Brevibacillus laterosporus and application thereof

Abstract

The invention discloses brevibacillus laterosporus and an application thereof. The brevibacillus laterosporus is named as brevibacillus laterosporus FBBJCG, and the brevibacillus laterosporus is characterized in that the brevibacillus laterosporus FBBJCG is preserved in the China General Microbiological Culture Collection Center (CGMCC), and the preservation number of the brevibacillus laterosporus FBBJCG is CGMCC No. 27712. The strain shows relatively strong bacteriostatic activity to pathogenic fungi, has a relatively wide bacteriostatic spectrum to fungi, can inhibit all detected fungi, and shows relatively strong bacteriostatic activity to pathogenic bacteria.

Description

Technical Field

[0001] The invention belongs to the field of microorganisms, and mainly relates to a Brevibacillus laterosporus strain with antibacterial effect and an application method thereof. Background Art

[0002] Bacillus, as a class of aerobic or facultative anaerobic bacteria, can not only form endospores to resist adverse conditions in adversity, but also secrete a variety of beneficial substances, providing powerful biological control effects. These bacteria are widely distributed in different habitats and are known for producing a variety of antagonistic compounds. 5% to 8% of their genome is dedicated to the biosynthesis of secondary metabolites. The most important bioactive molecules produced by Bacillus include non-ribosomally synthesized peptides and lipopeptides, polyketides, bacteriocins and siderophores, which have a wide range of antagonistic activities against plant pathogenic bacteria, fungi and viruses.

[0003] The control mechanism of Bacillus mainly involves several aspects: First, they can directly fight pathogens by producing antibiotics, enzymes and other bioactive molecules. For example, Bacillus subtilis RB14-C showed inhibitory effects on a variety of plant pathogens by producing iturin A. Secondly, Bacillus can induce systemic resistance in plants and enhance the resistance of plants to pathogens. Bacillus spp. can also regulate plant growth and immune responses by regulating the levels of endogenous plant hormones, such as indoleacetic acid (IAA).

[0004] In the prevention and control of animal and plant diseases, the main representative species of Bacillus bacteria include Bacillus subtilis, Bacillus licheniformis and Bacillus amyloliquefaciens. These bacteria can effectively fight against a variety of pathogens and play an important role in the development of biopesticides. Studies have found that Bacillus velezensis also shows a wide range of disease prevention potential. It can produce a variety of compounds including iturin, feninteractin and surfactin, which have significant inhibitory effects on a variety of pathogenic bacteria and fungi, such as Listeria monocytogenes, Aspergillus and Fusarium. Application on corn shows that Bacillus velezensis can not only inhibit the growth of these pathogenic fungi, but also reduce the production of harmful substances such as aflatoxins and ochratoxins. Bacillus subtilis MBI600, as a plant growth promoting rhizobacterium (PGPR), has been commercialized to promote tomato growth and fight soil-borne pathogens. B. subtilis C3 was used to control lily bulb rot, demonstrating the application of biological control in high-value plant crop protection. These examples illustrate the dual role of Bacillus in disease management, both in direct inhibition of pathogens and in activating plant defense mechanisms.

[0005] Bacillus is considered an environmentally friendly biocontrol agent. It regulates the plant's response to stress through a variety of hormone and enzyme mechanisms, helps soil remediation and serves as a denitrification agent in agriculture. Studies have shown that combining Bacillus with nanoparticles, such as those coated with gold, aluminum, and silver, can promote plant growth and prevent the growth of harmful fungi in the rhizosphere, further confirming its potential as a nano-biocontrol agent. These properties of Bacillus are not only used in traditional agricultural production, but also have a place in modern environmentally friendly disease management strategies.

[0006] In summary, Bacillus has shown great potential in controlling animal and plant diseases. Through the diversity of biological control mechanisms and the positive environmental impact, Bacillus has become an important part of modern sustainable agriculture. Summary of the invention

[0007] The purpose of the invention is to provide Brevibacillus laterosporus and application thereof.

[0008] The Brevibacillus laterosporus provided by the present invention is named as Brevibacillus laterosporus FBBJCG, characterized in that the Brevibacillus laterosporus FBBJCG has been deposited in the General Microbiological Center of China Microorganism Culture Collection Administration Committee, and the deposit number is CGMCC No. 27712. The Brevibacillus laterosporus FBBJCG has an antibacterial effect on plant pathogenic fungi, plant pathogenic bacteria, bee pathogenic fungi, bee pathogenic bacteria and conditional pathogens.

[0009] Another object of the present invention is to provide the use of the Brevibacillus laterosporus in inhibiting plant pathogenic fungi, plant pathogenic bacteria, bee pathogenic fungi, bee pathogenic bacteria and conditional pathogens.

[0010] Another object of the present invention is to provide a bacteriostatic agent for inhibiting plant pathogenic fungi, plant pathogenic bacteria, bee pathogenic fungi, bee pathogenic bacteria and conditional pathogenic bacteria.

[0011] The antibacterial agent provided by the present invention comprises the Brevibacillus laterosporus as an active ingredient.

[0012] Wherein, the plant pathogenic fungi are Botrytis Cinerea, Fusarium Oxysporum, Fusarium graminearum, Colletotrichumorbiculare (Berk. & Mont.) Arx, Phomopsis asparagi, Rhizoctonia cerealis Vander Hoeven, Macrohoma kawatsukai Hara, Fusarium redolens, Fusarium solani, Ustilaginoidea oryzae (Patou.) Bref = U. virens (Cooke) Tak., Magnaporthe grisea Barr, Alternaria panax, Cochliobolus sativus (Ito & Kurib.) Drechsler), Valsa mali Miyabeet Yamada., Exserohilum turcicum and Gibperella zeae (Schw.) Petch.); or the bee pathogenic fungi are one or two of Ascosphaera apis and Aspergillus tubingensis.

[0013] The plant pathogenic bacteria are one or more of Xanthomonas oryzae pv.oryzae, Xanthomonas campestris pv malvacearum (EF Smith) Dowson, and Pseudomonas solanacearum; or the bee pathogenic bacteria are one or both of Paenibacillus larvae and Melissococcus pluton; or the conditional pathogenic bacteria are one or both of Micrococcus flavus and Staphylococcus aureus.

