultural products and the agricultural economy in many countries and regions. The main reasons for the serious damage caused by Geminiviruses are as follows. (1) Wide geographical distribution: Geminiviruses are currently widely distributed in more than 50 countries and regions around the world; (2) Many crops are harmed: Geminiviruses occur in more than 40 common crops such as tomatoes, cotton, cassava, beans, wheat, and tobacco; (3) Heavy economic losses: Geminiviruses often cause devastating damage. The global economic losses caused by cotton leaf curl alone are as high as US$5 billion. (4) Few disease-resistant varieties: There are currently few disease-resistant varieties used in agricultural production, and the phenomenon of viruses breaking through resistance is gradually emerging.

[0003] Currently, field prevention and control of Geminiviruses faces many problems, including: (1) Field resistance measures for Geminiviruses are mostly prevention-oriented, combined with prevention and control, which consumes a lot of manpower and material resources; (2) Chemical pesticides are effective against Geminiviruses, and the abuse of pesticides will harm non-target organisms and cause problems such as pesticide residues; (3) Susceptibility factors knocked out by gene editing technology are mostly necessary for host growth and development, which can easily affect the normal agronomic traits of mutant crops and increase new risks of yield reduction; (4) Other breeding research has a long breeding cycle for virus-resistant varieties, few available measures, and is difficult to carry out.

[0004] TYLCCNV, Tomato Yellow Leaf Curl Virus (TYLCV), and Tobacco Stem Curl Virus (TbCSV) all belong to the genus Bean Golden Mosaic Virus of the family Geminiviridae. They are the most serious geminiviruses that harm tomato and tobacco crops in my country and the world. Field tobacco infected with TYLCCNV and TYLCV will cause the leaves to shrink, turn yellow, curl downward, and bend at the neck. Infection with TbCSV will also cause leaf shrinkage, curl downward, and bend at the stem, which are serious hazards to tobacco growth and cause serious economic losses. Although the harm caused by TYLCCNV, TYLCV, and TbCSV is very serious, the current agricultural production still focuses on prevention, and the prevention and control methods of reducing diseased plants in the field and using chemical pesticides as a supplement are very limited in effect.

[0005] RNA interference (RNAi) technology is a phenomenon in which double-stranded RNA (dsRNA) induces efficient and specific degradation of homologous mRNA. Except for prokaryotes, RNAi can occur in all eukaryotic cells. RNAi technology can be used to specifically silence the expression of related genes, and resistance can be achieved by downregulating the expression of susceptible genes. RNAi technology has the following advantages: (1) Highly efficient silencing effect: RNAi technology uses double-stranded RNA to mediate gene silencing with very high efficiency; (2) Simple operation process: Gene silencing can be achieved by inserting a 300bp fragment of the target gene into the relevant vector in the forward and reverse directions; (3) Good transmission effect: Double-stranded RNA can be transmitted to the entire plant material, facilitating the study of the function of the target gene; (4) RNAi technology gene expression vectors can be used to obtain transgenic materials through Agrobacterium-mediated leaf disc transformation. Summary of the invention

[0006] The first objective of the present invention is to provide an application of a plant GMPS gene in regulating plant growth and development and resisting geminiviruses.

[0007] The second object of the present invention is to provide a method for cultivating GMPS gene silenced plants.

[0008] The present invention is based on RNAi-mediated gene silencing tools. Through preliminary screening work, a broad-spectrum susceptibility factor GMPS of geminivirus in a plant was identified. The RNAi technology was further used to obtain a broad-spectrum and highly effective anti-geminivirus material through transgenic technology. The creation and use of the disease-resistant material will play an important role in the green prevention and control of plant geminivirus diseases.

[0009] The present invention introduces a vector carrying RNAi to interfere with GMPS expression into a target plant through Agrobacterium transformation to obtain a GMPS gene expression silenced plant. The transgenic silenced plant has significantly better growth and development than a wild-type plant, and can significantly reduce the infection of TYLCCNV, tomato yellow leaf curl virus (TYLCV) and tobacco stem curl virus (TbCSV), effectively controlling their damage.

