Application of recombinant protein in preparation of snakehead vesicular virus vaccine

Abstract

The invention belongs to the technical field of biological medicine, and discloses an application of recombinant protein in preparation of a snakehead vesicular virus vaccine. A G protein of a snakehead vesicular virus (SHVV) is taken as an antigen for the vaccine, recombinant escherichia coli BL21 (pET32a-G) capable of expressing the protein is constructed by utilizing a genetic engineering technical means, recombinant protein rG is obtained through induced expression, and the nano-carrier vaccine (BNC-rG vaccine) of the snakehead vesicular virus is prepared by taking bacterial nano-cellulose as a carrier. According to the BNC-rG vaccine provided by the invention, immune protection against SHVV can be realized through immersion immunization, the specific antibody level is remarkably improved, the relative protection rate of snakehead reaches 80.00% after snakehead is infected with SHVV after immersion immunization for 4 weeks, and the immune protection effect is remarkable.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine and relates to the application of a recombinant protein in the preparation of a Channa argus vesicular virus vaccine. Background Art

[0002] Channa argus Channa argus ) belongs to the order Perciformes and the family Channaidae. It is a freshwater fish native to East Asia. It is widely cultured in various water systems because of its low oxygen tolerance, strong adaptability and rapid growth. In recent years, with the continuous improvement of the intensive farming level of black snakehead, the farming scale and density have gradually expanded, and various diseases of black snakehead have occurred frequently. Among them, the vesicular virus disease caused by the black snakehead vesiculovirus (SHVV) has caused huge economic losses to the black snakehead farming industry and seriously endangered the healthy development of the black snakehead farming industry. Vaccines have gradually replaced antibiotics and chemical drugs because of their safety, high efficiency and no residue, and have become the main means of fish disease prevention and control, and have received extensive attention and research.

[0003] Glycoprotein (G protein) is the only transmembrane protein in the Channa argus vesicular virus. It is located on the envelope of the virus surface and is a trimeric protrusion, accounting for about 40% of the entire virus surface. It is a ligand for the virus to bind to the host cell and can mediate the endocytosis of the virus. In addition, G protein plays a vital role in opening the viral shell and releasing nucleic acids into the host cell. As the main protein that determines the virulence of the virus and the main protective antigen with antigenic determinants, G protein can stimulate the body to produce specific antibodies and help the body resist viral infection.

[0004] Since the glycoprotein of SHVV is the main structural protein with antigenic determinants and determines the virulence of the virus, it has good immunogenicity. As an alternative antigen for SHVV vaccine, it is expected to play an active role in the prevention and treatment of the virus. However, there is still a lack of efficient and mature SHVV prevention and treatment vaccines, and the chrysalis aquaculture industry is still facing the dilemma of SHVV. Summary of the invention

[0005] In order to achieve effective prevention and control of Channa argus vesicular virus (SHVV), reduce the economic losses caused by it to Channa argus farming, and promote the healthy development of aquaculture, the present invention aims to provide a nanocarrier soaked vaccine for SHVV. The present invention uses bacterial nanocellulose (BNC) as a vaccine carrier, connects the carboxylated BNC with the recombinant protein rG through a chemical connection reaction, constructs a nanocarrier vaccine (i.e., BNC-rG vaccine), and inoculates Channa argus with the BNC-rG vaccine by soaking. The present invention confirms that the BNC-rG vaccine can significantly increase the level of specific antibodies, and significantly reduce the viral load and mortality of Channa argus after infection with SHVV, and has a good immune protection effect on Channa argus infected with SHVV. In order to achieve this technical purpose, the present invention provides the following detailed technical scheme.

[0006] First, the present invention provides an application of a recombinant protein rG. Specifically, the recombinant protein rG is used as an active ingredient to prepare a Channa argus vesicular virus vaccine for preventing and treating Channa argus vesicular virus disease; the amino acid sequence of the recombinant protein rG is shown in SEQ ID NO:1, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO:2.

[0007] Based on the above application, the second aspect of the present invention provides a Channa argus vesicular virus vaccine, wherein the active ingredient of the Channa argus vesicular virus vaccine is the above recombinant protein rG.

[0008] Furthermore, the components of the Channa argus vesicular virus vaccine also include a carrier, and the carrier is carboxylated bacterial nanocellulose.

[0009] Furthermore, the Channa argus vesicular virus vaccine is administered by immersion inoculation, and the concentration of the vaccine administered by immersion inoculation is not less than 20 mg / L.

