Label-free multiple immunodetection system based on core-shell photon bar code integrated rolling circle amplification and application of label-free multiple immunodetection system

Abstract

The invention belongs to the technical field of immunodetection, and particularly relates to an unlabeled multiple immunodetection system based on core-shell photon bar code integrated rolling circle amplification and application. The non-labeled multiple immunodetection system comprises: 1) a probe-modified porous hydrogel-PhC shell microsphere, the probe is used for capturing a target nucleic acid molecule to be detected, the porous hydrogel-PhC shell microsphere is formed by coating a silica microsphere with a porous hydrogel, and the diameter of the porous hydrogel-PhC shell microsphere is 200-200 [mu] m; 2) an antibody modified by a DNA promoter; 3) a blocking / primer compound; and 4) a circular DNA. The detection system provided by the invention realizes high-sensitivity multiple quantitative detection, and the detection limit is within the range of 0.030 pg / mL. The detection system provided by the invention is verified through clinical sample analysis, has acceptable accuracy and high specificity, and proves that the provided detection system and method have good potential applicability in clinical screening and diagnosis.

Description

Technical Field

[0001] The present invention belongs to the technical field of immunoassays, and in particular, relates to a label-free multiple immunoassay system based on core-shell photon barcode integrated rolling circle amplification and its application. Background Art

[0003] Currently, common detection methods for viruses include real-time polymerase chain reaction (RT-PCR) through molecular amplification of viral RNA and immunoassays targeting virus-related proteins. Although RT-qPCR is a sensitive and accurate method, it faces some challenges in a decentralized environment, such as expensive thermal cyclers, and long reading times, requiring skilled techniques. In addition, the RT-PCR method cannot distinguish between live or dead viruses, and amplification can produce false positive rates. Immunoassays such as enzyme-linked immunosorbent assays (ELISA) and chemiluminescent immunoassays have attracted much attention due to their ability to quickly and specifically screen for certain viruses. Despite their great success, their limited sensitivity has hindered their use in the timely diagnosis of diseases, as the initial viral load of infection is sometimes low and difficult to detect.

[0004] Therefore, in order to meet the above challenges, people pay more and more attention to the development of some signal amplification strategies to accelerate the development of immunoassays, such as converting immunoassay signals into nucleic acid signals to achieve high-sensitivity detection. Current signaling amplification methods include loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), and rolling circle amplification (RCA). Among them, RCA describes a unidirectional nucleic acid replication process that can quickly synthesize multiple copies of circular DNA / RNA molecules and is widely used in limited resources. However, these methods are often limited to the detection of a single virus and cannot achieve multi-target detection. Especially in the case of the coexistence of COVID-19 and influenza, it has brought great pressure to society and medical staff in practical applications. Therefore, the development of a new immunoassay strategy with high sensitivity and multi-target quantification is still worth looking forward to.

[0005] In recent years, many researchers have devoted themselves to expanding the scope of suspension encoding strategies, including fluorescence, quantum dots, and photonic crystal (PhC) barcodes. Among these barcodes, PhC barcodes are formed based on the self-assembly of periodic ordered nanostructures, which endow them with gorgeous structural colors and inherent characteristic reflection peaks. In addition, these unique barcodes have advantages such as stable encoding and no photobleaching properties. These properties make PhC particles a promising tool for multiplexed detection of various biomarkers without interference from fluorescent signals. However, most detection methods based on photonic barcodes rely on fluorescent dye labeling, which has complex preparation processes and high costs, limiting their widespread application. In addition, the surface properties of traditional photonic barcode particles are poor and the probe fixation efficiency is low. Therefore, it is of great significance to develop new barcode carriers for label-free multiplex virus detection. Summary of the invention

[0006] The primary purpose of the present invention is to provide a label-free multiplex immunoassay system and application based on core-shell photon barcode integrated rolling circle amplification, so as to achieve high-sensitivity and high-specificity multiplex quantitative detection of target viruses.

[0007] To this end, the present invention provides the following technical solutions.

[0008] One aspect of the present invention provides a label-free multiplex immunoassay system based on core-shell photon barcode integrated rolling circle amplification, comprising:

[0009] 1) Probe-modified porous hydrogel-PhC shell microspheres, wherein the probe is used to capture the target nucleic acid molecule to be detected, the porous hydrogel-PhC shell microspheres are formed by porous hydrogel-coated silica microspheres, and the diameter of the porous hydrogel-PhC shell microspheres is between 200 and 200 μm;

[0010] 2) DNA promoter-modified antibodies;

[0011] 3) a blocker / primer complex; and

[0012] 4) Circular DNA.