[0010] Specifically, the technical solution adopted by the present invention is as follows:

[0011] Application of plant GMPS gene in regulating plant growth and development and resisting geminiviruses: promoting plant growth and resisting infection by plant geminiviruses by silencing the expression of GMPS gene in plants; wherein the viruses are Chinese tomato yellow leaf curl virus (TYLCCNV), tomato yellow leaf curl virus (TYLCV) and tobacco stem curl virus (TbCSV), and the transcript sequence of the GMPS gene is shown in SEQ ID NO:1.

[0012] Specifically, by constructing a plant GMPS gene RNAi silencing vector, that is, constructing an RNAi-GMPS vector targeting the 300bp specific coding region sequence of the GMPS gene; using sterile cultured leaves to prepare callus tissue, genetic transformation was carried out through Agrobacterium-mediated T-DNA insertion, and the RNAi-GMPS vector was introduced into the target plant. The obtained GMPS gene-silenced plants can significantly reduce the infection of the geminiviruses TYLCCNV, TYLCV and TbCSV.

[0013] A method for cultivating GMPS transgenic silenced plants resistant to TYLCCNV, TYLCV and TbCSV: a gene silencing vector carrying a GMPS gene-specific coding region sequence is introduced into a target plant by Agrobacterium transformation to obtain a GMPS gene-silenced plant.

[0014] The specific steps include:

[0015] (1) A 300 bp fragment of GMPS that can specifically silence the plant endogenous gene GMPS was selected, as shown in SEQ ID NO: 2; primers were designed for PCR amplification, and the forward GMPS-1 fragment was cloned respectively, the primers were GMPS-F1 and GMPS-R1, and the sequences were shown in SEQ ID NO: 3-4 respectively:

[0016] GMPS-F1: AAGACCCGGGATCAATGGCACCTCTTCGTT

[0017] GMPS-R1:TTACCCCGGGACCACCTGTTTATCACCAAT

[0018] The reverse GMPS-2 fragment was cloned using primers GMPS-F2 and GMPS-R2, and the sequences are shown in SEQ ID NOs: 5-6, respectively:

[0019] GMPS-F2:ACAGACGGTACCACCTGTTTATCACCAAT

[0020] GMPS-R2:ACCCGTCGACATCAATGGCACCTCTTCGTT

[0021] (2) linearizing the RNAi empty vector with restriction endonuclease XmalI, and digesting the GMPS-1 fragment, and purifying and recovering them respectively;

[0022] (3) Using T4 ligase to connect, transform DH5α Escherichia coli, screen and identify single colonies of positive clones, sequence the plasmids of positive clones, and obtain RNAi vector RNAi-GMPS-1 with the GMPS-1 fragment correctly inserted;

[0023] (4) Linearizing the RNAi-GMPS-1 vector from the previous step with restriction endonucleases MluI and SalI, and digesting the GMPS-2 fragment, and purifying and recovering them respectively;

[0024] (5) Using T4 ligase to connect, transform DH5α Escherichia coli, screen and identify single colonies of positive clones, and sequence the plasmids of positive clones to obtain RNAi vector RNAi-GMPS with GMPS-1 and GMPS-2 fragments correctly inserted respectively;

[0025] (6) 1 μL of the recombinant plasmid and 50 μL of Agrobacterium competent cells were transformed by chemical transformation. After incubation and recovery, they were evenly spread on the corresponding resistance culture medium to screen and identify the Agrobacterium positive clones that had been transformed with the recombinant plasmid;

[0026] (7) Infecting the pre-cultured sterile plant leaves with Agrobacterium carrying the recombinant plasmid by the leaf disc method, obtaining callus tissue by differentiation culture on a resistance medium, obtaining seedlings by rooting culture, and transferring them to soil for seedling hardening culture;

[0027] (8) After the seedlings have grown stably, leaf samples are taken and total DNA is extracted using the CTAB method. PCR amplification is performed using primer pairs 249OX13 and 250OX14 and the total DNA of the transgenic material as a template to screen positive plants. The sequences of primers 249OX13 and 250OX14 are shown in SEQ ID NOs: 7-8, respectively:

[0028] 249OX13:TCTTCTTCGTCTTACACATC;

[0029] 250OX14:AAGACCGGCAACAGGATTC.

