Lactobacillus paracasei strain as well as fermentation product and application thereof

Abstract

The invention relates to the technical field of microorganisms, in particular to a lactobacillus paracasei strain as well as a fermentation product and application thereof. The preservation number of the lactobacillus paracasei strain is CGMCC (China General Microbiological Culture Collection Center) No.27974. The Lactobacillus paracasei can inhibit the growth of Streptococcus mutans, reduce the formation of a dental plaque biofilm caused by Streptococcus mutans, reduce the content of a mature dental plaque biofilm, inhibit the level of water-insoluble exopolysaccharides generated by Streptococcus mutans, and reduce the expression quantity of cariogenic genes gtfB, gtfC, gtfD, ftf and LuxS of Streptococcus mutans, and can be used for fermentation production of fermented milk. And oat milk and other fermentation products.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a Lactobacillus paracasei strain and a fermentation product and application thereof. Background Art

[0002] Dental caries is a progressive destructive disease of the hard tissues of the teeth caused by the combined effects of multiple factors such as microorganisms, the host, the environment and time. Dental caries, commonly known as tooth decay, is the most common chronic bacterial infection of the oral cavity. It can cause pulpitis and apical periodontitis, and aggravate or induce systemic diseases. Oral microorganisms adhere to the tooth surface to form dental plaque biofilm, which is a biofilm complex composed of extracellular polysaccharides, proteins and minerals secreted by microorganisms adhering to the solid surface of tooth enamel or tooth roots.

[0003] Studies have found that probiotics can play an anti-caries role by inhibiting the growth of cariogenic bacteria and biofilm formation, including: ① probiotics can compete with cariogenic bacteria for nutrients or attachment sites; ② co-aggregate with pathogens and exert antibacterial effects; ③ probiotics can produce organic acids, hydrogen peroxide, bacteriocins, etc. to interfere with the metabolism of cariogenic bacteria, etc. Other anti-caries mechanisms include regulating immunity, adjusting local pH, and increasing saliva flow.

[0004] CN202210615263.8 discloses a saliva-associated lactobacillus CCTCC NO: M2022172 for preventing or treating dental caries and periodontal disease and its application. The saliva-associated lactobacillus has a significant inhibitory effect on Streptococcus mutans and Actinomyces viscosus that cause dental caries, and on Porphyromonas gingivalis, Fusobacterium nucleatum and Aggregatibacter semiactinomycetemcomitans that cause periodontal disease. The saliva-associated lactobacillus can be used as an oral probiotic to effectively prevent and improve oral diseases.

[0005] The research on the inhibitory effect and inhibitory mechanism of Lactobacillus paracasei on Streptococcus mutans is insufficient, and the anti-caries effect is low. Therefore, a Lactobacillus paracasei strain that can significantly inhibit Streptococcus mutans and has a better anti-caries effect is needed. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide a Lactobacillus paracasei strain, which has a very excellent effect of preventing or treating dental caries.

[0007] The Lactobacillus paracasei can tolerate the oral environment, has good self-aggregation ability, and co-aggregation ability with Streptococcus mutans, can inhibit the proliferation of Streptococcus mutans and common pathogens, effectively reduce the formation of dental plaque biofilm caused by Streptococcus mutans, reduce the content of mature dental plaque biofilm and is not easy to form biofilm itself, reduce the level of water-insoluble extracellular polysaccharides produced by Streptococcus mutans, and significantly reduce the expression of Streptococcus mutans cariogenic genes gtfD, ftf and LuxS. The adhesion ability of Streptococcus mutans on the hydroxyapatite tooth model is significantly inhibited, and the bacteria can be made into functional products for preventing and treating dental caries.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0009] In one aspect, the present invention provides a Lacticaseibacillus paracasei strain, the deposit number of the Lacticaseibacillus paracasei strain is CGMCC No.27974.

[0010] In one embodiment, the Lactobacillus paracasei strain comprises the 16S rRNA gene represented by SEQ ID NO:1.

[0011] In one embodiment, the Lactobacillus paracasei strain of the present invention can tolerate the oral environment and is not prone to forming biofilm on the tooth surface.

[0012] On the other hand, the present invention also provides the use of the Lactobacillus paracasei strain as described above in the preparation of a product for preventing or treating dental caries.

[0013] In one embodiment, the strain is used to inhibit the growth of Streptococcus mutans.

[0014] In one embodiment, the strain is used to reduce the formation of dental plaque biofilm caused by Streptococcus mutans and reduce the content of mature dental plaque biofilm.

[0015] In one embodiment, the strain is used to inhibit the level of water-insoluble exopolysaccharide production by Streptococcus mutans.

[0016] In one embodiment, the strain is used to reduce the expression levels of the cariogenic genes gtfB, gtfC, gtfD, ftf and LuxS of mutans Streptococcus.

[0017] In one embodiment, the strain is used to reduce the adhesion rate of Streptococcus mutans on a hydroxyapatite tooth model.

[0018] In one embodiment, the product is a food, a health product, a medicine or an oral care product.

[0019] In another embodiment, the oral care product is selected from one or more of mouthwash, beverage, mouth spray, chewing gum, tooth gel, toothpaste, tooth powder, dental floss, tooth cleaning liquid, and tooth cleaning foam.