[0014] The Bacillus laterosporus FBBJCG of the present invention exhibits strong antibacterial activity against pathogenic fungi, has a broad antibacterial spectrum against fungi, can inhibit all detected fungi, and exhibits strong antibacterial activity against pathogenic bacteria. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The colony morphology of four strains: FB71, FBBJAB, FBBJCG and QMHF-B4.

[0016] Figure 2 The results of starch hydrolysis tests of four strains: FB71, FBBJAB, FBBJCG and QMHF-B4.

[0017] Figure 3 These are the results of lipid hydrolysis tests for four strains: FB71, FBBJAB, FBBJCG and QMHF-B4.

[0018] Figure 4 The results of gelatin hydrolysis test of four strains: FB71, FBBJAB, FBBJCG and QMHF-B4.

[0019] Figure 5 These are the casein hydrolysis test results of four strains: FB71, FBBJAB, FBBJCG and QMHF-B4.

[0020] Figure 6 These are the results of sugar alcohol fermentation experiments of four strains, FB71, FBBJAB, FBBJCG and QMHF-B4; A is the D-glucose fermentation experiment; B is the D-fructose fermentation experiment; C is the sucrose fermentation experiment; D is the D-mannitol fermentation experiment.

[0021] Figure 7 These are the hydrogen sulfide test results for four strains: FB71, FBBJAB, FBBJCG and QMHF-B4.

[0022] Figure 8 Indole assay for four strains: FB71, FBBJAB, FBBJCG and QMHF-B4.

[0023] Fig. 9 This is the methyl red test for the four strains FB71, FBBJAB, FBBJCG and QMHF-B4.

[0024] Fig.10 VP test for four strains: FB71, FBBJAB, FBBJCG and QMHF-B4.

[0025] Fig.11The catalase activity of four strains, FB71, FBBJAB, FBBJCG and QMHF-B4, was determined.

[0026] Fig.12 Gram staining of four strains: FB71, FBBJAB, FBBJCG and QMHF-B4.

[0027] Fig.13 Spore staining of four strains: FB71, FBBJAB, FBBJCG and QMHF-B4.

[0028] Fig.14 This is PCR amplification of 16S rDNA of four strains.

[0029] Fig.15 PCR amplification of gyrB gene of four strains.

[0030] Fig.16 These are the experimental results of the in vivo inhibition of American foulbrood of honey bees by strains FB71, FBBJAB, FBBJCG and QMHF-B4.

[0031] Biomaterial Deposit

[0032] 1. Bacillus amyloliquefaciens QMHF-B4

[0033] Deposit number: CGMCC No.27711

[0034] Name: Bacillus amyloliquefaciens QMHF-B4

[0035] Classification name: Bacillus amyloliquefaciens

[0036] Survival: Survival

[0037] Storage time: June 27, 2023

[0038] Depository: China National Microbiological Culture Collection Administration General Microbiology Center

[0039] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing

[0040] 2. Brevibacillus laterosporus FBBJCG

[0041] Deposit number: CGMCC No.27712

[0042] Name: Brevibacillus laterosporus FBBJCG

[0043] Classification name: Brevibacillus laterosporus

[0044] Survival: Survival

[0045] Storage time: July 11, 2023

[0046] Depository: China National Microbiological Culture Collection Administration General Microbiology Center

[0047] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing

[0048] 3. Bacillus pumilus FBBJAB

[0049] Deposit number: CGMCC No.27714

[0050] Name: Bacillus pumilus FBBJAB

[0051] Classification name: Bacillus pumilus

[0052] Survival: Survival

[0053] Storage time: June 27, 2023

[0054] Depository: China National Microbiological Culture Collection Administration General Microbiology Center

[0055] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing

[0056] 4. Bacillus halotolerans FB71

[0057] Deposit number: CGMCC No.27715

[0058] Name: Bacillus halotolerans FB71

[0059] Classification name: Bacillus halotolerans

[0060] Survival: Survival

[0061] Storage time: June 27, 2023

[0062] Depository: China National Microbiological Culture Collection Administration General Microbiology Center

[0063] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing DETAILED DESCRIPTION

[0064] Example 1. Isolation and identification of strains FB71, FBBJAB, FBBJCG, and QMHF-B4

[0065] (I) Isolation of strains

[0066] The strain FB71 was isolated from the intestine of the Italian honey bee, the strain FBBJAB was isolated from the intestine of the Italian honey bee, the strain FBBJCG was isolated from the intestine of the Chinese honey bee, and the strain QMHF-B4 was isolated from the intestine of the green rice wasp. The samples were stored at 4°C after collection. 2-3 bees were placed in a sterile 1.5mL centrifuge tube, 600μL of sterile saline was added, and the mixture was ground into a homogenate with a grinding rod, and then vortexed to mix. Let it stand for a while, aspirate the turbid liquid, and dilute it 10 times with sterile saline to 10 -5 . Take 10 -1 Up to 10 -5 100 μL of the diluted sample was coated on an LB medium plate, and each dilution was repeated 3 times. The plate was placed at 37°C for 24-48 hours. Single colonies of different morphologies were picked and streaked on an LB medium plate for purification to obtain pure cultures of bacteria, and different strains were numbered and then stored in 20% glycerol at -80°C.

[0067] Table 1 Sample collection information

[0068]

[0069] The colony morphology of the four strains is as follows Figure 1 As shown, after strain FB71 was cultured on LB solid medium at 37°C for 48 hours, the colonies were yellow and slightly regular, and the surface texture of the colonies was dense. After strain FBBJAB was cultured on LB solid medium at 37°C for 48 hours, the colonies were white and full, with a ring-shaped protrusion in the middle and wrinkles inside the ring. After FBBJCG was cultured on LB solid medium at 37°C for 48 hours, the colonies were yellow and translucent with irregular edges. After QMHF-B4 was cultured on LB solid medium at 37°C for 48 hours, the colonies were milky white and opaque, with notched edges.

[0070] (II) Identification of strains

[0071] 1. Physiological and biochemical identification of strains

[0072] 1.1 Starch hydrolysis test:

[0073] Inoculate fresh solid culture of Bacillus into starch medium and invert and culture at 37℃ for 48h. After obvious colonies are formed, add iodine solution on the plate. The plate will turn blue-black. If there are transparent circles around the colonies, it means that starch hydrolysis is positive. If the area around the colonies is still blue-black, starch hydrolysis is negative.