[0030] (9) On the positive transgenic material, the silencing efficiency of the transgenic plant material was detected using the primer pair of qPCR-GMPS-F3 and qPCR-GMPS-R3, and the transgenic material with higher silencing efficiency was screened for seed preservation; the sequences of qPCR-GMPS-F3 and qPCR-GMPS-R3 are shown in SEQ ID NOs: 9-10, respectively:

[0031] qPCR-GMPS-F3: ACACTTCCTGTTTGATGTATG;

[0032] qPCR-GMPS-R3:ATAGCCTTGGTACCAATTTA.

[0033] Compared with the prior art, the outstanding effects of the present invention are:

[0034] The present invention has discovered a new geminivirus sensitive gene GMPS in plants through preliminary research, and introduced an RNAi-GMPS silencing vector into the target plant through the Agrobacterium transformation method, and silenced the GMPS gene expression in the plant through transgenic technology. The obtained GMPS gene silenced plants promote seed germination and root and leaf development, and can significantly reduce diseases caused by geminiviruses TYLCV, TYLCCNV and TbCSV.

[0035] The application of the GMPS gene in regulating plant growth and development and resisting geminiviruses and the method for cultivating transgenic plants according to the present invention will be further described below in conjunction with the accompanying drawings and specific examples. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Schematic diagram of the construction of GMPS gene silencing vector.

[0037] Figure 2 The germination (a), root development (b), leaf development (c, d, e) and late growth phenotype (f) of GMPS gene-silenced plants.

[0038] Figure 3 Silencing the GMPS gene improves plant resistance to the geminivirus Tomato yellow leaf curl virus (TYLCV);

[0039] Among them, (a) wild-type and GMPS gene silenced plants #1 and #3 were inoculated with TYLCV, and systemic leaf symptoms were observed on the 10th day; (b) GMPS mRNA expression levels in different plants were detected using qPCR technology; (c) samples from the same diseased part of different plants inoculated with TYLCV were sampled for qRT-PCR detection. (d) Western Blot detection was performed on the same diseased part of different plants inoculated with TYLCV.

[0040] Figure 4 Silencing the GMPS gene improves plant resistance to the twin viruses Tomato yellow leaf curl virus (TYLCCNV) and Tobacco stem curl virus (TbCSV);

[0041] Among them, (a) wild-type and GMPS gene silenced plants #1 and #3 were inoculated with TYLCCNV, and systemic leaf symptoms were observed on the 7th day; (b) samples from the same diseased site of different plants inoculated with TYLCCNV were taken for qRT-PCR detection. (c) Western Blot detection was performed on the same diseased site of different plants inoculated with TYLCCNV; (d) wild-type and GMPS gene silenced plants #1 and #3 were inoculated with TbCSV, and systemic leaf symptoms were observed on the 7th day; (e) samples from the same diseased site of different plants inoculated with TbCSV were taken for qRT-PCR detection. DETAILED DESCRIPTION

[0042] A method for cultivating GMPS transgenic plants resistant to geminiviruses TYLCV, TYLCCNV and TbCSV, wherein a silencing vector carrying RNAi-GMPS is introduced into a target plant through Agrobacterium transformation to obtain a plant with a GMPS gene mutation. The transcript sequence of the GMPS gene is shown in SEQ ID NO:1.

[0043] The specific steps include:

[0044] (1) Design and select a 300 bp fragment of GMPS that can specifically silence the plant endogenous gene GMPS, as shown in SEQ ID NO: 2; design primers for PCR amplification, and clone the forward GMPS-1 fragment respectively. The primers are

[0045] GMPS-F1 and GMPS-R1, the sequences are shown in SEQ ID NO:3-4 respectively:

[0046] GMPS-F1: AAGACCCGGGATCAATGGCACCTCTTCGTT

[0047] GMPS-R1:TTACCCCGGGACCACCTGTTTATCACCAAT

[0048] The reverse GMPS-2 fragment was cloned using primers GMPS-F2 and GMPS-R2, and the sequences are shown in SEQ ID NOs: 5-6, respectively:

[0049] GMPS-F2:ACAGACGGTACCACCTGTTTATCACCAAT;

[0050] GMPS-R2:ACCCGTCGACATCAATGGCACCTCTTCGTT.