[0010] In a third aspect, the present invention provides a method for preparing the Channa argus vesicular virus vaccine, comprising: pretreatment of bacterial nanocellulose and preparation of its resuspension; obtaining recombinant protein rG and preparation of its resuspension; and preparation of BNC-rG vaccine.

[0011] Furthermore, in the above preparation method, the pretreatment method of bacterial nanocellulose is as follows: 100 g of wet bacterial nanocellulose is mixed with 30 mg of TEMPO, 200 mg of sodium bromide and 5 mL of sodium hypochlorite, stirred at room temperature for 12 hours, during which the pH is controlled at 10.5, and 5 mL of anhydrous ethanol is added to terminate the reaction; the reaction solution is filtered with distilled water to a pH of ≤ 8, 20 mL of 70% concentrated sulfuric acid is mixed with the filtered bacterial nanocellulose, heated and stirred at 50°C for 2 hours, and then 100 mL of distilled water is added to terminate the reaction, dialyzed and freeze-dried to obtain carboxylated bacterial nanocellulose with a size of 200~300 nm.

[0012] Furthermore, in the above preparation method, the preparation method of the bacterial nanocellulose resuspension is: 0.5 g of carboxylated bacterial nanocellulose is mixed with 30 mg of ethyldimethylaminopropylcarbodiimide (EDAC) and 60 mg of N-carbonylsuccinimidyl (NHS), stirred at room temperature for 4 h in 100 mL of 2-(N-morpholine)ethanesulfonic acid (MES) buffer at pH = 6.0, and 10 μL of mercaptoethanol is added to terminate the reaction to obtain a bacterial nanocellulose resuspension.

[0013] Furthermore, in the above preparation method, the method for obtaining the recombinant protein rG is: constructing an expression vector containing a recombinant protein rG encoding gene, and transferring it into genetically engineered bacteria, and obtaining the recombinant protein rG by inducing expression; the nucleotide sequence of the recombinant protein rG encoding gene is shown in SEQ ID NO:2.

[0014] Furthermore, in the above preparation method, the preparation method of the recombinant protein rG resuspension is: resuspending 20 mg of the recombinant protein rG in 1 mL of phosphate buffer at pH = 7.2 to obtain a recombinant protein rG resuspension.

[0015] Furthermore, in the above preparation method, the preparation method of the BNC-rG vaccine is: respectively mix the bacterial nanocellulose resuspension and the recombinant protein rG resuspension in a volume ratio of 1:1, and stir at room temperature for 4 hours; dialyze with a dialysis bag with a molecular weight cutoff of 10,000 for 48 hours, and freeze-dry to obtain a solid powder, which is the BNC-rG vaccine.

[0016] Compared with the prior art, the invention "application of a recombinant protein in the preparation of a Channa argus vesicular virus vaccine" has the following beneficial effects: The present invention uses genetic engineering technology to construct an expression vector containing the G protein encoding gene of the Channa argus vesicular virus, and transfers it into genetic engineering bacteria for induced expression to obtain recombinant protein rG. The recombinant protein rG is used as an active ingredient, and carboxylated bacterial nanocellulose (BNC) is used as a carrier to prepare a vaccine for the prevention and treatment of the Channa argus vesicular virus (i.e., BNC-rG vaccine). After the BNC-rG vaccine is soaked and immunized to Channa argus for 28 days, it is infected with SHVV, and its relative protection rate (RPS) rate to Channa argus reaches 80%, with significant results. In addition, the BNC-rG vaccine provided by the present invention significantly improves the immunity level of Channa argus after soaking and immunization, and the specific antibody level of Channa argus serum reaches the highest at 28 days.

[0017] The BNC-rG vaccine constructed by the present invention can achieve the goal of large-scale, simple and rapid seedling immunization through immersion immunization, greatly improve the immersion immunization effect, and realize the industrialization of commercial fish vaccines represented by the black snakehead vesicular virus vaccine. It will also lay a theoretical foundation for the research and application of nanocarrier genetic engineering vaccines for other aquatic animals, provide new research ideas, and is of great significance to the sustainable development of fisheries and the safe production of aquatic products. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is the result of PCR and double enzyme digestion of the recombinant expression vector pET32a-G. Among them, M1: DL10000 DNAMarker; 1: double enzyme digestion result; 2: single enzyme digestion result; 3: G Gene PCR results; M2: DL2000 DNA Marker.