[0074] Starch medium (100 mL): (LB medium + 1.0% soluble starch) 1.0 g of tryptone, 0.5 g of yeast extract, 1.0 g of NaCl, 1.0 g of soluble starch, 1.5 g of agar, and 100 mL of distilled water. After dissolving in a water bath, sterilize at 121°C for 20 min and pour into a plate for later use.

[0075] Results: The results are as follows Figure 2 As shown, after the four strains were cultured on starch medium for 48 hours, iodine solution was added around the colonies. Transparent circles were formed around strains FB71 and QMHF-B4, but no transparent circles were formed around strains FBBJAB and FBBJCG, indicating that strains FB71 and QMHF-B4 can secrete amylase to hydrolyze starch, while strains FBBJAB and FBBJCG cannot secrete amylase to hydrolyze starch. Therefore, strains FB71 and QMHF-B4 were positive for starch hydrolysis, while strains FBBJAB and FBBJCG were negative for starch hydrolysis.

[0076] 1.2 Oil hydrolysis test:

[0077] Cool the melted solid oil culture medium to about 50℃, shake it thoroughly to evenly distribute the oil, and pour it into a plate. Inoculate the oil culture medium with Bacillus. Invert and culture it at 37℃ for 24h. Observe the color of the bacterial moss. If red spots appear, it means that the fat is hydrolyzed, which is a positive reaction.

[0078] Fat culture medium (100 ml): 1.0 g peptone, 0.5 g beef extract, 0.5 g NaCl, 1.0 g peanut oil or sesame oil, 0.1 mL 1.6% neutral red aqueous solution, 1.5 g agar, 100 mL distilled water, pH 7.2, autoclave at 121°C for 20 min, pour into a plate for later use.

[0079] Note: Do not use spoiled oil. Heat the oil, agar and water first, adjust the pH and then add neutral red.

[0080] 1.6% neutral red aqueous solution: neutral red 1.6g, 95% ethanol 28mL, distilled water 72mL.

[0081] Results: Figure 3As shown, red spots appeared on the colonies of strains FBBJAB, FBBJCG, and QMHF-B4, and fatty acids were hydrolyzed, indicating that they can produce lipase, and lipase hydrolysis is positive. No red spots appeared around the colonies of strain FB71, indicating that they cannot produce lipase, and lipase hydrolysis is negative.

[0082] 1.3 Gelatin hydrolysis test:

[0083] Take the gelatin culture medium test tubes and puncture them with an inoculation needle to inoculate Bacillus. Incubate the inoculated test tubes at 20°C for 2-5 days. Observe the liquefaction of the gelatin.

[0084] Gelatin culture medium (100 mL): LB culture medium, 12-18 g of gelatin, pH 7.2-7.4. Dissolve the above ingredients in a water bath and adjust the pH to 7.2-7.4, dispense into test tubes, and sterilize at 121°C for 20 min.

[0085] Results: After puncture inoculation of FB71, FBBJAB, FBBJCG, and QMHF-B4 on gelatin medium, liquefaction of the gelatin medium was observed at 20°C for 3-4 days. Therefore, strains FB71, FBBJAB, FBBJCG, and QMHF-B4 can produce gelatinase to hydrolyze gelatin. The above results show that the gelatin hydrolysis test of the four strains is positive ( Figure 4 ).

[0086] 1.4 Casein hydrolysis test (litmus milk test):

[0087] Inoculate Bacillus into a milk litmus medium test tube and culture at 37℃ for 24-48h. If the milk turns clear, it is positive.

[0088] Milk litmus medium: 100 mL skim milk, 4 mL 2.5% litmus solution (filtered overnight before use). The color after mixing should be moderately lilac or purple. Divide into test tubes with a milk height of 4 cm and sterilize at 121°C under high pressure for 15 min.

[0089] Results: The strains FB71, FBBJAB, FBBJCG, and QMHF-B4 were inoculated into milk litmus medium, respectively, and the blank control was milk litmus medium without inoculation of strains. After culturing at 37°C for 48 hours, the results showed that the milk in the medium inoculated with FBBJAB, FB71, and QMHF-B4 became clear, while the medium inoculated with FBBJCG did not change significantly compared with the control (the milk did not become clear). The above results showed that the casein hydrolysis test of strain FBBJCG was negative and could not hydrolyze casein, while the casein hydrolysis test of strain FB71, FBBJAB, and QMHF-B4 was positive and could hydrolyze casein ( Figure 5 ).

[0090] 1.5 Sugar alcohol fermentation experiment

[0091] Use Bacillus cultured for 18 hours, inoculate in sugar fermentation medium, set up negative control, culture at 37℃ for 24-48 hours, and check the results. Observe the color change of each test tube and whether there are bubbles in the Dulbecco's tube. If the indicator changes from purple to yellow, it means that sugar fermentation produces acid, which is positive.

[0092] Sugar fermentation medium (100 mL): 1 g tryptone, 0.5 g NaCl, 0.05 mL 1.6% bromocresol violet ethanol solution, pH 7.6, dilute to 100 mL, divide into test tubes (10 mL / tube), put a Dulbecco tube in each tube to fill it with culture medium, and sterilize it at 121°C for 20 min.

[0093] 20% sugar solution (D-glucose, D-fructose, sucrose, D-mannitol) was sterilized by autoclaving at 112°C for 30 min. After sterilization, 0.5 ml of 20% sugar solution was aseptically added to each tube.

[0094] Results: The results of the D-glucose fermentation experiment are as follows Figure 6 As shown in A, the color of the glucose fermentation medium of the inoculated strains FBBJAB and FB71 changed from purple to light, and both could decompose D-glucose; no bubbles were produced in the Duroc tube of FBBJAB, and a few bubbles were produced in the Duroc tube of FB71, indicating that FBBJAB produced acid but not gas, and FB71 produced acid and gas. The color of the glucose fermentation medium of QMHF-B4 and FBBJCG did not change, and D-glucose could not be decomposed; bubbles were produced in the Duroc tube of QMHF-B4, and no bubbles were produced in the Duroc tube of FBBJCG, indicating that QMHF-B4 produced gas but not acid, and FBBJCG produced neither acid nor gas.