[0051] (2) linearizing the RNAi empty vector with restriction endonuclease XmalI, and digesting the GMPS-1 fragment, and purifying and recovering them respectively;

[0052] (3) Using T4 ligase to connect, transform DH5α Escherichia coli, screen and identify single colonies of positive clones, sequence the plasmids of positive clones, and obtain RNAi vector RNAi-GMPS-1 with the GMPS-1 fragment correctly inserted;

[0053] (4) Linearizing the RNAi-GMPS-1 vector from the previous step with restriction endonucleases MluI and SalI, and digesting the GMPS-2 fragment, and purifying and recovering them respectively;

[0054] (5) Use T4 ligase to connect, transform DH5α Escherichia coli, screen and identify single colonies of positive clones, and sequence the plasmids of positive clones. Thus, RNAi vector RNAi-GMPS with GMPS-1 and GMPS-2 fragments correctly inserted is obtained, such as Figure 1 As shown;

[0055] (6) 1 μL of the recombinant plasmid and 50 μL of Agrobacterium competent cells were transformed by chemical transformation. After incubation and recovery, they were evenly spread on the corresponding resistance culture medium to screen and identify the Agrobacterium positive clones that had been transformed with the recombinant plasmid;

[0056] (7) Infecting the pre-cultured sterile plant leaves with Agrobacterium carrying the recombinant plasmid by the leaf disc method, obtaining callus tissue by differentiation culture on a resistance medium, obtaining seedlings by rooting culture, and transferring them to soil for seedling hardening culture;

[0057] (8) After the seedlings have grown stably, leaf samples are taken and total DNA is extracted using the CTAB method. PCR amplification is performed using primer pairs 249OX13 and 250OX14 and the total DNA of the transgenic material as a template to screen positive plants. The sequences of primers 249OX13 and 250OX14 are shown in SEQ ID NOs: 7-8, respectively:

[0058] 249OX13:TCTTCTTCGTTCTACACATC;

[0059] 250OX14:AAGACCGGCAACAGGATTC.

[0060] (9) On the positive transgenic material, the silencing efficiency of the transgenic plant material was detected using the primer pair of qPCR-GMPS-F3 and qPCR-GMPS-R3, and the transgenic material with higher silencing efficiency was screened for seed preservation; the sequences of qPCR-GMPS-F3 and qPCR-GMPS-R3 are shown in SEQ ID NOs: 9-10, respectively:

[0061] qPCR-GMPS-F3: ACACTTCCTGTTTGATGTATG;

[0062] qPCR-GMPS-R3:ATAGCCTTGGTACCAATTTA.

[0063] (10) Among the positive plant materials obtained, two transgenic materials with better silencing efficiency were screened. Figure 3 As shown in b, the silencing efficiency of the first material is about 40%, named: RNAi-GMPS#1; the silencing efficiency of the second material is about 56%, named: RNAi-GMPS#3.

[0064] (11) Obtain transgenic strains by screening, such as Figure 2 As shown in a, the seeds of the above two materials and the wild-type seeds were sterilized at the same time and spread on the corresponding culture medium to observe the seed germination. RNAi-GMPS#1 and RNAi-GMPS#3 germinated before the wild-type seeds; Figure 2 As shown in b, the seeds of the above two materials and the wild-type seeds were sterilized at the same time and laid flat on the same horizontal line and then cultured vertically in the corresponding culture medium to observe the growth of plant roots. Compared with the wild type, the root length of RNAi-GMPS#1 and RNAi-GMPS#3 materials was significantly increased.

