Space-time resolution single cell transcriptome detection method

Abstract

The invention discloses a time-space resolution single cell transcriptome detection method, which comprises the following steps: firstly, carrying out specific marking on RNA newly generated by cells within a specific time by using a metabolism marking technology so as to ensure that new RNA molecules can be accurately identified and tracked; then, signal amplification of a new RNA target is realized through an adjacent rolling circle amplification (PLA-RCA) technology, and the detection sensitivity is improved; and finally, realizing high-throughput analysis on the newborn RNA by using an in-situ fluorescence sequencing technology, and carrying out accurate space positioning and quantification on the newborn RNA in the single cell by the step. Through the method, time and space resolution analysis can be provided for a single cell transcriptome, so that analysis of complex biological processes such as cell differentiation, disease occurrence and cell function response is facilitated; moreover, the method has important significance for revealing a molecular mechanism in a cell biological process, and provides a new visual angle and tool for disease diagnosis and treatment.

Description

Technical Field

[0001] The present invention belongs to the technical field of single cell analysis, and in particular relates to a single cell transcriptome detection method with spatiotemporal resolution. Background Art

[0002] Single-cell analysis refers to the study of multiple aspects and multi-omics characteristics of cells, such as the genome, transcriptome, proteome, epigenetic group and metabolome, at the single-cell level to reveal the heterogeneity between individual cells. This is different from traditional bulk analysis, which usually obtains the average state of the cell population at the multi-cell or tissue level and cannot clarify the key heterogeneity information between cells. Single-cell analysis technology can measure each cell individually, identify unique characteristics, and obtain genetic information, thereby revealing the gene structure and expression state of each cell, reflecting the cell heterogeneity information and genetic information of rare cells that cannot be obtained by traditional bulk analysis. Currently, single-cell analysis has been widely used in research fields such as development, homeostasis and disease.

[0003] Cells undergo different state transitions during their life. Conventional single-cell analysis usually requires lysing single cells and capturing their static and instantaneous gene expression information, while the heterogeneity of single cells at the molecular level often changes dynamically over time. For example, gene expression is transcribed from DNA into mRNA, and stimulation by different environmental factors and activation of various signaling pathways can cause dynamic changes in the transcriptional activity of specific genes. Therefore, capturing the dynamic changes in cells at the gene expression level has become a research hotspot for single-cell dynamic analysis.

[0004] Time-resolved single-cell transcriptome dynamic analysis is a technique that tracks and analyzes the temporal evolution of single-cell transcriptomes, which can reveal the dynamic process of gene expression over time. This analysis not only focuses on the gene expression state at a certain time point, but also studies the dynamic changes of gene expression over time during development, cell cycle, or in response to external stimuli. In the dynamic analysis of gene expression, "newly generated RNA" at a specific time is more worthy of attention. Nascent RNA refers to the newly synthesized transcription product of cells at a specific time, which can reflect the instantaneous transcription activity changes of genes. For example, when cells respond to stimulation, drug effects, or the early stage of a certain developmental stage, genes may be immediately activated to produce new mRNA. Compared with the "total RNA" in the cell, these newly synthesized RNAs can directly reflect the dynamic changes of genes and monitor the initiation and attenuation of gene expression in real time, which is crucial for understanding the dynamic regulation of gene expression under different conditions (such as cell stress, differentiation, and development). Even cells in the same tissue may have certain differences in their transcription process, that is, heterogeneity between cells. Therefore, studying nascent RNA in single cells can reveal these differences, thereby helping to understand cellular diversity in disease, and has profound and important research significance for revealing the basic principles of cell biology and promoting the development of precision medicine.

[0005] At present, the analytical methods for studying the dynamic changes of nascent RNA at the single-cell level are relatively mature, but the dynamic analysis strategies for analyzing gene expression and cell function in two dimensions of time and spatial resolution are still relatively limited. Existing time-resolved single-cell transcriptome analysis methods mainly include: (1) Pseudo-chronological analysis technology, which uses single-cell transcriptome sequencing data to infer cell trajectories. However, the statistical assumptions may not be consistent with the actual cell life process. The estimation of gene transcription rate has long relied on models and may be affected by model assumptions and algorithms; (2) Time-resolved single-cell detection methods based on cytoplasmic content sequencing technology can extract and sequence RNA from single cells at multiple time points, but this method has low cell analysis throughput and cannot achieve high sequencing throughput; (3) New RNA analysis methods combined with metabolic labeling and high-throughput sequencing, which labels new RNA with 4sU and 5-EU, so that new and old RNA can be distinguished. However, this method cannot retain the spatial distribution information of RNA, and the experimental steps are often complicated; (4) Spatiotemporal transcriptome analysis technology combined with metabolic labeling and in situ sequencing, which tracks the dynamic changes of RNA by labeling and in situ sequencing newly generated RNA, but this method has low mRNA detection efficiency.