[0020] In another aspect, the present invention further provides a fermentation product, which is obtained by fermenting the Lactobacillus paracasei strain as described above.

[0021] In one embodiment, the fermentation product is fermented milk, and the content of active Lactobacillus paracasei strains in the fermented milk is 4.0×10 8 CFU / mL and above.

[0022] In one embodiment, the fermentation product is fermented oat milk, and the viable count of Lactobacillus paracasei in the fermented oat milk is 8.5×10 8 CFU / mL and above.

[0023] Beneficial Effects

[0024] Compared with the prior art, the Lactobacillus paracasei strain of the present invention has the following beneficial effects:

[0025] (1) The Lactobacillus paracasei strain of the present invention can tolerate the oral environment and has good self-aggregation ability; it has the ability to co-aggregate with Streptococcus mutans, can inhibit the proliferation of Streptococcus mutans and common pathogenic bacteria, effectively reduce the formation of dental plaque biofilm caused by Streptococcus mutans, reduce the content of mature dental plaque biofilm and is not easy to form biofilm itself, reduce the level of water-insoluble extracellular polysaccharides produced by Streptococcus mutans, significantly inhibit the adhesion ability of Streptococcus mutans on hydroxyapatite tooth models, and significantly reduce the expression levels of cariogenic genes gtfD, ftf and LuxS of Streptococcus mutans.

[0026] (2) The Lactobacillus paracasei strain of the present invention has a beneficial in vitro probiotic function and is excellent in inhibiting a variety of pathogens.

[0027] (3) The Lactobacillus paracasei strain of the present invention can be fermented to produce fermented milk, oat milk and other fermented products. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The graph shows the copolymerization ability of the Lactobacillus paracasei HOM1212 strain of the present invention and Streptococcus mutans CICC10438. Note: ** represents a very significant difference compared with Streptococcus mutans CICC10438 (p<0.01). ## Compared with the commercial Lactobacillus paracasei S strain, there was a very significant difference (p<0.01).

[0029] Figure 2 The results show the inhibitory effect of the Lactobacillus paracasei HOM1212 strain of the present invention on the biofilm of Streptococcus mutans CICC10438, and specifically show the biofilm content. Note: ** represents a very significant difference compared with Streptococcus mutans CICC10438 (p<0.01). ## Compared with the commercial Lactobacillus paracasei S strain, there was a very significant difference (p<0.01).

[0030] Figure 3 The results show the inhibitory effect of the Lactobacillus paracasei HOM1212 strain of the present invention on the dental caries gene of Streptococcus mutans CICC10438, and specifically show the relative expression of the gene. Note: ** represents a very significant difference compared with Streptococcus mutans CICC10438 (p<0.01). ## This represents a very significant difference compared with the commercial Lactobacillus rhamnosus GG (p<0.01).

[0031] Figure 4 The results show the inhibitory effect of the Lactobacillus paracasei HOM1212 strain of the present invention on the adhesion of Streptococcus mutans CICC10438 to the tooth model, and specifically show the fluorescence value. Note: ** represents a very significant difference compared with Streptococcus mutans CICC10438 (p<0.01). # It represents a significant difference compared with the commercial Lactobacillus rhamnosus GG (p<0.05).

[0032] Storage information description:

[0033] The Lacticaseibacillus paracasei HOM1212 strain of the present invention was deposited in the General Microbiology Center (CGMCC) of the China Microbiological Culture Collection Administration on July 24, 2023, and the deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; the deposit number is CGMCC No. 27974. The strain was identified at the Institute of Microbiology, Chinese Academy of Sciences.

[0034] The strain was sent to the Institute of Microbiology, Chinese Academy of Sciences for identification.

[0035] The conclusion of the test and identification is as follows: Under the conditions of this laboratory, based on the comprehensive analysis of the cell morphology, physiological and biochemical characteristics, 16S rRNA gene sequence, dnaK gene sequence and other experimental data of the tested strains, and with reference to the Bergey's Manual of Systematic Bacteriology and relevant research papers in the International Journal of Systematic and Evolutionary Microbiology, the identification result of the tested strain (strain number: HOM1212) is: Lactaseibacillus paracasei. Synonyms: Lactobacillus paracasei.

[0036] The cell morphology of the strain is rod-shaped; the physiological and biochemical characteristics are Gram-positive, catalase-negative (-), and oxidase-negative (-); the 16S rRNA gene sequence is shown in SEQ ID NO: 1, and the dnaK gene sequence is shown in SEQ ID NO: 2. DETAILED DESCRIPTION

[0037] The present invention discloses strains and their applications, and those skilled in the art can refer to the contents of this article and appropriately improve the process parameters to achieve. It is particularly important to point out that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0038] It should be noted that the experimental methods used in the present invention are all conventional methods unless otherwise specified.

[0039] Unless otherwise specified, the reagents and materials used in the present invention are prepared by conventional methods or obtained from commercial channels.

[0040] As identified above, Lacticaseibacillus paracasei and Lactobacillus paracasei are synonyms of the same species, and thus in the present invention, Lacticaseibacillus paracasei and Lactobacillus paracasei can be used interchangeably.