[0019] Figure 2 This is the SDS-PAGE result of recombinant protein rG. Lane M: protein marker; Lane 1: supernatant of empty cell centrifugation induced by IPTG; Lane 2: centrifugation precipitate of empty cell centrifugation induced by IPTG; Lane 3: supernatant of recombinant cell centrifugation without IPTG induction; Lane 4: centrifugation precipitate of recombinant cell centrifugation without IPTG induction; Lane 5: supernatant of recombinant cell centrifugation induced by IPTG; Lane 6: centrifugation precipitate of recombinant cell centrifugation induced by IPTG; Lane 7: recombinant protein rG after nickel column purification.

[0020] Figure 3 It is the specific antibody level in the serum of Channa argus 1 to 4 weeks after immersion immunization. Among them, 1w, 2w, 3w, and 4w are the 7th, 14th, 21st, and 28th days after immersion immunization, respectively.

[0021] Figure 4 is the SHVV viral load in spleen, body kidney, and head kidney tissues of each group.

[0022] Figure 5 The survival rate curves of each group are shown in Figure 2. DETAILED DESCRIPTION

[0023] The present invention is explained below in conjunction with the embodiments, and the technical solutions in the embodiments of the present invention are clearly and completely described. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0024] Example 1 This example provides the construction and identification of recombinant Escherichia coli BL21 (pET32a-G).

[0025] 1. Construction of recombinant E. coli BL21 (pET32a-G) expressing recombinant protein rG Total RNA was extracted from diseased Channa argus tissues and reverse transcribed into cDNA. According to the Channa argus vesicular virus (SHVV) provided by GenBank database, G Design corresponding primers based on gene sequence: GF: CATGCCATGGGCATGCCACTGTTTGTTCC (SEQ ID NO: 3); GR:CGAGCTCTTAGGGAACAAATTGATAC (SEQ ID NO: 4).

[0026] PCR amplification of SHVV G Gene, use gel recovery kit to recover the target fragment and connect it to pMD-19T vector to obtain recombinant plasmid pMD19T-G. Transform it into E. coli DH5α competent cells, spread it on LB solid medium containing ampicillin, and invert and culture it at 37℃ overnight. Then pick a single colony for G Colony PCR detection of the gene. The colonies with positive colony PCR were inoculated into LB culture medium containing kanamycin, and cultured at 37°C and 180 r / min for 12-16 hours, and then the recombinant plasmid pMD19T-G was extracted.

[0027] The recombinant plasmid pMD19T-G and pET-32a expression vector with correct sequencing were treated with double enzyme digestion (NcoI and SacI), and the target fragments were recovered using a gel recovery kit and connected using T4 DNA ligase to obtain the recombinant expression vector pET32a-G. It was transferred into Escherichia coli BL21 (DE3) competent cells, spread on LB solid medium containing ampicillin, and inverted at 37°C overnight. Then a single colony was picked for G Colony PCR detection of genes: Inoculate the colonies with positive colony PCR into LB culture medium containing kanamycin and culture at 37°C and 180r / min for 12-16h.

[0028] The plasmid was extracted according to the instructions of the Omega plasmid extraction kit, and PCR and double enzyme digestion were performed for identification. The PCR and double enzyme digestion products were taken for agarose gel electrophoresis identification, and the electrophoresis conditions were: 120V, 30min. Figure 1 It is the result of PCR and double enzyme digestion identification of the recombinant expression vector pET32a-G. Figure 1 The results showed that the PCR and double enzyme digestion results of the recombinant expression vector pET32a-G were correct.

[0029] 2. Recombinant E. coli BL21 (pET32a-G) induced expression of recombinant protein rG Use an inoculation loop to pick up a small amount of recombinant E. coli BL21 (pET32a-G) bacterial liquid, streak inoculate on LB solid medium plate, incubate at 37℃ for 12~16h, pick a single colony and inoculate it in LB liquid medium, incubate at 37℃, 180r / min for 12~16h as seed liquid, then inoculate it into LB medium at 1% (V / V), and add ampicillin to a final concentration of 50μg / mL. Incubate at 37℃ for 5~7h until the bacterial liquid OD 600 When the value was 1.1-1.3, IPTG was added to a final concentration of 0.001 mol / L, and the culture was induced at 37 °C for 6 h to terminate the fermentation.

[0030] 3. Isolation and purification of recombinant protein rG The fermentation product was centrifuged at 10000r / min at room temperature, the cells were collected, washed 3 times with PBS (0.01mol / L, pH=7.2), and the wet cells were collected. The cells were resuspended in a ratio of 10mL PBS buffer per 1g of wet cells and ultrasonically disrupted under ice bath conditions. The disrupted bacterial solution was centrifuged at 4℃ and 12000r / min, the bacterial protein was collected, and the bacterial protein was dissolved with 8M urea to obtain a mixed protein solution containing the recombinant protein rG.