[0095] The results of the D-fructose fermentation experiment are as follows Figure 6 As shown in B, it can be seen from the figure that the color of the fructose fermentation medium inoculated with strains FBBJAB and FBBJCG changed from purple to light color, and they could decompose D-fructose; no bubbles were produced in the Duroc tube of FBBJAB, and bubbles were produced in the Duroc tube of FBBJCG, indicating that strain FBBJAB produced acid but not gas, and FBBJCG produced gas but not acid. The colors of QMHF-B4 and FB71 did not change, indicating that they could not decompose D-fructose; bubbles were produced in the Duroc tube of QMHF-B4, and no bubbles were produced in the Duroc tube of FB71, indicating that strain QMHF-B4 produced gas but not acid, and FB71 produced neither acid nor gas.

[0096] The results of the sucrose fermentation experiment are as follows Figure 6As shown in C, it can be seen from the figure that the color of the sucrose fermentation medium of the inoculated strain FBBJAB changes from purple to yellow, and fructose can be decomposed; the color of the sucrose fermentation medium of QMHF-B4, FB71, and FBBJCG is purple and does not change color, and all of them cannot decompose fructose. No bubbles are produced in the Duroc tubes of FBBJAB, QMHF-B4, and FBBJCG, and bubbles are produced in the Duroc tube of FB71. This shows that the strain FBBJAB produces acid but not gas, QMHF-B4 and FBBJCG do not produce acid or gas, and FB71 produces gas but not acid.

[0097] The results of D-mannitol fermentation experiment are as follows Figure 6 As shown in D, it can be seen from the figure that the color of the D-mannitol fermentation medium inoculated with strain FBBJAB changed from purple to yellow, and no bubbles were produced in the Duroc tube, while the color of the D-mannitol fermentation medium inoculated with QMHF-B4FB71 and FBBJCG did not change and remained purple. Bubbles were produced in the Duroc tube of QMHF-B4, while no bubbles were produced in the Duroc tubes of FB71 and FBBJCG. This shows that strain FBBJAB can decompose D-mannitol and produce acid but not gas, while strain QMHF-B4 cannot decompose D-mannitol and produces gas but not acid, and strains FB71 and FBBJCG produce neither acid nor gas.

[0098] 1.6 Hydrogen sulfide test:

[0099] Use an inoculation needle to pierce the Bacillus into the lead acetate culture medium and culture it at 37℃ for 48 hours. If the culture medium turns black, it is positive. If it is negative, continue to culture for up to 6 days.

[0100] Lead acetate medium (100mL): 0.3g beef extract, 1.0g peptone, 0.5g NaCl, 1.5g agar, dilute to 100mL and heat to dissolve, add 0.25g sodium thiosulfate when cooled to 60℃, adjust pH to 7.2, dispense into Erlenmeyer flasks, sterilize at 115℃ for 15min. Take out and cool to 55-60℃, add 1mL of 10% lead acetate aqueous solution (sterile), mix well and pour into sterile test tubes.

[0101] Results: The strains FB71, FBBJAB, FBBJCG and QMHF-B4 were inoculated on the lead acetate medium and cultured at 37℃ for 48h. None of the three test tubes turned black. When the culture was continued to the fifth day, the strains FB71 and FBBJCG did not turn black near the puncture line, while the strains FBBJAB and QMHF-B4 turned black near the puncture line, indicating that the strains FB71 and FBBJCG did not produce hydrogen sulfide and the hydrogen sulfide test was negative, while the strains FBBJAB and QMHF-B4 could produce hydrogen sulfide and the hydrogen sulfide test was positive ( Figure 7 ).

[0102] 1.7 Indole test:

[0103] Inoculate Bacillus into indole culture medium and culture at 37℃ for 48h. Slowly add 2 drops of indole reagent to the surface along the tube wall. If red appears on the liquid interface, it is a positive reaction. If it is not obvious, add 4-5 drops of ether to the culture medium and let it stand for 1min. After the ether rises, add indole reagent and observe the color reaction. A red ring appears between the ether and the culture medium, which is a positive reaction.

[0104] Indole medium (100 mL): 1.0 g of trypticase peptone, 0.5 g of NaCl, 0.05 g of L-tryptophan, pH 7.6, autoclave at 121°C for 15 min for use.

[0105] Indole reagent: p-dimethylaminobenzaldehyde 2g, 95% ethanol 190mL, concentrated HCl 40mL

[0106] Results: After the strains FB71, FBBJAB, FBBJCG, and QMHF-B4 were inoculated into indole medium and cultured at 37°C for 48 hours, 2 drops of indole reagent were slowly added along the tube wall. No red color was produced on the liquid layer interface of the four strains, indicating that the indole reaction of the four strains was negative ( Figure 8 ).

[0107] 1.8. Methyl red test:

[0108] Pick up Bacillus and inoculate it in glucose peptone water culture medium, culture at 37℃, and take 1mL of culture medium every day from the second day, add 1-2 drops of methyl red indicator, positive is bright red, weak positive is light red, negative is yellow. If positive is found or it is still negative on the 5th day, the result can be determined.

[0109] Glucose peptone water medium (100 mL): 0.5 g peptone, 0.5 g glucose, 0.2 g K 2 HPO 4 Dissolve the above ingredients in 100 mL of water, adjust the pH to 7.0-7.2, dispense into test tubes of 10 mL, and sterilize at 112°C for 30 min.

[0110] Methyl red reagent: 0.04g methyl red, 60mL 95% ethanol, 40mL distilled water. Dissolve in ethanol first, then add distilled water.

[0111] Results: FB71, FBBJAB, FBBJCG, and QMHF-B4 were inoculated with glucose peptone water culture medium and cultured at 37°C. After 24 hours of culture, 1 mL of culture medium was taken for FBBJAB, and 1 to 2 drops of methyl red indicator were added. The bacterial solution was bright red. Strain FB71, FBBJCG, and QMHF-B4 were sampled until the fifth day after culture, and methyl red indicator was added. The color of the bacterial solution was the same as the blank control (uninoculated culture medium), which was yellow. The above results show that FBBJAB methyl red reaction was positive, while strain FB71, FBBJCG, and QMHF-B4 methyl red reaction was negative ( Fig. 9 ).

[0112] 1.9VP test

[0113] Inoculate Bacillus into glucose peptone water culture medium (VP assay culture medium), culture at 37°C for 48 hours, add 1mL 40% NaOH and 1mL 5% α-naphthol to the test tube, shake vigorously, and keep it at 37°C for 15-30 minutes to speed up the reaction. If the culture turns red, it is a positive VP reaction.