[0013] In a preferred embodiment of the present invention, in step 1), the porous hydrogel-PhC shell microspheres are prepared by the following steps:

[0014] Adding a photoinitiator to a pre-gel solution to obtain a hydrogel solution, wherein the mass ratio of polyethylene glycol diacrylate to acrylic acid in the pre-gel solution is 10-20:10-20;

[0015] The obtained hydrogel solution is added to the silica microspheres, allowed to stand, and then cured by ultraviolet irradiation to obtain hydrogel-PhC shell microspheres;

[0016] The obtained hydrogel-PhC shell microspheres were etched with hydrofluoric acid to obtain porous hydrogel-PhC shell microspheres.

[0017] In a preferred embodiment of the present invention, the initiator is selected from any one of photoinitiator HMPP, photoinitiator 2959 and photoinitiator BPO.

[0018] In a preferred embodiment of the present invention, the standing time is 1 to 3 hours.

[0019] In a preferred embodiment of the present invention, the ultraviolet light irradiation conditions are: wavelength 365nm, time 20 to 30s.

[0020] In a preferred embodiment of the present invention, the concentration of hydrofluoric acid is 0.5-1%, and the etching time is 20-40 minutes.

[0021] In a preferred embodiment of the present invention, in step 1), the probes have nucleotide sequences as shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0022] In a preferred embodiment of the present invention, in step 2), the DNA promoter-modified antibody is a complex of a DNA promoter and an antibody, and the DNA promoter has a nucleotide sequence as shown in SEQ ID NO: 4 and SEQ ID NO: 5.

[0023] In a preferred embodiment of the present invention, the antibodies include anti-SARS-COV-2-N antibodies, anti-H1N1 antibodies, and anti-SARS-CoV-2-S antibodies.

[0024] In a preferred embodiment of the present invention, in step 3), the blocking / primer complex is composed of a primer and a G-padlock, the primer is used to amplify the target nucleic acid molecule to be detected, and the G-padlock has a nucleotide sequence as shown in SEQ ID NO:9.

[0025] In a preferred embodiment of the present invention, the primers have nucleotide sequences as shown in SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8, respectively.

[0026] In a preferred embodiment of the present invention, in step 4), the circular DNA single-stranded circular DNA is a template for rolling circle amplification.

[0027] In a preferred embodiment of the present invention, it also includes: RCA reaction buffer ThT and Phi 29 DNA polymerase.

[0028] Another aspect of the present invention also provides an application of the aforementioned label-free multiplex immunoassay system based on core-shell photon barcode integrated rolling circle amplification in the qualitative and / or quantitative detection of one or a combination of more than two of H1N1, SARS-CoV-2-S, and SARS-CoV-2-N.

[0029] By means of the above technical solution, the present invention has at least the following advantages:

[0030] The present invention proposes a novel label-free immunoassay system, which combines core-shell PhC barcodes with RCA to form a label-free multiplex immunoassay system based on core-shell photon barcode integrated rolling circle amplification, which can be used for high-sensitivity and high-accuracy multiplex virus detection. A large number of experimental results show that the composite immunoassay system developed by the present invention can achieve high-sensitivity and high-specificity detection of targets.

[0031] The detection system of the present invention not only exhibits the ability to quickly and accurately detect SARS-COV-2-N, SARS-COV-2-S and H1N1 simultaneously in the same tube, which is of great value for the multiplex label-free detection of H1N1, SARS-CoV-2-S and SARS-CoV-2-N, but also converts the signal of the target protein into a nucleic acid signal based on the DNA-modified antibody complex combined with the blocking / primer complex and the RCA strategy. The results showed that the system achieved highly sensitive multiple quantitative detection with a detection limit in the range of 0.030pg / mL. In addition, the detection system of the present invention was verified by clinical sample analysis with acceptable accuracy and high specificity, demonstrating that the proposed detection method has good potential applicability in clinical screening and diagnosis. Therefore, this innovative system and the corresponding detection method are expected to achieve multiple quantitative and / or qualitative detection of other pathogenic viruses and bacteria in many practical clinical applications.

[0032] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention and implement it according to the contents of the specification, the preferred embodiments of the present invention are described in detail as follows. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is a schematic diagram of the label-free multiplex immunoassay system based on core-shell photon barcode integrated rolling circle amplification of the present invention;

[0034] Figure 2Preparation and structural properties of porous hydrogel-PhC shell microspheres, wherein (a) is a schematic diagram of the preparation process of porous hydrogel-PhC shell microspheres, (b) is a SEM image of the global morphology of PhC microspheres, (c) is a microscopic characterization image of the exposed surface morphology of PhC microspheres, (d) is a microscopic characterization image of the exposed surface morphology of PhC microspheres infiltrated in hydrogel, (e) is a microscopic characterization image of the surface of porous hydrogel-PhC shell microspheres obtained in Example 1, the scale bar of (b) is 100um, the scale bars of (c) and (d) are 2.0um, and the scale bar of (e) is 0.2um;

[0035] Figure 3 are optical properties of different microspheres, wherein (a)-(c) are microscope optical images of PhC microspheres under full-wavelength white light, respectively, and the scale bar is 200 μm, (d)-(f) are microscope optical images of porous hydrogel-PhC shell microspheres obtained in Example 1 under full-wavelength white light, respectively, and (g)-(i) are comparisons of reflectance spectra of PhC microspheres and porous hydrogel-PhC shell microspheres obtained in Example 1, respectively;