[0006] Therefore, there is still a lack of high-sensitivity, high-accuracy, and high-throughput single-cell transcriptome analysis methods with spatiotemporal resolution. The development of such technologies is of great significance for a deep understanding of the dynamic changes of cell states and the spatial distribution of cell functions, and will provide a powerful tool for cell biology research and disease diagnosis. Summary of the invention

[0007] The purpose of the present invention is to overcome the defects of the prior art and provide a method for detecting single-cell transcriptome with spatiotemporal resolution.

[0008] The technical solution of the present invention is as follows:

[0009] A method for detecting single-cell transcriptome with spatiotemporal resolution comprises the following steps: Figure 1 As shown:

[0010] (1) Metabolically labeling adherent cells with 5-ethynyluridine, followed by fixation, permeabilization, and washing of the cells;

[0011] (2) using a DNA probe Probe B having a modification group at the 5' end that can covalently bind to 5-ethynyl uridine to perform a click chemistry reaction with the 5-ethynyl uridine in the cells treated in step (1);

[0012] (3) adding at least one DNA probe Probe A to the reaction product obtained in step (2) to complement the mRNA of the target gene;

[0013] (4) adding at least one circular DNA probe Circle 1 and one circular DNA probe Circle 2 to the reaction product obtained in step (3) for complementary pairing, wherein the at least one circular DNA probe Circle 1 has a specific code and a 5' end modified with a phosphate group, and the 5' end of the circular DNA probe Circle 2 has a phosphate group modified, and both the at least one circular DNA probe Circle 1 and the circular DNA probe Circle 2 can complementarily pair with the DNA probe Probe B and the at least one DNA probe Probe A;

[0014] (5) adding DNA ligase to the reaction product obtained in step (4) to perform circular ligation;

[0015] (6) adding DNA polymerase and dNTPs to the reaction product obtained in step (5) to perform a rolling circle amplification reaction;

[0016] (7) Adding an imaging detection probe to the reaction product obtained in step (6), performing in situ hybridization, and then performing imaging detection.

[0017] In a preferred embodiment of the present invention, the 5' end of the DNA probe Probe A has a first specific coding sequence NNNNTGAGTTGAGTNNNN (SEQ ID NO.54) with a length of 18 nt, wherein NN=AG, GA or TC, and the 3' end of the DNA probe Probe A has a sequence with a length of 20 nt that is complementary to the mRNA of the target gene.

[0018] Further preferably, the 5' end of the circular DNA probe Circle 1 has a second specific coding sequence NNNNACTCAACTCANNNN (SEQ ID NO.55) with a length of 18 nt, wherein NN=AG, GA or TC, and the second specific coding sequence is complementary to the corresponding first specific coding sequence.

[0019] More preferably, the modification group capable of covalently bonding with 5-ethynyl uridine is an azide group.

[0020] More preferably, the DNA ligase is T4 DNA ligase.

[0021] More preferably, the DNA polymerase is phi29 DNA polymerase.

[0022] More preferably, the modification group capable of covalently bonding with 5-ethynyl uridine is an azide group; the DNA ligase is T4 DNA ligase; and the DNA polymerase is phi29 DNA polymerase.

[0023] The beneficial effects of the present invention are:

[0024] 1. The present invention aims to address the challenges in single-cell transcriptome analysis, especially the difficulties in retaining the spatial information of newly synthesized RNA and improving detection efficiency and sensitivity. Based on metabolic labeling, proximity rolling circle amplification technology (PLA-RCA) and in situ fluorescence sequencing technology, it can analyze the dynamic change information of single cells from two dimensions of time and space, and thus reveal the relationship between disease occurrence, cell differentiation and functional response.