[0114] VP assay medium (100 mL): 0.5 g peptone, 0.5 g glucose, 0.2 g NaCl, dissolve the above ingredients in 100 mL water, adjust the pH to 7.0-7.2, dispense into test tubes of 4-5 mL, and sterilize at 112°C for 30 min.

[0115] 5% α-naphthol: 5g α-naphthol, 100mL anhydrous ethanol

[0116] Results: FB71, FBBJAB, FBBJCG, and QMHF-B4 were inoculated with glucose peptone water culture medium, respectively, and cultured at 37℃ for 48h. Then, 1mL 40% NaOH and 1mL 5% α-naphthol were added, respectively. The results showed that the fermentation broth of FB71, FBBJAB, and QMHF-B4 turned red, while the color of FBBJCG did not change, indicating that the VP reaction of FB71, FBBJAB, and QMHF-B4 was positive, and the VP reaction of FBBJCG was negative ( Fig.10 ).

[0117] 1.10 Determination of catalase

[0118] Pick a small amount of Bacillus culture from the LB slant, smear it on a clean glass slide, add 10% hydrogen peroxide, and the one with bubbles generated is positive.

[0119] Results: A small amount of culture was picked from the plates of the purified strains FB71, FBBJAB, FBBJCG, and QMHF-B4, smeared on a clean slide, and 10% hydrogen peroxide was added. Bubbles were produced by FB71, FBBJAB, and QMHF-B4, but not by FBBJCG. Therefore, the catalase reaction (catalase reaction) of FB71, FBBJAB, and QMHF-B4 was positive, and the catalase reaction of FBBJCG was negative ( Fig.11 ).

[0120] 2. Gram staining (Gram staining kit)

[0121] Gram staining was performed using the Solebro Gram staining kit (Cat. No. G1060). The specific steps are as follows:

[0122] (1) Select the strains FB71, FBBJAB, FBBJCG, and QMHF-B4 cultured on the plate and inoculate them into LB test tubes. Cultivate them at 37°C with shaking for 24 h.

[0123] (2) Smear fixation: Pipette 10 μL of bacterial solution onto a glass slide and pass it through a flame 1-2 times during fixation. Do not overheat.

[0124] (3) Staining: After adding crystal violet, stain for 1 minute and wash with water. After adding iodine solution, stain for 1 minute and wash with water. Add decolorizing solution, shake the slide, decolorize for about 20-60 seconds depending on the thickness of the smear, wash with water, and absorb water. After adding safranin, stain for 1 minute and wash with water. After blotting or air drying, examine with an oil microscope. Gram-negative bacteria appear red, and Gram-positive bacteria appear purple.

[0125] Results: Gram staining results are as follows Fig.12 As shown, the cells of strains FB71, FBBJAB, and QMHF-B4 are short rod-shaped, while the cells of strain FBBJCG are long rod-shaped with blunt ends. In addition, after Gram staining, the cells of the four strains are purple, indicating that all four strains are Gram-positive bacteria.

[0126] 3. Spore staining (Spore staining kit)

[0127] Spore staining was performed using the Scharffer-Fulton method (malachite green staining method) produced by Yuanye Biotechnology Co., Ltd. The specific steps are as follows:

[0128] (1) Select the strains FB71, FBBJAB, FBBJCG, and QMHF-B4 cultured on the plate and inoculate them into LB test tubes. Cultivate them at 37°C with shaking for 48 h.

[0129] (2) Pipette 10 μL of bacterial solution onto a clean, grease-free glass slide to make a smear and allow to dry naturally. (3) Add drops of malachite green staining solution to the smear to ensure that the bacteria are evenly distributed.

[0130] (4) Heat intermittently with low heat for 10 minutes.

[0131] (5) Rinse gently with water.

[0132] (6) Stain with spore counterstain for 1 min and rinse with water.

[0133] Microscopic examination: After drying, examine with an oil microscope; spores are stained green and bacteria are stained red.

[0134] Results: Spore staining results are as follows Fig.13 As shown, the spores in the cells of the four Bacillus strains FB71, FBBJAB, FBBJCG, and QMHF-B4 were stained green, short, and blunt, indicating that the four Bacillus strains can produce spores.

[0135] 4. Mobility

[0136] Use an inoculation needle to puncture and inoculate the bacillus into LB medium, culture at 37℃ for 48h, and observe the growth visually every 24h after inoculation. If the growth spreads from the puncture line to the surrounding area in a cloud-like manner, it means that the test strain is motile and is positive.

[0137] LB medium (100 mL): 1.0 g of tryptone, 0.5 g of yeast extract, 1.0 g of NaCl, 1.5 g of agar, 100 mL of distilled water, pH = 7.2, divided into test tubes, and sterilized by high pressure at 121°C for 20 min.

[0138] Results: After 48 hours of LB medium culture, the 4 strains of Bacillus were inoculated with puncture, and all 4 strains grew around the puncture line, and all 3 strains were motile. Among them, strains FB71 and FBBJCG showed significant cloud-like growth and had the strongest motility, followed by strain FBBJAB, and strain QMHF-B4 had the weakest motility.

[0139] In summary, the basic biological characteristics of the four strains are shown in Table 2:

[0140] Table 2 Basic biological characteristics of the four strains

[0141]

[0142] 5. Molecular Identification of Strains

[0143] 5.1 Extraction of genomic DNA

[0144] A single colony was picked from the streaked activated LB plate and inoculated into fresh LB liquid medium, and cultured at 37°C with shaking at 200 rpm. When the bacterial liquid OD600 grew to 0.8-1.0, 5 mL of bacterial liquid was taken and centrifuged to collect the bacteria. Genomic DNA was extracted using a bacterial genomic DNA extraction kit (DC112-01, Novozymes, China).