[0036] Figure 4 The present invention is an optimization of the reaction conditions of the label-free multiplex immunoassay system based on core-shell photon barcode integrated rolling circle amplification, wherein (a) is a comparison of fluorescence intensity in the presence and absence of a target, (b) is a comparison of fluorescence intensity at different phi 29 enzyme concentrations, (c) is a comparison of fluorescence intensity at different buffer ThT concentrations, and (d) is a comparison of fluorescence intensity at different RCA reaction times;

[0037] Figure 5 The sensitivity and specificity of the non-labeled multiplex immunoassay system based on core-shell photon barcode integrated rolling circle amplification for three viruses of the present invention, wherein (a)-(c) are the fluorescence intensity statistics of H1N1 virus, SARS-CoV-2-N and SARS-CoV-2-S at different concentrations, (d)-(f) are the linear analysis of the fluorescence intensity of H1N1 virus, SARS-CoV-2-N and SARS-CoV-2-S at different virus concentrations, (g)-(i) are the specificity evaluations of the three target proteins in the presence of high concentrations of interfering substances, and all tests were repeated 3 times;

[0038] Figure 6 The present invention is a label-free multiplex immunoassay system based on core-shell photonic barcode integrated rolling circle amplification for simultaneously detecting two viruses, wherein (a) is a schematic diagram of multiple label-free virus detection, (b) is a bright field microscope image (i-iii) and a dark field fluorescence image (iv-vi) of three core-shell color microbeads incubating two viruses simultaneously, and (c) is the fluorescence intensity statistics of the hydrogel core-shell color barcode for simultaneously detecting two viruses. All tests were repeated 3 times;

[0039] Figure 7 The microscope bright field image (a) and dark field fluorescence image (b) of the label-free multiplex immunoassay system based on core-shell photon barcode integrated rolling circle amplification of the present invention for simultaneous detection of three viruses. DETAILED DESCRIPTION

[0040] In order to make the technical means, creative features, objectives and effects of the present invention easy to understand, the technical solutions in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0041] The present invention adopts a non-labeled multiple immunoassay system integrating rolling circle amplification with core-shell photon barcode, and utilizes a DNA-modified antibody complex to bind a blocking / primer complex and RCA to convert the target protein into a nucleic acid signal. In the presence of the target protein, the DNA-modified antibody Ab1 and the DNA-modified antibody Ab2 recognize the target protein to be tested based on antigen-specific binding, and a sandwich structure is formed by the antibodies, and the two complementary nucleic acid chains are partially bound due to the proximity effect. Therefore, the unbound exposed part of the complex can be bound to the blocking / primer complex through a chain displacement reaction to release the primer. The released primer will hybridize with the probe fixed on the porous hydrogel-PhC shell microsphere barcode, and then trigger RCA with the help of THT to produce a large number of G4 repeat sequences and strong fluorescence signals. Therefore, the target protein signal is converted into a nucleic acid signal, and the coagulation degree of the target protein is measured by reading the fluorescence intensity on the core-shell structure colored microspheres.

[0042] The present invention proposes a novel label-free immunoassay platform that combines nucleocapsid PhC barcodes with RCA for highly sensitive multiplex virus detection. Figure 1As shown, the platform uses a pair of DNA antibody conjugates to recognize the target protein, thereby forming a proximity ligation complex Ab-1 / target protein / Ab-2. This process triggers a strand displacement reaction (SDA) to release the primer from the designed blocking / primer complex. Subsequently, the released primer hybridizes with the probe immobilized on the barcode, initiating RCA with C-rich circular DNA as a template, generating a large number of G-quadruplexes and producing a strong fluorescent signal. As a result, the signal of the target protein is converted into a nucleic acid signal. In addition, different PhC barcodes modified with different probes can be used to achieve multiple target determination. The results show that the composite immunoassay platform developed by the present invention is of great value for the multiplexed label-free detection of H1N1, SARS-CoV-2-S and SARS-CoV-2-N. Therefore, this innovative method is expected to achieve multiplexed quantification of other pathogenic viruses and bacteria in many practical clinical applications.

[0043] Unless otherwise specified, the percentage content involved in the present invention refers to mass percentage for solid-liquid mixing and solid-solid mixing, and refers to volume percentage for liquid-liquid mixing.

[0044] Unless otherwise specified, the percentage concentrations referred to in the present invention all refer to final concentrations, which refer to the percentage of the added component in the system after the addition of the component.

[0045] The temperature parameters in the present invention, if not specifically limited, allow for both constant temperature treatment and treatment within a certain temperature range. The constant temperature treatment allows the temperature to fluctuate within the precision range controlled by the instrument.

[0046] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods.