[0025] 2. If Figure 1 As shown in the figure, the present invention first uses metabolic labeling technology to specifically label the newly generated RNA in cells within a specific time to ensure that the newly synthesized RNA molecules can be accurately identified and tracked; then, the in situ specific signal amplification of the new RNA target is achieved through the proximity rolling circle amplification technology (PLA-RCA), thereby improving the detection efficiency and accuracy of the new RNA; finally, the in situ fluorescence sequencing technology is used to achieve high-throughput target analysis of the new RNA (the maximum number of targets is 3 4=81 species), a step that enables precise spatiotemporal localization and quantification of newly generated RNA within single cells.

[0026] 3. Through the present invention, not only the spatial information of newly generated RNA within a specific time can be preserved, but also complex biological processes such as cell differentiation, disease occurrence, and cell functional response can be analyzed; it is also of great significance for revealing the molecular mechanisms in cell biological processes, and provides new perspectives and tools for disease diagnosis and treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a schematic diagram of the principle of spatiotemporal resolution single-cell transcriptome detection in the present invention.

[0028] Figure 2 The metabolic marker 5-EU in Example 1 of the present invention is shown to visualize nascent RNA.

[0029] Figure 3 The in situ amplification detection of nascent mRNA in Example 2 of the present invention is shown.

[0030] Figure 4 This shows the detection efficiency of nascent mRNA in Example 3 of the present invention.

[0031] Figure 5 Shown is a pulse-chase experiment of nascent mRNA in the present invention.

[0032] Figure 6 Shown is the fluorescent in situ sequencing of three-target nascent mRNAs in the present invention.

[0033] Figure 7 The present invention is compared with the traditional RNA in situ detection method. DETAILED DESCRIPTION

[0034] The technical solution of the present invention is further illustrated and described below through specific implementation modes in combination with the accompanying drawings.

[0035] Example 1 Labeling and Characterization of Nascent RNA

[0036] In this embodiment, the glass slide is specially treated, and the surface is positively charged, which makes it easier for cells to adhere to culture and can be directly used for laser confocal microscopy imaging detection. Therefore, the adhered glass slide is selected as the carrier for model cell growth and subsequent experiments. First, cells are cultured on the adhered glass slide, and the newly generated RNA is generated and captured in situ within a specific time by the metabolic labeling method, which specifically includes the following steps (principle as shown in FIG. Figure 2 A):

[0037] (1) Spray 75% ethanol on the surface of the adhesive slide, place it in a culture dish, and irradiate it under ultraviolet light for 0.5 h;

[0038] (2) Digest the cells with trypsin, add the cell suspension to the surface of the slide, add complete medium to the culture dish and culture for 24 h, waiting for the cells to adhere and grow to a density of 80% to 90%;

[0039] (3) 5-EU metabolic labeling: Add complete medium containing 200 μM 5-ethynyluridine (5-EU) and metabolically label for 16 h; at the same time, culture the same cells with complete medium without 5-EU as a control;

[0040] (4) Remove the original culture medium and wash twice with DEPC-PBS, 5 min each time;

[0041] (5) Fix with 1.6% paraformaldehyde solution for 10 min, remove and wash twice with DEPC-PBS, 5 min each time;

[0042] (6) Add methanol stored at -20°C and permeabilize at -80°C for 30 min. Remove the slide and equilibrate to room temperature in a clean bench.

[0043] (7) Select an area with uniform cell growth and use an immunohistochemical pen to draw a circular area with a diameter of about 1 cm. After the histochemical solution is air-dried, add 0.1M HCl to form spherical droplets and permeabilize for 5 minutes. After the droplets are removed, add DEPC-PBST and wash three times, each time for 5 minutes;

[0044] (8) Click: Add the probe Probe B (as shown in SEQ ID NO.01, 5'N3-aaaaaaaaaaaaagcgcgagacactctt-FAM) with an azide group at the 5' end that can covalently bind to 5-EU to cause a click chemistry reaction at 37°C for 0.5 h;

[0045] (9) Wash with DEPC-PBST three times, 5 min each time, to remove unreacted probe B;

[0046] (10) Imaging: Imaging was performed using a laser confocal microscope.