[0145] 5.2 PCR amplification of 16S rDNA

[0146] Using genomic DNA as template, primers were designed and synthesized (Sangon Biotechnology Co., Ltd., China) to amplify 16S rDNA:

[0147] 27F: 5'-AGAGTTTGATCCTGGCTCAG-3'

[0148] 1492R:5'-GGTTACCTTGTTACGACTT-3'

[0149] Then, the 16S rDNA fragment was amplified using Q5 high-fidelity polymerase (BDTP1180, NEB, USA). The amplified fragment was detected as a single band by 1% agarose gel electrophoresis (the fragment length was about 1500 bp, as shown in the following figure). Fig.14 The 16S rDNA fragment was sequenced and analyzed by BLAST (http: / / www.ncbi.nlm.nih.gov) in GenBank, and the names of the identified strains similar to the four strains were obtained to identify the strains.

[0150] PCR system: genomic DNA 50-100ng, 27F 0.5mM, 1492R 0.5mM, 2×Q5 mix 25μL, H2O to 50μL. DNA amplification program: 98℃ for 30s, then 98℃ for 10s, 50℃ for 15s, 72℃ for 45s, for a total of 30 cycles, and finally 72℃ for 10min.

[0151] 5.3 PCR amplification of gyrB gene

[0152] Using genomic DNA as template, degenerate primers were designed and synthesized (Shanghai Biotechnology Co., Ltd., China) to amplify the gyrB gene (DNA gyrase subunit B gene, partial sequence, length of about 1200 bp, the results are as follows Fig.15 ), the underlined parts are sequencing primers, which are UP-1S and UP-2Sr gyrB-F:5'- GAAG TCATCATGACCGTTCTGCAYGCNGGNGGNAARTTYGA-3'

[0153] gyrB-R:5'- AGCACGGTACGGATGTGCGAGCC RTCNACRTCNGCRTCNGCRTCNGTCAT-3'

[0154] Then, the gyrB gene fragment was amplified using Q5 high-fidelity polymerase (BDTP1180, NEB, USA). The amplified fragment was detected as a single band by 1% agarose gel electrophoresis (the fragment length was about 1200 bp, as shown in the following figure). Fig.15 The DNA was sequenced using the sequencing primers UP-1S and UP-2Sr (Shanghai Sangon Biotechnology Co., Ltd., China).

[0155] PCR system: genomic DNA 50-100 ng, gyrB-F 0.5 mM, gyrB-R 0.5 mM, 2×Q5 mix 25 μL, H2O to 50 μL.

[0156] DNA amplification program: 98°C for 30 s, then 98°C for 10 s, 55°C for 15 s, 72°C for 36 s for 30 cycles, and finally 72°C for 10 min

[0157] 5.4 16S rDNA and gyrB gene sequence analysis

[0158] The sequences obtained after sequencing the 16S rDNA and gyrB genes of the four strains (FB71, JBBJAB, FBBJCG, and QMHF-B4) were compared by BLAST in the NCBI database. The comparison results are shown in the table below.

[0159] As can be seen from Table 3, the 16S rDNA sequence (sequence 1) of strain FB71 has a 100% similarity with the sequences of B. tequilensis, B. mojavensis, and B. halotolerans. The gyrB gene sequence (sequence 5) of strain FB71 has a 99.91% similarity with B. halotolerans and a 99.72% similarity with B. mojavensis. Therefore, the FB71 strain was identified as B. halotolerans.

[0160] Bacilus halotolerans FB71 was deposited at the General Microbiology Center of China Culture Collection Administration on June 27, 2023, at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number: CGMCC No.27715.

[0161] As shown in Table 3, the 16S rDNA sequence (sequence 2) of strain JBBJAB is 100% similar to that of B. pumilus, B. safensis, and B. zhangzhouensis. The gyrB gene sequence (sequence 6) of strain JBBJAB has the highest similarity with that of B. pumilus, which is 99.91%. Therefore, strain JBBJAB is identified as B. pumilus.

[0162] Bacilus pumilus FBBJAB was deposited at the General Microbiology Center of China Culture Collection Administration on June 27, 2023, at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number: CGMCC No.27714.

[0163] As shown in Table 3, the 16S rDNA sequence (sequence 3) of strain FBBJCG was only aligned to Brevibacilus laterosporus on NCBI, with a similarity of 100%. The gyrB gene sequence (sequence 7) of strain FBBJCG had the highest sequence similarity with Brevibacilus laterosporus, which was 99.72%. The FBBJCG strain was identified as Brevibacilus laterosporus.

[0164] Bacilus laterosporus FBBJCG has been deposited at the General Microbiology Center of China National Culture Collection Administration on July 11, 2023, at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number: CGMCC No. 27712.

[0165] As shown in Table 3, the 16S rDNA sequence (sequence 4) of strain QMHF-B4 has a 100% similarity with B. velezensis, B. siamensis, and B. amyloliquefaciens. The gyrB gene sequence (sequence 8) of strain QMHF-B4 has the highest similarity with B. amyloliquefaciens, which is 99.91%. Combined with the above physiological and biochemical experiments, the QMHF-B4 strain was identified as B. amyloliquefaciens.

[0166] Bacilus amyloliquefaciens QMHF-B4 was deposited at the General Microbiology Center of China National Microbiological Culture Collection Administration on June 27, 2023, at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number: CGMCC No.27711.

[0167] Table 3 Molecular identification of four strains of Bacillus

[0168]

[0169] Example 2. Determination of antibacterial activity of strains FB71, FBBJAB, FBBJCG, and QMHF-B4

[0170] The dual culture method was used to detect the antibacterial activity of Bacillus against pathogenic fungi in vitro, and the dig-hole diffusion method was used to detect the antibacterial activity of Bacillus against pathogenic bacteria in vitro. 16 plant pathogenic fungi, 3 plant pathogenic bacteria, 2 human pathogenic bacteria, 2 bee pathogenic fungi and 2 bee pathogenic bacteria (the 25 pathogens are shown in Table 4 below, provided by the Plant Disease and Insect Pest Laboratory, Institute of Plant Protection, Chinese Academy of Agricultural Sciences and the Bee Pest Laboratory, Bee Research Institute, the above strains were isolated and identified from nature according to conventional methods known in the art) were used as target bacteria to determine the antibacterial activities of FB71, FBBJAB, FBBJCG and QMHF-B4 strains, respectively.

[0171] Table 4 25 plant (or bee) pathogenic fungi and bacteria

[0172]

[0173]

[0174] 1. Activation of pathogens

[0175] Fungal activation: Use a sterilized inoculation loop to pick up the mycelium of pathogenic fungi stored at 4°C and place them on a new PDA medium plate. Culture them in a constant temperature incubator at 28°C for 4-5 days and set aside.