[0047] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0048] Example 1: Preparation of porous hydrogel-PhC shell microspheres

[0049] Polyethylene glycol diacrylate (PEGDA) and acrylic acid (AA) are dissolved in water to obtain a pre-gel solution. A photoinitiator HMPP is added to the obtained pre-gel solution to obtain a hydrogel solution, wherein the mass volume ratio concentrations of polyethylene glycol diacrylate, acrylic acid and HMPP in the hydrogel solution are 20%, 10% and 1% respectively.

[0050] Then fill the obtained hydrogel solution into the dried PhC microspheres (assembly method refers to Label-Free Quantifications of Multiplexed Mycotoxins by G-Quadruplex Based on Photonic Barcodes), let it stand for 2.0 hours, and then irradiate it with 365nm ultraviolet light for 30 seconds to strengthen it to obtain hydrogel microspheres. After strengthening, wash the obtained hydrogel microspheres with ddH2O to remove impurities on the surface of the hydrogel microspheres, and then etch the obtained hydrogel microspheres with 0.5% hydrofluoric acid (HF) for 30 minutes to successfully obtain porous hydrogel-PhC shell microspheres. Finally, rinse it repeatedly with ultrapure water to obtain gorgeous translucent beads, which are porous hydrogel-PhC shell microspheres.

[0051] like Figure 2 As shown in a, the porous hydrogel-PhC shell microspheres in this embodiment are prepared by replicating the PhC microsphere template formed by assembling silica nanoparticles. Figure 2 b and Figure 2 As shown in Fig. c, the PhC microsphere template was observed to present a hexagonal nanostructure by scanning electron microscopy (SEM). The prepared hydrogel solution was added to the PhC microspheres and entered the interconnected nanopores of the silica nanoparticles through capillary force. Subsequently, the hydrogel solution was polymerized under the action of an initiator after ultraviolet irradiation for 30 seconds to obtain hydrogel-PhC shell microspheres, as shown in Fig. Figure 2 Finally, the hydrogel-PhC shell microspheres were selectively etched with 0.5% HF for 0.5 h to form a highly ordered hydrogel shell with a hexagonal symmetrical porous scaffold structure (as shown in Figure 5). Figure 2 e), while keeping the hydrogel hybrid microsphere core and the PhC microsphere barcode structure the same, thereby obtaining a porous hydrogel-PhC shell microsphere carrier. After testing, the diameter of the obtained porous hydrogel-PhC shell microsphere is between 200-220um.

[0052] Coding elements are essential for multiplex detection, and PhC microsphere barcodes are endowed with characteristic reflection spectra due to their periodically ordered nanostructures. In addition, according to the Bragg equation: λ=1.633d naverage, the unique reflection spectrum inherent to the PhC barcode is adjusted by the diameter of the orderly arranged silica nanoparticles. In the above Bragg equation, d represents the distance between two adjacent nanoparticles, and naverage represents the average refractive index of the material components. Since the porous hydrogel-PhC shell microsphere carrier is replicated from the PhC microsphere barcode template structure. Similarly, the reflection peak of the hydrogel-encapsulated PhC microsphere barcode also conforms to the Bragg equation. The average value of the core-shell hydrogel barcode is determined by its composition and proportion, so the reflection peak is mainly related to the diameter of the hydrogel-encapsulated barcode. As Figure 3 a- Figure 3 As shown in Figure 1, the SCCB template (i.e., PhC microspheres) and the porous hydrogel-PhC shell microspheres obtained above have bright structural colors and unique wavelength reflection spectra at 470nm, 550nm, and 635nm, respectively. In addition, the reflection peak of the constructed core-shell encoding carrier porous hydrogel-PhC shell microspheres is almost the same as that of the PhC microsphere template, and the changes caused are negligible. Even more exciting is that the PhC microsphere barcode still presents a stable and bright color after hydrogel encapsulation. The above results show that hydrogel-encapsulated PhC microsphere barcodes can be used as a multiplex detection platform.

[0053] Example 2: Construction of a label-free multiplex immunoassay system based on core-shell photonic barcode integrated rolling circle amplification

[0054] 1. Preparation of probe-modified porous hydrogel-PhC shell microspheres

[0055] The porous hydrogel-PhC shell microspheres prepared in Example 1 were treated with an activator such as EDC and NHS buffer (the buffer composition used in this example was PBS (10 mM, pH 7.4) for 0.5 h to activate the carboxyl groups on the porous hydrogel-PhC shell microsphere carrier AA. Then, they were washed with PBS, and after washing, nucleic acid probes were added and reacted at 37° C. for 2.0 h to covalently bind the carboxyl groups on the porous hydrogel-PhC shell microspheres to the amino groups of the nucleic acid probes, and then blocked with BSA for 30 min. Different porous hydrogel-PhC shell microspheres were mixed with corresponding target nucleic acid probes to obtain corresponding probe-modified porous hydrogel-PhC shell microspheres.