[0047] like Figure 2 B and Figure 2 As shown in Figure C, the fluorescence signal of the positive group cells with 5-EU added is stronger, and the control group without 5-EU has almost no fluorescence signal. The above results show that the present invention can successfully capture the newly generated RNA within a specific time based on metabolic labeling technology.

[0048] Example 2 In situ amplification detection of nascent mRNA

[0049] In this example, the β-actin gene (ACTB) highly expressed in the human cervical cancer cell line HeLa was used as the research object. In order to verify the specificity of the present invention in detecting nascent RNA, this example set up four groups of control experiments, and performed in situ amplification detection of nascent RNA at the same time as the experimental group, such as Figure 3 As shown in A. From left to right, Probe A, Probe B, Circle 1 and Circle 2 were all added (experimental group), without Probe A (control group 1), without Probe B (control group 2), without Circle 1 and Circle 2 (control group 3), and without 5-EU marker during culture (control group 4).

[0050] The probe sequences involved in this embodiment are shown in Table 1 below:

[0051] Table 1

[0052] name Sequence 5'-3' SEQ ID NO.01 Probe B <![CDATA[N3-aaaaaaaaaaaagcgcgagacactctt]]> SEQ ID NO.02 ACTB-probeA1 gacgctaatagcgattaaaaaaaaaacagggatagcacagcctgga SEQ ID NO.03 ACTB-probeA2 gacgctaatagcgattaaaaaaaaaaatggtgagctggcggcgggt SEQ ID NO.04 ACTB-probeA3 gacgctaatagcgattaaaaaaaaaacatcacgccctggtgcctgg SEQ ID NO.05 ACTB-probeA4 gacgctaatagcgattaaaaaaaaaaaggtgtggtgccagattttct SEQ ID NO.06 ACTB-probeA5 gacgctaatagcgattaaaaaaaaaaaggtcccggccagccaggtcc SEQ ID NO.07 ACTB-probeA6 gacgctaatagcgattaaaaaaaaaaagccgtggccatctcttgctc SEQ ID NO.08 Circle 1 P-attagcgtccagtgaatgcgagtcctcaatgctgctgctgtactacgccgtcaagagtgtc SEQ ID NO.09 Circle 2 P-tcgcgcttggtataatcgct SEQ ID NO.10 C1-FISH-Cy5 Cy5-CCTCAATGCTGCTGCTGTACTAC

[0053] The 5' modified phosphate group P in Circle 1 forms a phosphodiester bond with Circle 2 in "Ligation".

[0054] The 5' modified phosphate group P in Circle 2 forms a phosphodiester bond with Circle 1 in "Ligation".

[0055] The 5' modified fluorescent group Cy5 in C1-FISH-Cy5 is complementary to the repetitive nucleotide sequence (...gtagtacagcagcagcattgagg...) in the rolling circle amplification product (RCP) in "FISH".

[0056] Addition of Probe A means equimolar addition of ACTB-probes A1 to A6.

[0057] In each of the above groups: the final concentration of each probe added is as follows according to the reaction order:

[0058] Probe B:2μM

[0059] Probe A:0.1μM

[0060] Circle 1: 0.1 μM

[0061] Circle 2: 0.1 μM

[0062] C1-FISH-Cy5: 0.1 μM.

[0063] The specific steps are as follows:

[0064] (1) Complete cell culture, metabolic labeling, fixation, permeabilization and washing according to steps (1) to (7) in Example 1;

[0065] (2) Click: Except for control group 2, the other four groups were added with probe B with an azide group at the 5' end that can covalently link with 5-EU, and a click chemistry reaction was carried out at 37°C for 0.5 h; DEPC-H2O equal to that of probe B was added to control group 2;

[0066] (3) After the reaction, all five groups were washed three times with DEPC-PBST, each time for 5 min, to remove the unreacted probe Probe B;

[0067] (4) Probe A Hybridization: Except for Control Group 1, the other four groups were added with Probe A complementary to the specific region of ACTB gene mRNA and reacted at 37°C for 2 h; Control Group 1 was added with DEPC-H2O in an amount equal to that of Probe A;

[0068] (5) After the reaction, all five groups were washed three times with DEPC-PBST, each time for 5 min, to remove the unreacted probe Probe A;