[0041] Streptococcus mutans is the main bacterium that causes dental caries. The relationship between Streptococcus mutans and dental caries is mainly that Streptococcus mutans can use sucrose as a substrate to produce water-insoluble extracellular glucan, fructan and intracellular polysaccharide. Glucan mediates bacterial adhesion and promotes plaque formation.

[0042] The Lacticaseibacillus paracasei strain HOM1212 used in the present invention is isolated from healthy infant feces in Beijing, and has the following physical and chemical properties: the suitable growth temperature is 37°C, it has antibacterial properties, has good self-aggregation ability and good co-aggregation ability with Streptococcus mutans, can inhibit the proliferation of Streptococcus mutans and common pathogens, can tolerate the oral environment, significantly inhibits the adhesion of Streptococcus mutans on the hydroxyapatite tooth model, effectively reduces the formation of dental plaque biofilm caused by Streptococcus mutans, reduces the content of mature dental plaque biofilm and is not easy to form biofilm by itself, reduces the level of water-insoluble extracellular polysaccharides generated by Streptococcus mutans, and significantly reduces the expression of Streptococcus mutans cariogenic genes gtfD, ftf and LuxS. It can be used to prepare functional products for preventing or treating dental caries.

[0043] In order to further understand the present invention, the Lactobacillus paracasei provided by the present invention and uses thereof are described in detail below in conjunction with the embodiments, and the protection scope of the present invention is not limited by the following embodiments.

[0044] Example 1 Isolation and Identification of Lactobacillus paracasei HOM1212 Strain

[0045] (1) Preparation of culture medium

[0046] MRS liquid medium:

[0047] MRS medium (OXOID, CM1163) and double distilled water 1L, stir well, sterilize at 121℃ for 20min, and set aside.

[0048] Modified MRS solid medium:

[0049] MRS medium (OXOID, CM1163), 0.05 g of bromocresol green (Shanghai Biotech), 1 L of double distilled water, stir evenly, adjust pH to 5.5, sterilize at 121°C for 20 min, and set aside.

[0050] (2) Isolation of laboratory strains

[0051] Weigh 1g of healthy infant feces, shake and mix thoroughly with 9mL of 0.9% saline, dilute the sample by ten-fold dilution method, select two appropriate dilutions, take 100μL and spread it on the modified MRS solid plate, and culture at 37℃ for 72h. Pick a single colony with a smooth surface, milky white or milky yellow colonies and yellowing around, streak culture and purification. Observe the colony morphology under a microscope. Pick a single colony to MRS liquid culture medium for pure culture, preserve it in glycerol and number HOM1212.

[0052] (3) Isolation of commercial strains of Lactobacillus paracasei S and Lactobacillus rhamnosus GG

[0053] Weigh 1g of bacterial powder or 1mL of product (including commercial strains of Lactobacillus paracasei S strain or Lactobacillus rhamnosus GG strain) respectively, shake and mix thoroughly with 9mL of 0.9% saline, dilute the sample by ten-fold dilution method, select two appropriate dilutions, take 100μL and spread it on a modified MRS solid plate, and culture at 37°C for 48h. Pick a single colony with a smooth surface, streak culture and purify. Observe the colony morphology under a microscope. Pick a single colony to MRS liquid culture medium for pure culture, preserve the seeds with glycerol and number them as Lactobacillus paracasei S strain and Lactobacillus rhamnosus GG strain.

[0054] (4) Identification of strains

[0055] The strains of the selected strains were inoculated into MRS liquid medium and cultured at 37°C for 24h. The total DNA of the bacterial solution was extracted and 16S rRNA gene amplification was performed. Universal primers 27F (5'-AGTTTGATCMTGGCTCAG-3', SEQ ID NO: 3) and 1492R (5'-GGTTACCTTGTTACGACTT-3', SEQ ID NO: 4) were used for PCR amplification and agarose gel electrophoresis, gel cutting and recovery, and sequencing (performed by CGMCC). Then, the BLAST tool was used to compare in the NCBI database, and the HOM1212 strain was identified as Lactobacillus casei. The sequence of the 16S rRNA gene of the HOM1212 strain is shown in SEQ ID NO: 1:

[0056]

[0057] The sequence of the dnaK gene of the HOM1212 strain is shown in SEQ ID NO: 2:

[0058] ACATCCTTGACATCACCAGAGATGACCCCGCCTTGAATGGCAGCACCTAGCGCAACCGCTTCGTCTGGGTTAATGCTGTGGTCTGGGTCCTTGCCAGTCCACTGTTTAACTGCTTCCTGAACTGCTGGTGTCCGAGTTGAACCACCATTTAAAATAACCTTGTCGATGTCAGCGTTGGTCAACTTGGCATCCTTCAAAGCATTTTCGACTGGGATCTTGGTCTTGGCAACCAGGTCAGCGGTCATT TCGTCAAACTGTGCCCGCGTCAAGGTGCGTTCCAAATGCAACGGGCCATTAGGGCCAGCAGAGATAAATGGCAAGCTGATCTGTGTCTGGGTAACCCCGGACAGATCCTTCTTAGCCTTTTCAGCGGCATCCTTCAGCCGTTGCATCGCCATTTTATCTTTGGACAAATCAATATTGTTGTCTTTCTTAAATTCAGCAACTAACCAGTCGATGATCTTGT TATCAAAATCATCACCGCCCAAATGGGTATCACCATTGGTCGACAGCACTTCAAAGACCCCGTCGCCTAATTGCAGAATGGAAACATCAAATGTCCCACCGCCAAGGTCATAAACCAGAATCTTTTCGTCCTTGTCGCCTTTGTCCAAGCCATAAGCCAAGGCAGAAGCGGTTGGTTCGTTGATAATCCGCTGAACATTCAAACCAGCAATCTTGCCGGC