[0056] The probe sequences used in the present invention for capturing the H1N1, SARS-CoV-2-S and SARS-CoV-2-N nucleic acid molecules to be detected are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively:

[0057] SEQ ID NO: 1: TCTATACT;

[0058] SEQ ID NO: 2: TATCGTTA;

[0059] SEQ ID NO: 3: ATATAAGG.

[0060] 2. Preparation of DNA promoter-modified antibodies

[0061] First, 100 μL of 0.5 mg / mL anti-SARS-COV-2-N paired antibody (Novozyme, RM3146) (named Ab-1 / Ab-2) was incubated with EDC and NHS at a molar ratio of 2:1 for 60 minutes to obtain incubated Ab-1 / Ab-2. Next, 100 μL of DNA promoter (100 μM) was reacted with the incubated Ab-1 / Ab-2 at 4.0 ° C for 12 hours. After the reaction, the unbound DNA promoter chain was removed by ultrafiltration to obtain a purified DNA-anti-SARS-COV-2-N paired antibody complex. Finally, the purified DNA-anti-SARS-COV-2-N paired antibody complex was stored at -20 ° C for future use.

[0062] At the same time, a similar method was used to label anti-SARS-COV-2-S antibody (Novozymes, RM3159) and anti-H1N1 antibody (Beijing Sino Biological Technology Co., Ltd., 11684-MM03) with DNA promoters to obtain the corresponding purified DNA-anti-SARS-COV-2-S paired antibody complexes and purified DNA-anti-H1N1 paired antibody complexes.

[0063] The DNA promoter sequences used in the above process are shown in SEQ ID NO: 4 and SEQ ID NO: 5 respectively:

[0064] SEQ ID NO: 4:

[0065] TGAGGTAGTATGTCAGGACTTTTTTTTATCACATCAGGCTCTATGCTATTG;

[0066] SEQ ID NO: 5:

[0067] TACGTCCAGAACTTTACCCATCTTTTTTGTCCTGTTTGTGTATAGTTGGATGCA A;

[0068] 3. Preparation of circular DNA

[0069] First, primers (10 μM) and G-padlock (10 μM) were added to 10 mM PBS (pH 7.4), reacted at 95 ° C for 5 minutes, and then slowly cooled to room temperature to obtain a blocking / primer complex. Subsequently, splint R ligase (25 U / μL) and ligation buffer (composed of: 500 mM Tris-HCl, 100 mM MgCl2, 10 mM ATP, and 100 mM DTT, catalog number: B0375SVIAL) were incubated with the above blocking / primer complex at 25 ° C for 2.0 hours to obtain a ligation product. Finally, ExoIII (100 U / μL) and CutSmart buffer were mixed with the obtained ligation product, reacted at 37 ° C for 2.0 hours to obtain a complete circular DNA, the reaction was terminated at 65 ° C for 20 minutes, and stored at -20 ° C for use as a template.

[0070] The primer sequences used in the above process are shown in SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8 respectively:

[0071] SEQ ID NO: 6: TGAGGTAGTATGTTGTATAGTTGATATAGA

[0072] SEQ ID NO: 7: TGAGGTAGTATGTTGTATAGTTTAACGATA

[0073] SEQ ID NO: 8: TGAGGTAGTATGTTGTATAGTT CCTTATAT

[0074] The G-padlock sequence used is shown in SEQ ID NO: 9:

[0075] SEQ ID NO:9:

[0076] ATACTACCTCACTGGGCCCACCCTCCCCACCCGGGACAACTATACAAC

[0077] 4. Multiple label-free detection reaction system

[0078] First, the three different DNA-modified paired antibodies obtained above: DNA-anti-SARS-COV-2-N paired antibody complex, DNA-anti-SARS-COV-2-S paired antibody complex and DNA-anti-H1N1 paired antibody complex were mixed with three viral proteins (Novozyme) (concentration range of 1.0pg / mL-100pg / mL) in the same tube at 37°C for 0.5h to obtain a mixed solution. Next, the three probe-modified porous hydrogel-PhC shell microspheres and the above-prepared blocking / primer complex, circular DNA, RCA reaction buffer ThT and Phi 29DNA polymerase were added to the resulting mixture and reacted at 37°C for 1.0h. The fluorescence intensity was collected using a fluorescence spectrometer, and all experiments were performed in 3 parallel groups.

[0079] Example 3: Optimization of reaction conditions

[0080] In order to verify the feasibility of the label-free multiplex immunoassay system of the present invention, the fluorescence intensity of the reaction system constructed in the above Example 2 was compared. Figure 1 As shown, when the target protein to be detected appears, the paired DNA-antibodies Ab1 and Ab2 recognize the target protein to be detected and form a sandwich complex, and shorten the distance between the two nucleic acid chains fixed on the antibodies, prompting partial pairing and binding of the nucleic acid chains. The unbound part of the sandwich complex binds to the designed blocking / primer complex through a chain displacement reaction, and releases the primer in the blocking / primer complex. The released primer then hybridizes with the probe on the probe-modified porous hydrogel-PhC shell microspheres and triggers the subsequent RCA reaction, generating a strong fluorescent signal on the porous hydrogel-PhC shell microsphere carrier. As shown Figure 4 As shown in (a), in the presence of the target protein to be detected, the fluorescence intensity shows a sharp peak at 485nm (corresponding to the red line in the figure), and in the absence of the target protein to be detected, the fluorescence intensity tends to a horizontal line (corresponding to the black line in the figure). This result shows that the detection system and detection method constructed by the present invention successfully convert protein detection into nucleic acid detection, laying a foundation for the detection of low-concentration protein biomarkers.