[0069] (6) Circles Hybridization: Except for control group 3, two circular probes Circle 1 and Circle 2 that complement the specific regions of probes Probe A and Probe B were added to the other four groups and reacted at 37°C for 1 h; DEPC-H2O was added to control group 3 in an equal amount as that of circular probes Circle 1 and Circle 2;

[0070] (7) After the reaction, all five groups were washed three times with DEPC-PBST, each time for 5 min, to remove the unreacted circular probes Circle 1 and Circle 2;

[0071] (8) Ligation: T4 DNA ligase was added to all five groups to ligate the two ends of the circular probe into a circle and react at 37°C for 0.5 h;

[0072] (9) After the reaction, all five groups were washed three times with DEPC-PBST, each time for 5 min, to remove unreacted T4 DNA ligase;

[0073] (10) RCA: phi29 DNA polymerase and dNTPs were added to all five groups for rolling circle amplification reaction at 37°C for 2 h;

[0074] (11) After the reaction, all five groups were washed three times with DEPC-PBST, each time for 5 min, to remove unreacted phi29 DNA polymerase and dNTPs;

[0075] (12) FISH: Fluorescent probe C1-FISH-Cy5 was added to all five groups for in situ fluorescent hybridization reaction and incubated at room temperature for 0.5 h;

[0076] (13) Imaging: Imaging was performed using a laser confocal microscope.

[0077] The experimental results are as follows Figure 3 As shown, only the experimental group had obvious fluorescence signals, while the four control groups had no obvious fluorescence signals, proving that only when all four probes and 5-EU were added, the in situ amplification signal of the nascent RNA could be detected, indicating that the present invention has good specificity.

[0078] Example 3 Characterization of nascent mRNA detection sensitivity and detection efficiency

[0079] With reference to Example 2, in order to characterize the detection efficiency of the present invention for nascent RNA, this example constructs a plasmid vector outside the cell and introduces non-natural bioluminescent enzyme genes in the HeLa cell line: Enhanced Green Fluorescent Protein (EGFP) and Luciferase (Luc) are exogenous genes. The "detection efficiency (Efficiency)" in this example is defined as "detection efficiency (Efficiency) = nascent RNA / total RNA", where "nascent RNA" refers to the average number of EU-mRNAs produced by metabolic labeling of a gene within a specific time, and "total RNA" refers to the average number of mRNAs produced by normal DNA transcription of a gene within the same time as above. The dimension of "average number" is "RCPs / cell", that is, in the confocal microscope imaging results, the average number of signal points in each cell. This example sets up two experimental groups: detecting the nascent RNA of the EGFP gene (experimental group 1) and detecting the total RNA of the Luc gene (experimental group 2), corresponding to "nascent RNA" and "total RNA" respectively. Compared with genes naturally existing in normal HeLa cell lines (such as ACTB), there is no "old mRNA" for the two genes EGFP and Luc in the HeLa cell line, so the "detection efficiency" in this example has accurate biological significance.

[0080] The probe sequences involved in this embodiment are shown in Table 2 below:

[0081] Table 2

[0082]

[0083]

[0084] The 5' modified phosphate group P in Circle 1 forms a phosphodiester bond with Circle 2 in "Ligation".

[0085] The 5' modified phosphate group P in Circle 2 forms a phosphodiester bond with Circle 1 in "Ligation".

[0086] The 5' modified fluorescent group Cy5 in C1-FISH-Cy5 is complementary to the repetitive nucleotide sequence (...gtagtacagcagcagcattgagg...) in the rolling circle amplification product (RCP) in "FISH".

[0087] Addition of Probe A means equimolar addition of probes A1 to A6.

[0088] In each of the above groups: the final concentration of each probe added is as follows according to the reaction order:

[0089] Probe B:2μM

[0090] Probe A:0.1μM

[0091] Circle 1: 0.1 μM

[0092] Circle 2: 0.1 μM

[0093] C1-FISH-Cy5: 0.1 μM.