[0059] Example 2 Preparation process of active bacterial powder of Lactobacillus paracasei HOM1212 strain

[0060] (1) Culture of bacterial strains

[0061] The Lactobacillus paracasei HOM1212 strain isolated in Example 1 was inoculated into MRS liquid culture medium at a 3% inoculation rate and cultured at 37°C for 24 h to activate the second generation. The viable count of the strain was up to 1.8×10 10 CFU / mL and above.

[0062] (2) Freeze drying

[0063] The fermentation liquid of Lactobacillus paracasei HOM1212 strain cultured in (1) was centrifuged to collect bacterial sludge, which was washed with 0.9% sterile physiological saline, mixed with a protective agent (100 g / L skim milk powder), freeze-dried in a freeze dryer, and the bacterial cake was crushed with a fine grinder to obtain the freeze-dried bacterial powder, wherein the number of viable bacteria in the freeze-dried bacterial powder was higher than 4.0×10 11 CFU / g.

[0064] Example 3 Test on the ability of Lactobacillus paracasei HOM1212 strain to inhibit common pathogenic bacteria

[0065] (1) Activation of pathogenic bacteria

[0066] Five pathogenic bacteria were selected for this test: Escherichia coli ATCC8739, Salmonella typhimurium ATCC14028, Staphylococcus aureus ATCC6538, Pseudomonas aeruginosa ATCC9027, Listeria monocytogenes ATCC19111. The pathogenic strains were purchased from ATCC (American type culture collection).

[0067] The pathogenic strains were inoculated into the nutrient agar medium at an inoculum amount of 1% of the total volume of the medium, and cultured at 37°C, 200 rpm, and shaking for 12 hours. The indicator bacteria were adjusted to OD = 0.1 with fresh medium for later use.

[0068] (2) Strain activation

[0069] In this experiment, the commercial strain Lactobacillus rhamnosus GG was selected as the control strain. The GG and HOM1212 strains separated in Example 1 were inoculated into MRS liquid culture medium at an inoculum amount of 1% of the total culture medium, and cultured at 37°C for 24 hours. After activation twice, the fermentation liquid of the strain was obtained. Centrifuged at 11000rpm for 10 minutes, the supernatant was taken for antibacterial test, and the MRS liquid culture medium was used as a negative control.

[0070] (3) Plate preparation

[0071] Pour the sterilized nutrient agar culture into the culture dish, add 100 μL of indicator bacteria solution into the culture medium, mix well, and let it stand to solidify.

[0072] (4) Antibacterial experiment

[0073] Use sterile tweezers to gently place the Oxford cup on the plate, keeping a certain distance between the wells. Add 150 μL of fermentation supernatant to each well, place in a 4°C refrigerator for diffusion for 12 hours, and then culture in a 37°C incubator for 18 hours. Observe and measure the diameter of the inhibition zone. Table 1 shows the inhibitory effect of the strain on pathogenic bacteria.

[0074] Table 1

[0075]

[0076] Note: “–” no antibacterial activity, <11mm; “+” 11mm≤inhibition zone<16mm; “++” 16mm≤inhibition zone<23mm; “+++” ≥23mm

[0077] As shown in Table 1, Lactobacillus paracasei HOM1212 strain has an inhibitory effect on all five pathogenic bacteria. The antibacterial ability of Lactobacillus paracasei HOM1212 strain is comparable to that of the commercial strain Lactobacillus rhamnosus GG strain.

[0078] Example 4 Tolerance of Lactobacillus paracasei HOM1212 strain to artificial saliva containing lysozyme

[0079] (1) Activation of strains

[0080] The Lactobacillus paracasei HOM1212 strain isolated in Example 1 and the commercial strain Lactobacillus paracasei S strain were inoculated in an MRS liquid culture medium at an inoculum rate of 3%, cultured at 37°C for 24 hours, and activated twice. After the strain activation was completed, the supernatant was removed after centrifugation at 11000 rpm for 10 minutes, and the viable count was adjusted to 1.5×10 with sterile phosphate buffered saline (PBS). 9 CFU / mL.

[0081] Streptococcus mutans CICC10438 10438) was selected from children with dental caries and purchased from the China Industrial Microbiological Culture Collection. Mutans Streptococcus CICC10438 was inoculated into brain heart infusion (BHI) liquid culture medium at a 3% inoculum, cultured anaerobically at 37°C for 24 hours, and activated twice. After the strain was activated twice, it was centrifuged at 11000rpm for 10 minutes, the supernatant was removed, and the viable count was adjusted to 1.5×10 with sterile PBS. 9 CFU / mL.