[0031] Dissolve the protein precipitate in a ratio of 10 mL of dissolving solution for every 1 g of protein. Dissolution conditions: 200 r / min oscillation and dissolution at room temperature for 2 hours. Then centrifuge at 4°C and 10,000 r / min for 30 minutes, collect the supernatant, chelate the affinity chromatography column with the equilibrium buffer, load the sample at 2 times the column volume, balance it with the equilibrium buffer, and then elute it with the elution buffer to collect the protein solution. Place the purified 200 mL protein solution in a dialysis bag (SnakeSkin™) with a molecular weight cutoff (MWCO) of 10K, and immerse it completely in 10L of refolding solution, and dialyze it at 4°C for 12 hours. During this period, the refolding solution was replaced every 6 hours. After the dialysis, the dialyzed protein solution was collected and stored at 4°C for later use.

[0032] In the above steps, the dissolving solution includes: 5mmol / L imidazole, 0.5mmol / L sodium chloride, 8M urea, 20mmol / LTirs-HCl, pH=7.9.

[0033] The equilibration buffer solution includes: 5 mmol / L imidazole, 0.5 mmol / L sodium chloride, 8 M urea, 20 mmol / L Tirs-HCl, pH=7.9.

[0034] The elution buffer solution includes: 0.5 mol / L imidazole, 0.5 mmol / L sodium chloride, 8 M urea, 20 mmol / L Tirs-HCl, pH=7.9.

[0035] The refolding solution includes: 150mmol / L NaCl, 2.5mmol / L KCl, 10mmol / L Na2HPO4, 2mmol / LKH2PO4, 1% Tween-20, 10mmol / L β-cyclodextrin, 1mol / L L-cysteine, 3mmol / L reduced glutathione, 1mmol / L oxidized glutathione, pH=7.9.

[0036] 4. SDS-PAGE detection of recombinant protein rG The SDS-PAGE detection is divided into 7 lanes, which are as follows: Lane 1: supernatant of centrifugation of empty-loaded bacteria induced by IPTG; Lane 2: centrifugation precipitation of empty-vector bacteria induced by IPTG; Lane 3: supernatant of centrifugation of recombinant bacteria without IPTG induction; Lane 4: centrifugal precipitation of recombinant bacteria without IPTG induction; Lane 5: supernatant of centrifugation of recombinant bacteria induced by IPTG; Lane 6: centrifugal precipitation of recombinant bacteria induced by IPTG; Lane 7: recombinant protein rG after nickel column purification.

[0037] The concentration of acrylamide in the separation gel was 12%; Coomassie Brilliant Blue staining was used, and decolorization with decolorizing solution was performed until the bands were clear. Figure 2 As shown in the results of each group, IPTG induction significantly increased the expression of recombinant protein rG, and the recombinant protein rG was mainly present in the centrifugal precipitate after bacterial cell disruption ( Figure 2 6 lanes in the figure).

[0038] Example 2 This example provides the preparation of BNC-rG vaccine.

[0039] 1. Bacterial Nanocellulose (BNC) Pretreatment 100g of wet bacterial nanocellulose was mixed with 30mg of TEMPO, 200mg of sodium bromide and 5mL of sodium hypochlorite, stirred at room temperature for 12h, during which the pH was controlled at 10.5, and 5mL of anhydrous ethanol was added to terminate the reaction. The reaction solution was filtered with distilled water until the pH was ≤8, and the filtered bacterial nanocellulose was mixed with 20mL of 70% concentrated sulfuric acid, heated and stirred at 50°C for 2h, and then 100mL of distilled water was added to terminate the reaction, dialyzed and freeze-dried to obtain carboxylated bacterial nanocellulose with a size of 200~300nm.

[0040] 2. Preparation of Bacterial Nanocellulose Resuspension 0.5 g of carboxylated bacterial nanocellulose was mixed with 30 mg of EDAC and 60 mg of NHS, stirred in 100 mL of MES buffer at pH = 6.0 at room temperature for 4 h, and 10 μL of mercaptoethanol was added to terminate the reaction to obtain a bacterial nanocellulose resuspension.

[0041] 3. Obtaining recombinant protein rG See Example 1.