[0094] The specific steps include the following (such as Figure 4 A):

[0095] (1) constructing a plasmid DNA vector containing deoxyribonucleotide sequences corresponding to the EGFP and Luc genes;

[0096] (2) Prepare DMEM medium containing plasmid DNA and DMEM medium containing liposome Lipofectamine 2000 (Lipo2000) in 1.5 mL EP tubes, mix gently, and let stand for 5 min;

[0097] (3) Mix the DMEM medium containing plasmid DNA and the DMEM medium containing liposome Lipofectamine 2000 (Lipo2000), and then add 14.5 mL of antibiotic-free DMEM medium to prepare 15 mL of transfection medium;

[0098] (4) After the HeLa cells were cultured on the adhesive slide and were in an adherent state, the original culture medium of the HeLa cells was removed and the cells were washed twice with DEPC-PBS, each time for 5 min;

[0099] (5) Transfection: Pour 15 mL of the prepared transfection medium and culture for 48 h;

[0100] (6) Remove the original culture medium and wash twice with DEPC-PBS, 5 min each time;

[0101] (7) 5-EU metabolic labeling: Add DMEM medium containing 200 μM 5-ethynyl uridine (5-EU) and 1 μg / mL Doxorubicin (DOX) and metabolic labeling for 16 h;

[0102] (8) Follow steps (4) to (7) in Example 1 to complete fixation, permeabilization and washing;

[0103] (9) Click: Probe B with an azide group at the 5' end that can covalently bind to 5-EU was added to experimental group 1 to undergo a click chemistry reaction at 37°C for 0.5 h; DEPC-H2O equal to that of probe B was added to experimental group 2;

[0104] (10) After the reaction, both groups were washed three times with DEPC-PBST, each time for 5 min, to remove the unreacted probe Probe B;

[0105] (11) Probe A Hybridization: Probe A complementary to the specific regions of EGFP gene mRNA and Luc gene mRNA was added to experimental group 1 and experimental group 2, respectively, and reacted at 37°C for 2 h;

[0106] (12) After the reaction, both groups were washed three times with DEPC-PBST, each time for 5 min, to remove the unreacted probe Probe A;

[0107] (13) Circle Hybridization: Two circular probes Circle 1 and Circle 2 that are complementary to the specific regions of Probe A and Probe B were added to both Experimental Group 1 and Experimental Group 2, and the reaction was carried out at 37°C for 1 h.

[0108] (14) After the reaction, both groups were washed three times with DEPC-PBST for 5 min each time to remove the unreacted circular probes Circle 1 and Circle 2;

[0109] (15) Ligation: T4 DNA ligase was added to both experimental groups 1 and 2 to ligate the two ends of the circular probe into a circle, and the reaction was carried out at 37°C for 0.5 h;

[0110] (16) After the reaction, both groups were washed three times with DEPC-PBST for 5 min each time to remove unreacted T4 DNA ligase;

[0111] (17) RCA: phi29 DNA polymerase and dNTPs were added to both experimental groups 1 and 2 for rolling circle amplification at 37°C for 2 h;

[0112] (18) After the reaction, both groups were washed three times with DEPC-PBST for 5 min each time to remove unreacted phi29 DNA polymerase and dNTPs;

[0113] (19) FISH: Fluorescent probes were added to experimental groups 1 and 2 for in situ fluorescent hybridization reaction and incubated at room temperature for 0.5 h;

[0114] (20) Imaging: Imaging was performed using a laser confocal microscope.

[0115] The imaging results are as follows Figure 4 As shown in B, there are obvious fluorescence signals in both experimental groups 1 and 2. Figure 4 As shown in Figure C, in this embodiment, the fluorescence signal points in each cell are counted by Cellprofiler software, and the nascent RNA fluorescence signal is about 58.2RCPs / cell, the overall RNA fluorescence signal is about 94.0RCPs / cell, and the nascent RNA detection efficiency of the present invention is about 62%.

[0116] Example 4: Visualization of nascent RNA spatial information

[0117] Referring to the steps of Example 2 and Example 3, in order to study the spatiotemporal resolution information of the nascent RNA, this example uses a "pulse chase" experiment to visualize the spatial distribution of the nascent RNA. Figure 5 As shown in A, nascent RNA is generated by metabolic labeling within 1 h (pulse process), and then the nascent RNA is imaged by laser confocal microscopy at different tracking times after 2 h, 4 h, 6 h, and 8 h of tracking process.