[0081] In order to better realize the potential of the detection system and detection method described in the present invention, this example optimizes some reaction conditions. During the RCA amplification reaction, the concentration of the phi29 enzyme is crucial to the reaction efficiency. Therefore, this example first examines the effect of changes in the concentration of the phi29 enzyme on the detection signal. The specific method is: using the multiple label-free detection reaction system described in Part 4 of Example 2, and keeping other conditions unchanged, explore the changes in the fluorescence intensity of the reaction system when the phi29 enzyme concentration is in the range of 0 to 1.0U. The results are shown in Figure 2. Figure 4 (b) If Figure 4As shown in (b), within the concentration range of 0 to 1.0 U, as the concentration of phi29 enzyme increased, the FL intensity showed an obvious upward trend. When the concentration increased to 1.0 U, the FL intensity no longer increased. Therefore, 1.0 U was selected as the optimal concentration of phi29 enzyme.

[0082] The concentration of ThT in the RCA reaction buffer was screened using the same method as above. Figure 4 (c). Figure 4 As shown in (c), within the range of 0.5 to 2.5 uM, as the concentration of ThT increases, the FL intensity signal increases continuously and reaches a maximum value and stabilizes at a concentration of 0.5 uM. Therefore, the optimal concentration of ThT is selected to be 3.0 uM.

[0083] Since the amplification reaction time determines the amount of product, thus affecting the FL intensity, this example also explores the effect of RCA reaction time on the fluorescence intensity. Figure 4 (d) Figure 4 As shown in (d), with the increase of reaction time, the FL intensity showed an obvious upward trend, and reached a plateau after 60 min of reaction. Therefore, this time (60 min) was selected as the optimal time for detection.

[0084] According to the above results, the optimal single reaction system composition is shown in Table 1 below:

[0085] Table 1 Composition of the best reaction system

[0086]

[0087]

[0088] Based on the above results, the optimal reaction conditions were determined to be: 37°C for 1.0 h.

[0089] Example 4: Sensitivity and specificity of detection

[0090] In order to further demonstrate the sensitivity of the detection method proposed by the present invention, different concentrations of H1N1 in the reaction system were verified on the platform. The specific method is: using the optimal reaction system determined in Table 1 of Example 3, and performing RCA reaction on different concentrations of H1N1 according to the content described in Part 4 of Example 2, and collecting the fluorescence model, and drawing a linear relationship diagram at the same time, the results are shown in Figure 5 (a) and 5(d). Figure 5 As shown in (a), the fluorescence signal intensity showed a significant increase trend as the H1N1 concentration increased from 1.0 to 100 pg / mL. Figure 5As shown in (d), the method showed a good linear response graph for H1N1 concentrations in the range of 1.0 to 50 pg / mL, and the linear equation was Y = 127.6 + 5383.6log10(x), R 2 =0.9884. It is thus calculated that the detection limit of the reaction system of the present invention for H1N1 is 0.03 pg / mL, calculated at a signal-to-noise ratio of 3.

[0091] In addition, the sensitivity of the detection system of the present invention to two other viruses, SARS-CoV-2-N and SARS-CoV-2-S, was also tested using the same method, and similar results were obtained, as shown in FIG. Figure 5 (b) and 5(e), 5(c) and 5(f). Figure 5 As shown in (b), the fluorescence signal intensity showed a significant increase trend as the concentration of SARS-CoV-2-N increased from 1.0 to 100 pg / mL. Figure 5 As shown in (e), the method showed a good linear response graph for SARS-CoV-2-N concentrations in the range of 1.0 to 50 pg / mL, and the linear equation was Y = 448.5 + 5223.5log10(x), R 2 =0.9848. It is thus calculated that the detection limit of the detection system and method of the present invention for SARS-CoV-2-N is 0.027 pg / mL, calculated at a signal-to-noise ratio of 3. Figure 5 As shown in (c), the fluorescence signal intensity showed a significant increase trend as the concentration of SARS-CoV-2-S increased from 1.0 to 100 pg / mL. Figure 5 As shown in (f), the method showed a good linear response graph for SARS-CoV-2-S concentrations in the range of 1.0 to 50 pg / mL, and the linear equation was Y = 587.7 + 5158.8log10(x), R 2 =0.9933. Based on this, the detection limit of the detection system and method of the present invention for SARS-CoV-2-S is calculated to be 0.017 pg / mL, calculated at a signal-to-noise ratio of 3.