[0176] Bacterial activation: Take out the bacterial strain, inoculate it into fresh LB solid medium with a sterilized inoculation loop, and culture it in a 37℃ constant temperature incubator for 24-48 hours. When a single colony grows, keep it for later use. For liquid culture, pick a single colony and place it in 3mL liquid LB medium, and culture it at 37℃, 200r / min, with shaking for 12 hours.

[0177] 2. Determination of antibacterial effect on pathogenic fungi

[0178] Punch the activated pathogenic fungi with a sterile puncher to obtain a 6 mm diameter fungal block and place it in the center of a potato dextrose agar plate. With the inoculated pathogenic fungi as the center, 2 μL of overnight cultured bacterial solution was inoculated at a distance of 2 cm from the fungus body in a cross distribution pattern. LB broth was treated in the same way as the negative control group, and three biological replicates were performed for each treatment group. Incubate at 30°C in the dark for 7 days to allow the pathogenic fungi to grow. ImageJ software (NIH, USA) was used to capture images and measure the area of ​​the fungal growth area on the plate. After taking a photo of the incubated agar plate, open ImageJ software and import the captured image into the software. Set the scale by selecting the "Set Scale" option under the "Analyze" menu. Use the selection tool "Polygon selections" to draw an area around the colony outline. Click the "Measure" option under the "Analyze" menu. ImageJ will automatically calculate and display the area of ​​the selected area. Record the displayed area value and calculate the antifungal activity, that is, the fungal growth inhibition rate, according to the following formula:

[0179]

[0180] 3. Determination of antibacterial effect on pathogenic bacteria

[0181] Prepare pathogenic bacteria liquid. When the bacteria grow to the logarithmic phase, take 100 μL of the liquid and spread it on LB solid culture medium. Make holes evenly around the culture medium (6 mm in diameter). Then add 50 μL of filtered and sterilized antagonistic bacteria liquid into the holes. Repeat 3 times for each dish. Culture at 37°C and measure the diameter of the inhibition zone after 1-2 days.

[0182] 4. Results and Analysis

[0183] 4.1 Determination of the antibacterial activity of strains FB71, FBBJAB, FBBJCG, and QMHF-B4 against plant pathogenic fungi

[0184] Table 5 Test results of antibacterial activity against plant (or bee) pathogenic fungi

[0185]

[0186] The antibacterial activities of strains FB71, FBBJAB, FBBJCG, and QMHF-B4 against 18 pathogenic fungi were measured by the dual culture method, and the results are shown in Table 5. The experimental results show that strains FB71, FBBJAB, FBBJCG, and QMHF-B4 have different degrees of antibacterial activity, and the maximum inhibition rate can reach 97.89%.

[0187] The strain FB71 showed high antibacterial activity against Apple black rot fungus, with an inhibition rate of 94.60%. In addition, FB71 also showed obvious antibacterial ability against Aspergillus mellifera, Botrytis cinerea, Gibberella maydis, Green Sclerotium oryzae, Fusarium graminearum, Rhizoctonia graminearum, and, with inhibition rates of 93.13%, 90.86%, 89.65%, 87.76%, 86.68%, and 83.37%, respectively. Except for not inhibiting Aspergillus tubingensis, it also showed certain antibacterial ability against the other 10 tested fungi, with a wide antibacterial spectrum.

[0188] The strain FBBJAB had the best inhibitory effect on apple black rot fungus, with an inhibition rate of up to 97.89%, and the inhibition rate on cucurbit spiny colleorhiza was 97.59%. The inhibition rates on Glomerella apis, Botrytis cinerea, Fusarium graminearum, and Macropteris spp. were 96.29%, 94.53%, 88.37%, and 80.58%, respectively. Except for the inhibition of Aspergillus tubingensis, it also showed a certain inhibitory ability against the other 11 tested fungi.

[0189] The strain FBBJCG has an inhibition rate of 91.93% against Apple Black Coriolus, 90.21% against Colletotrichum aculeatus, 89.90% against Gibberella maydis, and 89.79% against Botrytis cinerea. The strain FBBJCG has no inhibitory effect on Aspergillus tubingensis and Aspergillus mellifera.

[0190] The strain QMHF-B4 showed strong inhibitory effects on most pathogenic fungi, with an inhibition rate of up to 97.67% against Apple black rot fungus, and showed high antibacterial activity when co-cultured with Gray Bighorn Aspergillus, with an inhibition rate of 96.83%. At the same time, it also achieved high in vitro antibacterial rates of 95.17%, 93.45%, 92.21%, 90.72% and 90.57% against Cucurbitaceae, Bee Sac Fungus, Gray Mold, Stem Point of Ring Pattern and Rice Green Sclerotinia.

[0191] Table 6 Determination results of antibacterial activity against pathogenic bacteria

[0192]

[0193]

[0194] The digging well diffusion method was used to detect the antibacterial activity of strains FBBJAB, FBBJCG, QMHF-B4, and FB71 against 6 pathogenic bacteria, and the results are shown in Table 6. The results showed that the four strains exhibited different antibacterial activities against different pathogenic bacteria. The antibacterial diameter of FBBJAB against Xanthomonas oryzae was 14.87 mm, the antibacterial diameter against Staphylococcus aureus was 22.97 mm, the antibacterial diameter against Bacillus larvae was 21.04 mm, the antibacterial diameter against Apis cerevisiae was 15.27 mm, and the antibacterial diameter against Micrococcus luteus was 10.08 mm; the antibacterial diameter of FBBJCG against Xanthomonas hornulariae of cotton was 9.78 mm, the antibacterial diameter against Staphylococcus aureus was 17.03 mm, and the antibacterial diameter against Apis cerevisiae was 1. The diameter of the bacteria reached 24.33mm; the antibacterial diameter of QMHF-B4 against Xanthomonas angular leaf spot of cotton was 12.41mm, the antibacterial diameter against Bacillus larvae reached 23.14mm, the antibacterial diameter against Apis cerevisiae reached 13.63mm, and the antibacterial diameter against Micrococcus luteus was 10.28mm; the antibacterial diameter of FB71 against Bacillus larvae reached 23.46mm, the antibacterial diameter against Apis cerevisiae reached 21.48mm, the antibacterial diameter against Staphylococcus aureus was 8.81mm, and the antibacterial diameter against Xanthomonas angular leaf spot of cotton was 11.54mm.