[0118] The imaging results are as follows Figure 5 As shown in B, the fluorescent signal points of the newly generated RNA are obvious, and as the tracking time increases, the distribution area of ​​the newly generated RNA gradually shifts from the nucleus to the cytoplasm, which is consistent with the expected life trajectory of RNA ( Figure 5 C) The above results show that the present invention can perform in situ imaging research on nascent RNA with spatiotemporal resolution.

[0119] Example 5 Triple-target detection and co-analysis of nascent RNA

[0120] Referring to the steps of Example 2 and Example 3, in this example, the human cervical cancer cell line HeLa is used as a model, and three genes, cyclin F (CCNF), E2F transcription factor (E2F2) and thymopoietin (TMPO), are detected. Specific probe sets are designed for the three genes through a multi-round combination encoding strategy, and four rounds of fluorescence in situ sequencing are performed. Each round is imaged using a laser confocal microscope, and the four rounds of imaging results are aligned, identified and decoded to obtain the nascent RNA fluorescence signals corresponding to the three gene targets. The results are shown in FIG. Figure 6 A and Figure 6 As shown in B, the nascent RNA fluorescence signal points of the three genes can be detected in each round of imaging, and the nascent RNA fluorescence signal points of each gene can be counted through bioinformatics multi-round fluorescence in situ sequencing analysis software.

[0121] The probe sequences involved in this embodiment are shown in Table 3 below:

[0122] Table 3

[0123]

[0124]

[0125] The 5' modified phosphate group P in Circle 1 forms a phosphodiester bond with Circle 2 in "Ligation".

[0126] The 5' modified phosphate group P in Circle 2 forms a phosphodiester bond with Circle 1 in "Ligation".

[0127] The 5' modified fluorescent group Cy5 in C1-FISH-Cy5 is complementary to the repetitive nucleotide sequence (...gtagtacagcagcagcattgagg...) in the rolling circle amplification product (RCP) in "FISH".

[0128] Addition of Probe A means equimolar addition of probes A1 to A6.

[0129] In each of the above groups: the final concentration of each probe added is as follows according to the reaction order:

[0130] Probe B:2μM

[0131] Probe A:0.1μM

[0132] Circle 1: 0.1 μM

[0133] Circle 2: 0.1 μM

[0134] C1-FISH-Cy5: 0.1 μM.

[0135] Example 6 Comparison with traditional RNA in situ detection methods

[0136] In this example, the β-actin gene (ACTB) highly expressed in the human cervical cancer cell line HeLa is used as the research object. In this example, the ACTB gene transcripts in the same batch of HeLa cells cultured under the same conditions are detected by conventional fluorescence in situ hybridization detection method and the method in Example 2 of the present invention, wherein the conventional fluorescence in situ hybridization detection uses double ligated probes (DLPs, composed of two sequences of left (L) and right (R), and a primer probe Primer, wherein the Primer is used to anchor the DLPs at the upper end and initiate the RCA reaction; in this example, for the ACTB gene, 3 segments of the targeting ACTB mRNA sequence region are selected) and padlock probes (Padlock, composed of a sequence, that is, the "L, R" sequence gaps in the "double ligated probe" are connected together, wherein the primer probe Primer is used to anchor the DLPs at the upper end and initiate the RCA reaction; in this example, for the ACTB gene, 3 segments of the targeting ACTB mRNA sequence region are selected).

[0137] The two comparative probes and the probe of Example 2 of the present invention were first hybridized with the target mRNA to form a circular structure under DNA ligase, and then RCA was performed. Finally, in situ hybridization detection was performed using a probe with a Cyanine5 (Cy5) fluorescent group.

[0138] The three probe structures and imaging results are shown in Figure 2. Figure 7 As shown in A, in this example, the fluorescence signal points in each cell were counted by Cellprofiler software. The results showed that the in situ detection ability of the present invention for mRNA is about 10 times that of DLP and PP probes ( Figure 7 B). The above results show that the present invention has higher sensitivity.