[0065] (12) Figure 2 As shown in c, the above two materials and the wild-type material were planted to observe the phenotypes of the different materials during the growth period. Compared with the wild-type, the leaf sizes of RNAi-GMPS#1 and RNAi-GMPS#3 materials increased significantly; Figure 2 d and Figure 2 As shown in Figure e, the leaf fresh weight and leaf size of the above two materials and the wild-type material during the growth period were statistically analyzed to observe the growth of plant leaves. Compared with the wild-type, the leaf fresh weight and leaf size of RNAi-GMPS#1 and RNAi-GMPS#3 materials were significantly increased.

[0066] (13) Figure 2 As shown in FIG. 5 , the phenotypes of the above two materials and the wild-type material in the late growth stage were observed. Compared with the wild-type, the RNAi-GMPS#1 and RNAi-GMPS#3 materials grew better and had taller plants.

[0067] (14) Figure 3 As shown in a, the phenotypes of the above two materials and the wild-type material were observed 10 days after inoculation with TYLCV. Compared with the wild-type, the symptoms of leaf yellowing and shrinkage caused by TYLCV in RNAi-GMPS#1 and RNAi-GMPS#3 were significantly alleviated; Figure 3 c and Figure 3As shown in d, 10 days after the above two materials and the wild-type material were inoculated with TYLCV, samples were taken to extract total DNA and total protein, and the TYLCV virus accumulation was detected by qPCR and Western Blot. Compared with the wild-type, the TYLCV virus accumulation in RNAi-GMPS#1 and RNAi-GMPS#3 materials was significantly decreased.

[0068] (15) Figure 4 As shown in a, the phenotypes of the above two materials and the wild-type material were observed 7 days after inoculation with TYLCCNV. Compared with the wild-type, the symptoms of leaf yellowing and shrinkage caused by TYLCCNV in RNAi-GMPS#1 and RNAi-GMPS#3 materials were significantly alleviated; Figure 4 b and Figure 4 As shown in c, 7 days after the above two materials and the wild-type material were inoculated with TYLCCNV, samples were taken to extract total DNA and total protein, and the TYLCCNV virus accumulation was detected by qPCR and Western Blot. Compared with the wild type, the TYLCCNV virus accumulation in RNAi-GMPS#1 and RNAi-GMPS#3 materials was significantly decreased.

[0069] (16) Figure 4 As shown in d, the phenotypes of the above two materials and the wild-type material were observed 7 days after inoculation with TbCSV. Compared with the wild-type, the symptoms of leaf shrinkage and stem bending caused by TbCSV in RNAi-GMPS#1 and RNAi-GMPS#3 were significantly alleviated; Figure 4 As shown in e, 7 days after the above two materials and the wild-type material were inoculated with TbCSV, samples were taken to extract total DNA, and the TbCSV virus accumulation was detected by qPCR. Compared with the wild-type, the TbCSV virus accumulation in RNAi-GMPS#1 and RNAi-GMPS#3 materials was significantly decreased.

[0070] The embodiments described above are merely descriptions of preferred implementation modes of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of GMPS gene in regulating plant growth and development and resisting Geminivirus, characterized in that: The plant GMPS gene RNA is interfered with to promote plant growth and development and resist infection by various geminiviruses of the plant; wherein the GMPS gene sequence is shown in SEQ ID NO: 1; the geminiviruses are TYLCV, TYLCCNV and TbCSV.

2. The use of the GMPS gene according to claim 1 in regulating plant growth and development and resisting geminiviruses, characterized in that: By utilizing RNA interference technology, the expression of GMPS gene was silenced by cloning the GMPS gene fragment, wherein the GMPS gene fragment is shown in SEQ ID NO:

2.

3. The use of the GMPS gene according to claim 2 in regulating plant growth and development and resisting geminiviruses, characterized in that: The GMPS gene fragments were constructed into RNAi interference transformation vectors in both forward and reverse directions. Sterile plant leaves were used as callus tissues, and genetic transformation was carried out using Agrobacterium-mediated T-DNA. The vectors interfering with the GMPS gene were introduced into the target plants. The obtained GMPS low-expression plants can significantly reduce the infection of various geminiviruses.