[0092] The above results show that this method proposes a new multiplex amplification detection system with significantly higher sensitivity than existing immunoassays (the existing method has a detection sensitivity of 0.5pg / mL). Therefore, it is precisely because of the large amount of G4 produced in the RCA amplification reaction and the uniqueness of the encoding vector that the constructed platform has high sensitivity and selectivity. Compared with the traditional fluorescent labeling method, the results obtained by this method provide a new label-free detection platform with high accuracy and sensitivity.

[0093] In addition, this example further studies the specificity of the detection system by measuring the signal intensity of interference targets such as BSA, H3N2 and H1N1. The specific method is: using the optimal reaction system determined in Table 1 of Example 3, and according to the content described in Part 4 of Example 2, the interference targets BSA, H3N2 and the target H1N1 to be detected are added to the reaction system to perform RCA reaction and obtain fluorescence signals. The results are shown in Figure 5 (g). Figure 5 The results in (g) show that even though the concentration of the interfering substance (500 pg / mL) is 10 times that of the target H1N1 concentration (50 pg / mL), the fluorescence signal intensity measured for the interfering substance is almost the same as the fluorescence signal of the blank control. Only when the target H1N1 appears will the fluorescence signal rise rapidly and be significantly higher than the fluorescence signals of other interfering targets.

[0094] The same method was used to test the specificity of the reaction systems of the target SARS-CoV-2-N and SARS-CoV-2-S, and the results were shown in 5(h) and Figure 5 (i) as shown. Figure 5 (h) and Figure 5 The results in (i) show that the same satisfactory results as above were obtained by exploring the specificity of SARS-CoV-2-N and SARS-CoV-2-S. Therefore, these results confirm that the label-free multiplex immunoassay system based on core-shell photon barcode integrated RCA developed by the present invention has high specificity and enhances the potential for detecting live pathogenic viruses in complex samples.

[0095] Example 5: Simultaneous detection of different viruses

[0096] Because COVID-19 has brought a lot of economic losses and some complications to the public. In addition, the symptoms caused by conventional influenza viruses are basically similar to those caused by SARS-CoV-2 coronavirus, which can easily mislead the public in treatment. Therefore, it is crucial to develop a new method of immediate intervention and effectively distinguish these viruses. To this end, the present invention constructs a new core-shell barcode combined with RCA signal amplification technology for simultaneous label-free detection of the above two / three viruses. The composite hydrogel shell used in the present invention is formed by polymerization of acrylic acid and polyethylene glycol diacrylate under the action of an initiator, and the core silica photonic crystal is used as a detector. In addition, by adjusting the internal periodic structure, the PhC microcarrier is able to perform various color barcodes to detect different targets. As Figure 6As shown in (a), the corresponding capture probes of the three viruses are fixed on three color-coded porous hydrogel-PhC shell microspheres (the specific preparation method is as described above) assembled from three PhC microspheres of different particle sizes (200-220μm). In the presence of the target virus, the antibody modified with nucleic acid DNA specifically binds to capture the viral protein and forms a sandwich structure, thereby causing the nucleic acid chains on the antibody to approach each other and hybridize. The unhybridized DNA fragments bind to the blocking / primer complex and initiate SDA to release the primer chain. The released primer will bind to the nucleic acid probe on the corresponding probe-modified porous hydrogel-PhC shell microsphere and trigger the subsequent RCA reaction, generating a strong fluorescent signal on the core-shell microsphere carrier.

[0097] In this example, in order to demonstrate the capability and accuracy of the developed multiplex detection method, two combinations of viruses to be tested (a combination of SARS-CoV-2-N, SARS-CoV-2-S, and H1N1) were added to the same tube for simultaneous detection. The specific method was as follows: RCA reaction was performed according to the optimal reaction system determined in Table 1 of Example 3 and the contents described in Part 4 of Example 2, and the fluorescence signal was collected. The results are shown in Table 1. Figure 6 (b) and Figure 6 (c). Figure 6 In (b), i represents the bright field image of SARS-CoV-2-N and SARS-CoV-2-S detection, ii represents the bright field image of SARS-CoV-2-N and H1N1 detection, and iii represents the bright field image of SARS-CoV-2-S and H1N1 detection; iv-vi represent the fluorescence images of the corresponding protein detection.

[0098] like Figure 6 (b) and Figure 6 As shown in (c), the detection system of the present invention can realize the simultaneous detection of two target viruses to be detected. The above results show that the detection system proposed by the present invention has excellent multiplex ability and high specificity for the detection of target viruses.