[0082] (2) Experiment on strain tolerance to artificial saliva containing lysozyme

[0083] The strain was transferred to sterile artificial saliva containing 1 mg / mL lysozyme and cultured at 37°C. The number of live bacteria at 0h and 6h was measured to evaluate the strain's tolerance to artificial saliva containing lysozyme.

[0084] (3) Tolerance

[0085]

[0086] Wherein, T1 represents the number of live bacteria of the strain at t = 6 hours; T0 represents the number of live bacteria of the strain at t = 0 hours. Table 2 shows the tolerance of the strain to artificial saliva containing 1 mg / mL lysozyme.

[0087] Table 2

[0088]

[0089] Note: ** indicates significant difference compared with Streptococcus mutans CICC10438 (p<0.01). # # It represents a significant difference compared with the commercial Lactobacillus paracasei S strain (p<0.01).

[0090] As can be seen from Table 2, compared with Streptococcus mutans CICC10438 and commercial strain Lactobacillus paracasei S strain, Lactobacillus paracasei HOM1212 strain has stronger tolerance in artificial saliva containing 1mg / mE lysozyme, with extremely significant difference (p<0.01). Its survival rate of Lactobacillus paracasei HOMI212 strain is 92.55%±3.61% after incubation of artificial saliva containing 1mg / mL lysozyme for 6h. Studies have shown that oral saliva contains abundant lysozyme, so Lactobacillus paracasei HOM1212 strain can maintain a higher survival rate in the oral cavity, thereby can play a probiotic role in the oral cavity.

[0091] Example 5 Self-aggregation ability of Lactobacillus paracasei HOM1212 strain

[0092] (1) Activation of strains

[0093] The Lactobacillus paracasei HOM1212 strain and the Lactobacillus paracasei S strain isolated in Example 1 were inoculated into MRS liquid culture medium at an inoculum size of 3% respectively, cultured at 37° C. for 24 h, and activated twice. After the strain activation was completed, the supernatant was removed after centrifugation at 11000 rpm for 10 min, and resuspended 3 times with sterile PBS buffer.

[0094] Mutans Streptococcus CICC10438 was inoculated into BHI liquid culture medium at 3% inoculation volume, cultured at 37°C for 24 hours, and activated twice. After the strain was activated twice, it was centrifuged at 11000 rpm for 10 minutes, the supernatant was removed, and it was resuspended three times with sterile PBS buffer.

[0095] (2) Self-aggregation experiment

[0096] The initial absorbance of the strain was adjusted to A0 = 0.6 ± 0.02 with sterile PBS buffer and allowed to stand at room temperature. The absorbance of the suspension was measured at 1 h, 2 h, and 3 h. t )(OD=600).

[0097] (3) Self-aggregation ability

[0098]

[0099] Among them A t The absorbance at t = 1, 2, and 3 hours is shown. Table 3 shows the self-aggregation ability of the strains.

[0100] Table 3

[0101]

[0102] Note: ** indicates a very significant difference compared with Streptococcus mutans CICC10438 (p<0.01). ## Compared with the commercial Lactobacillus paracasei S strain, there was a very significant difference (p<0.01).

[0103] As can be seen from Table 3, with the increase of time, the self-aggregation ability of the strain gradually increased, and the self-aggregation ability of Lactobacillus paracasei HOM1212 strain and commercial Lactobacillus paracasei S strain were higher than that of Streptococcus mutans CICC10438 (p<0.01). Compared with the commercial Lactobacillus paracasei S strain, the self-aggregation ability of Lactobacillus paracasei HOM1212 strain was higher, with a very significant difference (p<0.01). Studies have shown that higher self-aggregation ability helps strains reproduce and survive in the oral cavity.

[0104] Example 6 Coaggregation ability of Lactobacillus paracasei HOM1212 strain and Streptococcus mutans CICC10438

[0105] (1) Activation of strains

[0106] The Lactobacillus paracasei HOM1212 strain and the Lactobacillus paracasei S strain isolated in Example 1 were inoculated into MRS liquid culture medium at an inoculum size of 3%, cultured at 37° C. for 24 h, and activated twice. After the strain activation was completed, the supernatant was removed after centrifugation at 11000 rpm for 10 min, and resuspended 2-3 times with sterile PBS buffer.

[0107] Mutans Streptococcus CICC10438 was inoculated into BHI liquid medium at 3% inoculation volume, cultured anaerobically at 37°C for 24 hours, and activated twice. After the strain was activated twice, it was centrifuged at 11000 rpm for 10 minutes, the supernatant was removed, and it was resuspended three times with sterile PBS buffer.

[0108] (2) Coaggregation experiment

[0109] Equal volumes of probiotics Lactobacillus paracasei HOM1212 strain and Lactobacillus paracasei S strain were mixed with Streptococcus mutans CICC10438, and the probiotics in the control group were replaced with sterile PBS buffer. The absorbance of the suspension was measured at 1h, 2h, and 3h. The results are shown in Table 1. Figure 1 .