[0042] 4. Preparation of recombinant protein rG resuspension Resuspend 20 mg of the recombinant protein rG in 1 mL of phosphate buffer at pH 7.2 to obtain a resuspension of the recombinant protein rG.

[0043] 5. Preparation of BNC-rG Vaccine The bacterial nanocellulose resuspension obtained in step 2 and the recombinant protein rG resuspension obtained in step 4 were mixed in a volume ratio of 1:1 and stirred at room temperature for 4 hours; dialyzed for 48 hours using a dialysis bag with a molecular weight cutoff of 10,000, and freeze-dried to obtain a solid powder, which is the BNC-rG vaccine (stored at 4°C).

[0044] Example 3 This example provides an evaluation of the immune effect of the BNC-rG vaccine. The BNC-rG vaccine was immunized by immersion: 1 g of powdered BNC-rG vaccine was resuspended in 1 mL of PBS buffer with a pH of 7.2.

[0045] 1. Specific antibody level detection Healthy snakehead fish with a body length of 6.8±0.2cm and a body weight of 2.0±0.1g were selected and randomly divided into 4 groups (30 fish / group). They were immunized by immersion in PBS buffer, BNC resuspension, rG resuspension and BNC-rG vaccine, respectively. The immersion concentration was set to 20mg / L, and the immersion water volume was 2L. Continuous oxygenation was maintained during the period. After immersion for 8h, the snakehead fish were returned to the breeding pond for daily feeding.

[0046] Blood samples were collected from each group of Channa argus on days 7, 14, 21, and 28, and the collected blood was left to stand at room temperature for 2 hours and then placed in a refrigerator at 4°C overnight. The next day, the blood was centrifuged at 5000 g for 15 minutes in a low-temperature refrigerated centrifuge, and the upper serum was taken and stored at -20°C.

[0047] Enzyme-linked immunosorbent assay (ELISA) was used to detect the specific antibody level of serum. The specific operation was as follows: the collected serum was diluted with coating buffer at a ratio of 1:200, and then added to a 96-well plate, 100μL was added to each well (three replicates for each sample), and incubated at 4°C for 12h. Then 5% skim milk powder was added and incubated at 37°C for 2h. After the incubation, 100μL of rG diluted to 2μg / mL was added and incubated at 37°C for 1h. Mouse His-tag monoclonal antibody was selected as the primary antibody, and HRP-conjugated goat anti-mouse IgG was used as the secondary antibody, which was diluted at 1:2000 and 1:5000, respectively. After each incubation, it was washed 3 times with PBST, each time for 3min. Then 100μL of tetramethylbenzidine (TMB) colorimetric solution was added to each well and incubated at 37°C in the dark for 30min. Finally, 50 µL of 2 mol / L H2SO4 was added to terminate the reaction, and the OD value of the sample was measured at a wavelength of 450 nm using an enzyme reader.

[0048] Figure 3 The specific antibody level of serum 1 to 4 weeks after immersion immunization is the average of 3 tests and is expressed as mean ± standard error. Different letters represent significant differences ( p <0.05). Figure 3 The results showed that the BNC-rG immersion immunization group was significantly superior to the PBS buffer group, BNC resuspension group, and rG resuspension group, and the serum antibody level reached the highest on the 28th day.

[0049] 2. Detection of immune protection effect after artificial virus infection Four weeks after the above immunization, 20 fish were randomly selected from each group and injected with 100 μL of TCID 50 =10 -2.67 / mL of SHVV virus liquid, and the water temperature was maintained at about 28°C. 24 hours after injection infection, spleen, body kidney and head kidney tissues were collected, and SHVV virus load in spleen, body kidney and head kidney tissues was detected by RT-qPCR. In addition, the incidence and mortality of black snakehead were regularly observed and recorded for a total of 15 days. The survival rate curve was drawn according to the number of deaths, and the relative protection rate (Relative percent survival, RPS) of black snakehead in the experimental group was calculated by the following formula: .

[0050] Figure 4is the SHVV viral load in spleen, body kidney and head kidney tissues of each group. Figure 4 It can be seen that 24 hours after injection infection, the viral load in the spleen, body kidney and head kidney tissues of the BNC-rG group was significantly lower than that of the other three groups ( p <0.05). Figure 5 is the survival rate change curve of each group. Figure 5 It can be seen that 24 hours after injection, the survival rate of the BNC-rG group was the highest. After calculation, the relative protection rate of the BNC-rG group against SHVV infection was 80.00%.