[0099] Finally, this example also simultaneously detects three viruses H1N1, SARS-CoV-2-N and SARS-CoV-2-S. The specific method is: according to the optimal reaction system determined in Table 1 of Example 3 and the contents described in Part 4 of Example 2, RCA reaction is performed. The results are shown in FIG. Figure 7 , where a represents the bright field image of the microscope for simultaneous detection of three proteins, and b represents the fluorescence image for simultaneous detection of three proteins. Figure 7 As shown, the detection system of the present invention can realize the simultaneous detection of three target viruses to be detected. All of the above experimental data emphasize that the method has the ability to realize label-free, multiple, high-sensitivity and specific detection.

[0100] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any form. Although the present invention has been disclosed as a preferred embodiment as above, it is not used to limit the present invention. Any technician familiar with this profession can make some changes or modifications to equivalent embodiments of equivalent changes by using the methods and technical contents disclosed above without departing from the scope of the technical solution of the present invention. However, any simple modification, equivalent change and modification made to the above embodiments according to the technical essence of the present invention without departing from the content of the technical solution of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. A label-free multiplex immunoassay system based on core-shell photon barcode integrated rolling circle amplification, characterized in that: include: 1) Probe-modified porous hydrogel-PhC shell microspheres, wherein the probe is used to capture the target nucleic acid molecule to be detected, the porous hydrogel-PhC shell microspheres are formed by porous hydrogel-coated silica microspheres, and the diameter of the porous hydrogel-PhC shell microspheres is between 200 and 200 μm; 2) DNA promoter-modified antibodies; 3) a blocker / primer complex; and 4) Circular DNA.

2. The label-free multiplex immunoassay system based on core-shell photon barcode integrated rolling circle amplification according to claim 1, characterized in that: In step 1), the porous hydrogel-PhC shell microspheres are prepared by the following steps: Adding a photoinitiator to a pre-gel solution to obtain a hydrogel solution, wherein the mass ratio of polyethylene glycol diacrylate to acrylic acid in the pre-gel solution is 10-20:10-20; The obtained hydrogel solution is added to the silica microspheres, allowed to stand, and then cured by ultraviolet irradiation to obtain hydrogel-PhC shell microspheres; The obtained hydrogel-PhC shell microspheres were etched with hydrofluoric acid to obtain porous hydrogel-PhC shell microspheres.

3. The label-free multiplex immunoassay system based on core-shell photon barcode integrated rolling circle amplification according to claim 2, characterized in that: The initiator is selected from any one of photoinitiator HMPP, photoinitiator 2959 and photoinitiator BPO.

4. The label-free multiplex immunoassay system based on core-shell photon barcode integrated rolling circle amplification according to claim 2, characterized in that: The standing time is 1 to 3 hours.

5. The label-free multiplex immunoassay system based on core-shell photon barcode integrated rolling circle amplification according to claim 2, characterized in that: The ultraviolet light irradiation conditions are: wavelength 365nm, time 20 to 30s.

6. The label-free multiplex immunoassay system based on core-shell photon barcode integrated rolling circle amplification according to claim 2, characterized in that: The concentration of the hydrofluoric acid is 0.5-1%, and the etching time is 20-40 minutes.

7. The label-free multiplex immunoassay system based on core-shell photon barcode integrated rolling circle amplification according to claim 1, characterized in that: In step 1), the probes have nucleotide sequences as shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

8. The label-free multiplex immunoassay system based on core-shell photon barcode integrated rolling circle amplification according to claim 1, characterized in that: In step 2), the DNA promoter-modified antibody is a complex of a DNA promoter and an antibody, and the DNA promoter has a nucleotide sequence as shown in SEQ ID NO: 4 and SEQ ID NO:

5.

9. The label-free multiplex immunoassay system based on core-shell photon barcode integrated rolling circle amplification according to claim 8, characterized in that: The antibodies include anti-SARS-COV-2-N antibodies, anti-H1N1 antibodies, and anti-SARS-CoV-2-S antibodies.

10. The label-free multiplex immunoassay system based on core-shell photon barcode integrated rolling circle amplification according to claim 1, characterized in that: In step 3), the blocking / primer complex is composed of a primer and a G-padlock, the primer is used to amplify the target nucleic acid molecule to be detected, and the G-padlock has a nucleotide sequence as shown in SEQ ID NO:

9.

11. The label-free multiplex immunoassay system based on core-shell photon barcode integrated rolling circle amplification according to claim 10, characterized in that: The primers have nucleotide sequences shown as SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8, respectively.

12. The label-free multiplex immunoassay system based on core-shell photon barcode integrated rolling circle amplification according to claim 1, characterized in that: In step 4), the circular DNA single-stranded circular DNA is a template for rolling circle amplification.

13. The label-free multiplex immunoassay system based on core-shell photon barcode integrated rolling circle amplification according to claim 1, characterized in that: Also includes: RCA reaction buffer ThT, Phi 29 DNA polymerase.

14. Use of the label-free multiplex immunoassay system based on core-shell photon barcode integrated rolling circle amplification according to any one of claims 1 to 13 in the qualitative and / or quantitative detection of one or a combination of more than two of H1N1, SARS-CoV-2-S, and SARS-CoV-2-N.

Images