[0110] (3) Coaggregation ability

[0111]

[0112] A0 and B0 represent the initial absorbance of Lactobacillus paracasei HOM1211 and Streptococcus mutans CICC10438, C t The absorbance of the mixture measured at t = 1, 2, and 3 hours is shown.

[0113] from Figure 1 It can be seen that as time goes by, the coaggregation ability of probiotics Lactobacillus paracasei HOM1211 strain, Lactobacillus paracasei S strain and Streptococcus mutans CICC10438 increases. Compared with the PBS control group, at 2h and 3h, the coaggregation ability of Lactobacillus paracasei HOM1211 strain and Streptococcus mutans CICC1 0438 has extremely significant differences (p<0.01). Compared with Lactobacillus paracasei S strain, at 1h, the Lactobacillus paracasei HOM1212 strain group has extremely significant differences (p<0.01). This study shows that the coaggregation ability of Lactobacillus paracasei HOM1211 strain and Streptococcus mutans is high, which can reduce the adhesion and colonization of free Streptococcus mutans in the oral cavity and reduce the formation of dental biofilm.

[0114] Example 7 Inhibitory Effect of Lactobacillus paracasei HOM1212 on Streptococcus mutans CICC10438

[0115] (1) Activation of strains

[0116] The Lactobacillus paracasei HOM1212 strain and the Lactobacillus paracasei S strain isolated in Example 1 were inoculated into MRS liquid culture medium at an inoculum size of 3%, cultured at 37° C. for 24 h, and activated twice. After the strain activation was completed, the supernatant was removed after centrifugation at 11000 rpm for 10 min, and the bacterial count was adjusted with sterile PBS.

[0117] Mutans Streptococcus CICC10438 was inoculated into BHI liquid medium at 3% inoculation volume, cultured at 37°C for 24 hours, and activated twice. After the strain was activated twice, the supernatant was removed after centrifugation at 11000 rpm for 10 minutes, and the bacterial count was adjusted with sterile PBS.

[0118] (2) Co-culture experiment with Streptococcus mutans CICC10438

[0119] The viable counts of probiotic Lactobacillus paracasei HOM1212 strain, Lactobacillus paracasei S strain, and Streptococcus mutans CICC10438 were adjusted to 1.5×10 8 CFU / mL, 125 μL of Lactobacillus paracasei HOM1212 strain and Lactobacillus paracasei S strain were inoculated into BHI liquid medium with Streptococcus mutans CICC10438, and cultured anaerobically at 37 °C for 24 h. In the control group, Lactobacillus paracasei HOM1212 strain was replaced with sterile PBS, and the colony count was performed using BHI solid medium after the co-culture.

[0120] (3) Inhibition rate:

[0121]

[0122] A is the number of viable bacteria of mutans Streptococcus CICC10438 after the co-culture of probiotics Lactobacillus paracasei HOM1212 strain and Lactobacillus paracasei S strain with Streptococcus mutans CICC10438 respectively; B is the number of viable bacteria of mutans Streptococcus CICC10438 in the control group. Table 4 shows the inhibitory effect of probiotics Lactobacillus paracasei HOM1212 strain and Lactobacillus paracasei S strain on Streptococcus mutans CICC10438.

[0123] Table 4

[0124]

[0125] Note: ** Compared with the commercial Lactobacillus paracasei S strain, there was a very significant difference (p<0.01).

[0126] As can be seen from Table 4, both probiotic strains of Lactobacillus paracasei HOM1212 and Lactobacillus paracasei S can inhibit the growth of Streptococcus mutans CICC10438. Compared with the commercial Lactobacillus paracasei S strain, Lactobacillus paracasei HOM1212 had a stronger inhibitory effect on Streptococcus mutans CICC10438 (p<0.01).

[0127] Example 8 Biofilm Formation Ability of Lactobacillus paracasei HOM1212 Strain

[0128] (1) Activation of strains

[0129] The Lactobacillus paracasei HOM1212 strain and Lactobacillus casei S strain isolated in Example 1 were inoculated in MRS liquid culture medium at an inoculum volume of 3%, cultured at 37°C for 24 h, and activated twice. After the strain activation was completed, the supernatant was removed after centrifugation at 11000 rpm for 10 min, and the strain was resuspended three times with sterile saline, and sterile PBS was used as a blank control to adjust the OD 600 =0.5±0.02.

[0130] Mutans Streptococcus CICC10438 was inoculated into BHI liquid medium at 3% inoculation volume, cultured anaerobically at 37°C for 24 hours, and activated twice. After the strain was activated twice, it was centrifuged at 11000rpm for 10 minutes, the supernatant was removed, and it was resuspended 2-3 times with sterile PBS, and the sterile PBS was used as the blank control to adjust its OD 600 =0.5±0.02.

[0131] (2) Biofilm formation ability of strains

[0132] The probiotic Lactobacillus paracasei HOM1212 strain and Lactobacillus paracasei S strain were inoculated into MRS+2% sucrose medium, and Streptococcus mutans was inoculated into BHI+2% sucrose medium. After mixing evenly, they were transferred to 96-well plates for culture and anaerobically cultured at 37°C for 48 hours.