[0051] In summary, the present invention uses the G protein of the Channa vesicular virus as a vaccine antigen, and uses genetic engineering technology to construct a recombinant Escherichia coli BL21 (pET32a-G) capable of expressing the protein, obtains the recombinant protein rG by inducing expression, and uses bacterial nanocellulose as a carrier to prepare a Channa vesicular virus vaccine (BNC-rG vaccine). The BNC-rG vaccine provided by the present invention can achieve immune protection against the Channa vesicular virus by soaking immunization, wherein the specific antibody level is significantly improved. After the Channa vesicular virus was infected with SHVV 4 weeks after soaking immunization, the relative protection rate of the Channa vesicular virus reached 80.00%, and the immune protection effect was significant.

[0052] The embodiments described above are only some embodiments of the present invention, not all embodiments. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention claimed for protection, but only represents selected embodiments of the present invention. All other embodiments obtained without creative work and related deductions and substitutions made by ordinary technicians in the field under the conditions of the concept of the present invention belong to the scope of protection of the present invention.

Claims

1. An application of a recombinant protein rG, characterized in that: The recombinant protein rG is used as an active ingredient to prepare a Channa argus vesicular virus vaccine for preventing and treating Channa argus vesicular virus disease; the amino acid sequence of the recombinant protein rG is shown in SEQ ID NO:

1.

2. A vaccine for Channa argus vesicular virus, characterized in that: The active ingredient of the Channa argus vesicular virus vaccine is the recombinant protein rG; the amino acid sequence of the recombinant protein rG is shown in SEQ ID NO:

1.

3. The Channa argus vesicular virus vaccine according to claim 2, characterized in that The components of the Channa argus vesicular virus vaccine also include a carrier, and the carrier is carboxylated bacterial nanocellulose.

4. The Channa argus vesicular virus vaccine according to claim 3, characterized in that The Channa argus vesicular virus vaccine is inoculated by immersion, and the concentration of the vaccine inoculated by immersion is not less than 20 mg / L.

5. The method for preparing the Channa argus vesicular virus vaccine according to claim 2, characterized in that: include: Pretreatment of bacterial nanocellulose and preparation of its resuspension; acquisition of recombinant protein rG and preparation of its resuspension; preparation of BNC-rG vaccine.

6. The preparation method according to claim 5, characterized in that: The pretreatment of bacterial nanocellulose includes: taking 100g of wet bacterial nanocellulose, mixing it with 30mg of TEMPO, 200mg of sodium bromide and 5mL of sodium hypochlorite, stirring at room temperature for 12h, controlling the pH at 10.5 during the period, and adding 5mL of anhydrous ethanol to terminate the reaction; filtering the reaction solution with distilled water until the pH is ≤8, mixing the filtered bacterial nanocellulose with 20mL of 70% concentrated sulfuric acid, heating and stirring at 50°C for 2h, and then adding 100mL of distilled water to terminate the reaction, dialyzing and freeze-drying to obtain carboxylated bacterial nanocellulose with a specification of 200~300nm.

7. The preparation method according to claim 6, characterized in that: The preparation of the bacterial nanocellulose resuspension includes: mixing 0.5 g of carboxylated bacterial nanocellulose with 30 mg of ethyldimethylaminopropylcarbodiimide and 60 mg of N-carbonylsuccinic acid imide, stirring at room temperature for 4 hours in 100 mL of 2-(N-morpholine)ethanesulfonic acid buffer at pH = 6.0, adding 10 μL of mercaptoethanol to terminate the reaction, and obtaining a bacterial nanocellulose resuspension.

8. The preparation method according to claim 7, characterized in that: The acquisition of recombinant protein rG includes: constructing an expression vector containing a recombinant protein rG encoding gene, transferring it into genetically engineered bacteria, and obtaining the recombinant protein rG by inducing expression; the nucleotide sequence of the recombinant protein rG encoding gene is shown in SEQ ID NO:

2.

9. The preparation method according to claim 8, characterized in that: The preparation of the recombinant protein rG resuspension includes: resuspending 20 mg of the recombinant protein rG in 1 mL of phosphate buffer at pH=7.2 to obtain a recombinant protein rG resuspension.

10. The preparation method according to claim 9, characterized in that: The preparation of the BNC-rG vaccine includes: mixing the bacterial nanocellulose resuspension and the recombinant protein rG resuspension in a volume ratio of 1:1, stirring at room temperature for 4 hours; dialyzing with a dialysis bag with a molecular weight cutoff of 10,000 for 48 hours, and freeze-drying to obtain a solid powder, which is the BNC-rG vaccine.

Images