[0195] In summary, FB71, FBBJAB, FBBJCG, and QMHF-B4 all showed strong antibacterial activity against pathogenic fungi and had a broad antibacterial spectrum against fungi. FB71, FBBJAB, FBBJCG, and QMHF-B4 showed different antibacterial activities against different pathogenic bacteria. FB71 also had a broad antibacterial spectrum against pathogenic bacteria and showed strong antibacterial activity. FBBJAB and FBBJCG had good antibacterial activity against Staphylococcus aureus and Apis cerevisiae, and QMHF-B4 had good antibacterial activity against Bacillus larvae and Micrococcus luteus.

[0196] Example 3: Inhibition of foulbrood by strains FB71, FBBJAB, FBBJCG and QMHF-B4 in vivo

[0197] 1. Experimental Methods

[0198] Experimental groups: One-day-old larvae newly hatched from the honeycomb were placed on a 48-well larval rearing plate. Each bacterial strain had four treatments, including a control group (CK), a group inoculated with the pathogen of American foulbrood (Paenibacilus larvae), a group inoculated with beneficial bacteria, and a group inoculated with both pathogens and beneficial bacteria. Each treatment had 4 replicates, with 12 larvae in each replicate. In addition, due to insufficient number of larvae, in the FBBJAB group, the CK group had only 3 replicates, with 9 larvae in each replicate, and the other three treatment groups in the FBBJAB group had 4 replicates each, with 8 larvae in each replicate.

[0199] Inoculation of bacteria: Pathogens were added to the feed of 1-day-old larvae for feeding inoculation. The P. larvae treatment group was inoculated with P. larvae spores in the feed, with an inoculation amount of 400 spores / worm; the beneficial bacteria treatment group was FB71, FBBJAB, FBBJCG and QMHF-B4, and the OD was diluted after 24 hours of culture. 600 to 0.6, and the diluted bacterial solution was added to the feed at a ratio of 1:10 to feed the honey bee larvae; the P.larvae + beneficial bacteria treatment group was: 400 spores / worm spores and diluted FB71, FBBJAB, FBBJCG and QMHF-B4 bacterial solutions were added to the feed.

[0200] Survival rate statistics: Feed the larvae every day and calculate the survival rate of the larvae. Clean the dead larvae out of the 48-well plate in time and calculate the survival rate until pupation, a total of 7 days.

[0201] 2. Experimental results:

[0202] The results are as follows Fig.16 As shown, feeding four beneficial bacteria, FB71, FBBJAB, FBBJCG and QMHF-B4, did not affect the survival rate of the larvae, and there was no difference with CK; however, inoculation with P.larvae could cause a large number of larvae to die, while simultaneous inoculation with P.larvae and FBBJCG, P.larvae and QMHF-B4 could significantly increase the survival rate of the larvae caused by P.larvae; and simultaneous inoculation with P.larvae and FB71, P.larvae and FBBJAB could also partially increase the survival rate of the larvae caused by P.larvae.

Claims

1. A strain of Brevibacillus laterosporus, named Brevibacillus laterosporus FBBJCG, characterized in that: The Brevibacillus laterosporus FBBJCG has been deposited in the General Microbiological Center of China National Microbiological Culture Collection Administration, with the deposit number being CGMCC No.27712.

2. Use of the Brevibacillus laterosporus described in claim 1 in inhibiting plant pathogenic fungi, plant pathogenic bacteria, bee pathogenic fungi, bee pathogenic bacteria and conditional pathogens.

3. The use according to claim 2, characterized in that: The plant pathogenic fungi are Botrytis Cinerea, Fusarium Oxysporum, Fusarium graminearum, Colletotrichum orbiculare (Berk. & Mont.) Arx, Phomopsisasparagi, Rhizoctonia cerealis Vander Hoeven, Macrohoma kawatsukai Hara, Fusarium redolens, Fusarium solani, Ustilaginoidea oryzae (Patou.) Bref = U. virens (Cooke) Tak., Magnaporthe grisea Barr, Alternaria panax, Cochliobolus sativus (Ito & Kurib.) Drechsler), Valsa maliMiyabe et Yamada., Exserohilum turcicum and Gibberella zeae (Schw.) Petch.); or the bee pathogenic fungi are one or two of Ascosphaeraapis and Aspergillus tubingensis.

4. The use according to claim 2, characterized in that: The plant pathogenic bacteria are one or more of Xanthomonas oryzae pv.oryzae, Xanthomonas campestris pvmalvacearum (EF Smith) Dowson and Pseudomonas solanacearum; or one or two of the bee pathogenic bacteria Paenibacillus larvae and Melissococcus pluton; or the conditional pathogenic bacteria are one or two of Micrococcus flavus and Staphylococcus aureus.

5. An antibacterial agent for inhibiting plant pathogens, bee pathogens and conditional pathogens, characterized in that: The method comprises the Brevibacillus laterosporus according to any one of claims 1 as an active ingredient.

6. The antibacterial agent according to claim 5, characterized in that The plant pathogenic fungi are Botrytis Cinerea, Fusarium Oxysporum, Fusarium graminearum, Colletotrichum orbiculare (Berk. & Mont.) Arx, Phomopsisasparagi, Rhizoctonia cerealis Vander Hoeven, Macrohoma kawatsukai Hara, Fusarium redolens, Fusarium solani, Ustilaginoidea oryzae (Patou.) Bref = U. virens (Cooke) Tak., Magnaporthe grisea Barr, Alternaria panax, Cochliobolus sativus (Ito & Kurib.) Drechsler), Valsa maliMiyabe et Yamada., Exserohilum turcicum and Gibberella zeae (Schw.) Petch.); or the bee pathogenic fungi are one or two of Ascosphaeraapis and Aspergillus tubingensis.

7. The antibacterial agent according to claim 5, characterized in that The plant pathogenic bacteria are one or more of Xanthomonas oryzae pv.oryzae, Xanthomonas campestris pvmalvacearum (E. F. Smith) Dowson and Pseudomonas solanacearum; or the bee pathogenic bacteria are one or both of Paenibacillus larvae and Melissococcus pluton; or the conditional pathogenic bacteria are one or both of Micrococcus flavus and Staphylococcus aureus.

Images