[0139] Other probes involved in this embodiment are shown in Table 4 below:

[0140] name Sequence 5'-3' SEQ ID NO.44 ACTB-L1 cgctaatagtcgataaaaaaaaaaacagggatagcacagcctgga SEQ ID NO.45 ACTB-R1 gtggtacggccagaggcgtaaaaaaaaaaatggctactacactctt SEQ ID NO.46 ACTB-L2 cgctaatagtcgataaaaaaaaaaaatggtgagctggcggcgggt SEQ ID NO.47 ACTB-R2 gcgcggcgatatcatcatccaaaaaaaaaatggctactacactctt SEQ ID NO.48 ACTB-L3 cgctaatagtcgataaaaaaaaaaacatcacgccctggtgcctgg SEQ ID NO.49 ACTB-R3 tccttctgacccatgcccacaaaaaaaaaatggctactacactctt SEQ ID NO.50 ACTB-PP1 cagggatagcacagcctggattcactcagaagtgcgtctatttagtggagccagctactcacttgtggtacggccagaggcgta SEQ ID NO.51 ACTB-PP2 atggtgagctggcggcgggtttcactcagaagtgcgtctatttagtggagccagctactcacttgcgcggcgatatcatcatcc SEQ ID NO.52 ACTB-PP3 catcacgccctggtgcctggttcactcagaagtgcgtctatttagtggagccagctactcactttccttctgacccatgcccac SEQ ID NO.53 Primer ggctccactaaatagacgca

[0141] The above description is only a preferred embodiment of the present invention, and therefore cannot be used to limit the scope of the present invention. That is, equivalent changes and modifications made according to the patent scope of the present invention and the contents of the specification should still fall within the scope of the present invention.

Claims

1. A method for detecting single-cell transcriptome with spatiotemporal resolution, characterized in that: The steps include: (1) Metabolically labeling adherent cells with 5-ethynyluridine, followed by fixation, permeabilization, and washing of the cells; (2) using a DNA probe Probe B having a modification group at the 5' end that can covalently bind to 5-ethynyl uridine to perform a click chemistry reaction with the 5-ethynyl uridine in the cells treated in step (1); (3) adding at least one DNA probe Probe A to the reaction product obtained in step (2) to complement the mRNA of the target gene; (4) adding at least one circular DNA probe Circle 1 and one circular DNA probe Circle 2 to the reaction product obtained in step (3) for complementary pairing, wherein the at least one circular DNA probe Circle 1 has a specific code and a 5' end modified with a phosphate group, and the 5' end of the circular DNA probe Circle 2 has a phosphate group modified, and both the at least one circular DNA probe Circle 1 and the circular DNA probe Circle 2 can complementarily pair with the DNA probe Probe B and the at least one DNA probe Probe A; (5) adding DNA ligase to the reaction product obtained in step (4) to perform circular ligation; (6) adding DNA polymerase and dNTPs to the reaction product obtained in step (5) to perform a rolling circle amplification reaction; (7) Adding an imaging detection probe to the reaction product obtained in step (6), performing in situ hybridization, and then performing imaging detection.

2. A method for detecting single-cell transcriptome with spatiotemporal resolution according to claim 1, characterized in that: The 5' end of the DNA probe Probe A has a first specific coding sequence NNNNTGAGTTGAGTNNNN with a length of 18 nt, wherein NN=AG, GA or TC, and the 3' end of the DNA probe Probe A has a sequence with a length of 20 nt that is complementary to the mRNA of the target gene.

3. A method for detecting single-cell transcriptome with spatiotemporal resolution as claimed in claim 2, characterized in that: The 5' end of the circular DNA probe Circle 1 has a second specific coding sequence NNNNACTCAACTCANNNN with a length of 18 nt, wherein NN=AG, GA or TC, and the second specific coding sequence is complementary to the corresponding first specific coding sequence.

4. A method for detecting single-cell transcriptome with spatiotemporal resolution according to any one of claims 1 to 3, characterized in that: The modification group capable of covalently bonding with 5-ethynyl uridine is an azide group.

5. A method for detecting single-cell transcriptome with spatiotemporal resolution according to any one of claims 1 to 3, characterized in that: The DNA ligase is T4 DNA ligase.

6. A method for detecting single-cell transcriptome with spatiotemporal resolution according to any one of claims 1 to 3, characterized in that: The DNA polymerase is phi29 DNA polymerase.

7. A method for detecting single-cell transcriptome with spatiotemporal resolution according to any one of claims 1 to 3, characterized in that: The modification group capable of covalently bonding with 5-ethynyl uridine is an azide group; the DNA ligase is T4 DNA ligase; and the DNA polymerase is phi29 DNA polymerase.

Images