[0133] (3) Determination of biofilm content

[0134] The 96-well plate was rinsed twice with sterile water, dried, and stained with 200 μL 0.1% crystal violet for 15 minutes. After staining, the crystal violet was removed, rinsed twice with sterile water, placed in a 37°C incubator to dry for 30 minutes, and then 200 μL 30% glacial acetic acid was added to dissolve for more than 30 minutes. The plate was read with an ELISA reader at a wavelength of 570 nm. Table 5 shows the biofilm formation ability of the strains.

[0135] Table 5

[0136]

[0137] Note: ** indicates a very significant difference compared with Streptococcus mutans CICC10438 (p<0.01).

[0138] As can be seen from Table 5, the ability of the two probiotics Lactobacillus paracasei HOM1212 strain and Lactobacillus paracasei S strain to form biofilm is much lower than that of Streptococcus mutans CICC10438. Compared with Streptococcus mutans CICC10438, the biofilm formation amount of the two probiotics Lactobacillus paracasei HOM1212 strain and Lactobacillus paracasei S strain has a very significant difference (p<0.01), so the intake of Lactobacillus paracasei HOM1212 strain does not aggravate the formation of biofilm and dental caries.

[0139] Example 9 Inhibitory effect of Lactobacillus paracasei HOM1212 strain on biofilm formation of Streptococcus mutans CICC10438

[0140] (1) Activation of strains

[0141] The Lactobacillus paracasei HOM1212 strain and the Lactobacillus paracasei S strain isolated in Example 1 were inoculated into MRS liquid culture medium at 3% inoculation amount, cultured at 37° C. for 24 h, and activated twice. After the strain activation was completed, the supernatant was removed after centrifugation at 11000 rpm for 10 min.

[0142] Mutans Streptococcus CICC10438 was inoculated into BHI liquid culture medium at 3% inoculation amount, cultured anaerobically at 37°C for 24 hours, activated twice, and centrifuged at 11000 rpm for 10 minutes before removing the supernatant.

[0143] (2) Probiotics Lactobacillus paracasei HOM1212 strain and Lactobacillus paracasei S strain were co-cultured with Streptococcus mutans CICC10438

[0144] The viable counts of probiotic Lactobacillus paracasei HOM1212 strain and Lactobacillus casei S strain and Streptococcus mutans CICC10438 were adjusted to 1.5×10 using fresh MRS+2% sucrose and BHI+2% sucrose culture media. 8 CFU / mL, added at a ratio of 1:1, and the control group replaced the probiotics with MRS + 2% sucrose medium, mixed evenly and added to a 96-well plate, and fermented anaerobically at 37 °C for 24h and 48h.

[0145] (3) Determination of biofilm content

[0146] The samples in the 96-well plate after fermentation were rinsed twice with sterile water, dried, and stained with 200 μL 0.1% crystal violet for 15 minutes. After staining, the crystal violet was removed, rinsed twice with sterile water, placed in a 37°C incubator to dry for 30 minutes, and then 200 μL 30% glacial acetic acid was added to dissolve for more than 30 minutes. The results were read with an enzyme-labeled instrument at a wavelength of 570 nm. Figure 2 .

[0147] from Figure 2 Can find out, when probiotics Lactobacillus paracasei HOM1212 strain, Lactobacillus paracasei S strain were co-cultured with Streptococcus mutans CICC10438 for 24h and 48h respectively, Lactobacillus paracasei HOM1212 strain all can significantly inhibit Streptococcus mutans CICC10438 biofilm formation (p<0.01).And Lactobacillus paracasei S strain can only significantly inhibit Streptococcus mutans CICC10438 biofilm formation (p<0.01) when 48h.Compare with Lactobacillus paracasei S strain, when 24h and 48h, the ability that Lactobacillus paracasei HOM1212 strain inhibits Streptococcus mutans CICC10438 to form biofilm is much higher than Lactobacillus paracasei S strain (p<0.01), which shows that the ability that Lactobacillus paracasei HOM1212 strain inhibits Streptococcus mutans CICC10438 to form biofilm is stronger.

[0148] Example 10 Inhibitory effect of Lactobacillus paracasei HOM1212 strain on mature biofilm of Streptococcus mutans CICC10438

[0149] (1) Preparation of probiotic supernatant

[0150] The probiotic Lactobacillus paracasei HOM1212 strain and Lactobacillus paracasei S strain were inoculated into fresh MRS liquid culture medium at an inoculation rate of 3%, cultured under anaerobic conditions at 37°C for 24 hours, activated for 2 generations, and centrifuged at 11000 rpm for 10 minutes to obtain the supernatant, the pH of which was adjusted to 6.5 with 1.0 M NaOH, and filtered through a 0.22 μm filter membrane to remove the bacteria, and placed in a 4°C refrigerator for use.

[0151] (2) Preparation of mature biofilm of Streptococcus mutans CICC10438

[0152] Mutant Streptococcus CICC10438 was inoculated into fresh BHI liquid medium at a 3% inoculum and cultured at 37°C under anaerobic conditions for 24 h to activate the second generation. Mutant Streptococcus CICC10438 was centrifuged and resuspended twice with sterile PBS. The OD 600 Adjust to 0.5, mix well, take 100 μL and add to 96-well plate, and culture anaerobically at 37°C for 24 h.