4. A method for cultivating GMPS transgenic plants resistant to Geminivirus, characterized in that: The GMPS gene interference vector is introduced into the target plant through the leaf disc method to obtain the GMPS gene low expression plant.

5. The method for cultivating GMPS transgenic plants according to claim 4, characterized in that: The following steps are involved: (1) Leaves of wild-type plants were sampled, total RNA was extracted using the Trizol method, and total RNA was reverse transcribed to obtain cDNA; (2) using the above cDNA as a template to amplify the forward GMPS gene fragment by PCR, and using primers GMPS-F1 and GMPS-R1 to clone the forward GMPS-1 gene fragment with restriction sites; (3) using the cDNA described in the above step as a template to amplify the reverse GMPS gene fragment by PCR, and using primers GMPS-F2 and GMPS-R2 to clone the reverse GMPS-2 gene fragment with restriction sites; (4) The vector and the insert fragment are recovered by enzyme digestion and then ligated using T4 ligase; (5) The RNAi-GMPS vector was transformed into DH5α Escherichia coli, and the primers 249OX13 and 250OX14 were used for PCR amplification to screen and identify positive clones. The plasmids of the positive clones were sequenced to obtain the correct RNAi-GMPS vector; (6) Mix 1 μL of the recombinant plasmid with 50 μL of Agrobacterium competent cells and transform them by chemical transformation. After incubation and recovery, spread them on the corresponding resistance culture medium to screen and obtain single clones of Agrobacterium that have been transformed with the recombinant plasmid; (7) Infecting wild-type plant leaves with Agrobacterium carrying the recombinant plasmid by the leaf disc method, obtaining callus tissue by differentiation culture on a corresponding resistance medium, and then obtaining genetically transformed seedlings by rooting culture on a rooting medium. After hardening, the seedlings are transferred to soil for further culture; (8) After the seedlings have grown stably, leaf samples are taken and total DNA is extracted using the CTAB method; the extracted DNA is used as a template and PCR amplification is performed using primers 249OX13 and 250OX14 to confirm that the exogenous RNAi vector sequence has been transferred into the plant; (9) The positive transgenic materials were further cultured, leaf samples were taken, total RNA was extracted using the TRIZOL method, and reverse transcription was performed. Using cDNA as a template, qPCR detection was performed using primers qPCR-GMPS-F3 and qPCR-GMPS-R3 to determine the GMPS gene silencing efficiency in different transgenic lines, and the silenced lines were selected for observation and seed preservation.

6. The method for cultivating GMPS transgenic plants according to claim 5, characterized in that: The sequences of the primers GMPS-F1 and GMPS-R1 in step (2) are shown in SEQ ID NOs: 3-4, respectively: GMPS-F1: AAGACCCGGGATCAATGGCACCTCTTCGTT; GMPS-R1:TTACCCCGGGACCACCTGTTTATCACCAAT.

7. The method for cultivating GMPS transgenic plants according to claim 6, characterized in that: The sequences of the primers GMPS-F2 and GMPS-R2 in step (3) are shown in SEQ ID NOs: 5-6 respectively: GMPS-F2:ACAGACGCGTACCACCTGTTTATCACCAAT; GMPS-R2:ACCCGTCGACATCAATGGCACCTCTTCGTT.

8. The method for cultivating GMPS transgenic plants according to claim 7, characterized in that: In step (8), the sequences of 249OX13 and 250OX14 are shown in SEQ ID NOs: 7-8, respectively: 249OX13:TCTTCTTCGTTCTACACATC; 250OX14:AAGACCGGCAACAGGATTC.

9. The method for cultivating GMPS transgenic plants according to claim 8, characterized in that: In the step (9), the sequences of qPCR-GMPS-F3 and qPCR-GMPS-R3 are shown in SEQ ID NOs: 9-10, respectively: qPCR-GMPS-F3: ACACTTCCTGTTTGATGTATG; qPCR-GMPS-R3:ATAGCCTTGTGACCAATTTA.

Images