[0153] (3) Effects of the supernatants of probiotic Lactobacillus paracasei HOM1212 and Lactobacillus paracasei S on the mature biofilm of Streptococcus mutans CICC10438

[0154] The supernatant of mutans Streptococcus CICC10438 was removed after the culture was completed, and 100 μL of the treated strain supernatant was added after rinsing once with sterile PBS. In the control group, the probiotic supernatant was replaced with fresh MRS medium (pH=6.5) and co-cultured at 37°C for 24 h.

[0155] (4) Determination of biofilm content

[0156] The sample that fermentation in 96-well plate is finished is rinsed with sterile water 2 times, dried, and dyed with 200 μ L 0.1% crystal violet for 15 min. After dyeing, take out crystal violet, rinse with sterile water 2 times, place 37 ℃ of incubators to dry for 30 min, then add 200 μ L 30% glacial acetic acid to dissolve for more than 30 min. Read with microplate reader, wavelength is 570 nm. Table 6 shows the inhibitory effect of probiotics Lactobacillus paracasei HOM1212 strain and Lactobacillus paracasei S strain on the mature biofilm of Streptococcus mutans CICC10438 respectively.

[0157] Table 6

[0158]

[0159] Note: ** indicates a very significant difference compared with Streptococcus mutans CICC10438 (p<0.01).

[0160] As can be seen from Table 6, after the fermentation supernatants of the probiotic Lactobacillus paracasei HOM1212 strain and Lactobacillus paracasei S strain were adjusted to pH=6.5, the fermentation supernatants still had a very significant inhibitory effect on the mature biofilm of Streptococcus mutans CICC10438 (p<0.01), indicating that the non-acidic metabolites produced by the Lactobacillus paracasei HOM1212 strain have the effect of inhibiting the formation of biofilm by Streptococcus mutans.

[0161] Example 11 Effect of Lactobacillus paracasei HOM1212 strain on the content of water-insoluble exopolysaccharides produced by Streptococcus mutans CICC10438

[0162] (1) Activation of strains

[0163] The Lactobacillus paracasei HOM1212 strain and the Lactobacillus rhamnosus GG strain isolated in Example 1 were inoculated into MRS liquid culture medium at an inoculum size of 3%, cultured at 37° C. for 24 h, and activated twice. After the strain activation was completed, the supernatant was removed after centrifugation at 11000 rpm for 10 min, and washed twice with sterile PBS for standby use.

[0164] Mutans Streptococcus CICC10438 was inoculated into BHI liquid culture medium at 3% inoculation volume and cultured anaerobically at 37°C for 24 hours. After the strain was activated twice, the supernatant was removed after centrifugation at 11000 rpm for 10 minutes, and the culture was washed twice with sterile PBS for use.

[0165] (2) Probiotics Lactobacillus paracasei HOM1212 and Lactobacillus rhamnosus GG were co-cultured with Streptococcus mutans CICC10438

[0166] The viable counts of probiotic Lactobacillus paracasei HOM1212 and Lactobacillus rhamnosus GG were adjusted to 1.5×10 8 CFU / mL, and the viable count of Streptococcus mutans CICC10438 was adjusted to 1.5×10 8 The probiotics Lactobacillus paracasei HOM1212 strain and Lactobacillus rhamnosus GG strain were added to Streptococcus mutans CICC10438 at a ratio of 1:1, and the probiotic solution of the control group was replaced with fresh MRS + 2% sucrose, mixed evenly, added to a 24-well plate, and anaerobically fermented at 37°C for 48h.

[0167] (3) Determination of water-insoluble extracellular polysaccharide content

[0168] The supernatant of the sample after the culture in the 24-well plate was removed, 2 mL of sterile water was added, 1 mL was taken for centrifugation, and resuspended with sterile water 3 times to remove the water-soluble exopolysaccharide. The water-insoluble exopolysaccharide was dissolved with 1.0 M NaOH, stirred at 37 ° C for 2 h, and its content was determined by phenol-concentrated sulfuric acid method. Table 7 shows the effects of probiotics Lactobacillus paracasei HOM1212 strain and Lactobacillus rhamnosus GG strain on the content of water-insoluble exopolysaccharide produced by Streptococcus mutans CICC10438

[0169] Table 7

[0170]

[0171] Note: ## indicates that there is a significant difference (p<0.01) compared with the commercial Lactobacillus rhamnosus GG strain.

[0172] Studies have shown that water-insoluble extracellular polysaccharides are key factors in the formation of dental biofilm and dental caries by Streptococcus mutans. As can be seen from Table 7, both Lactobacillus paracasei HOM1212 strain and Lactobacillus rhamnosus GG strain can significantly reduce the formation of water-insoluble extracellular polysaccharides of Streptococcus mutans CICC10438, with inhibition rates of 90.83% ± 0.28% and 75.44% ± 0.29%, respectively. This shows that Lactobacillus paracasei HOM1212 strain and Lactobacillus rhamnosus GG strain can inhibit the formation of water-insoluble polysaccharides by Streptococcus mutans and prevent the formation of dental caries.

[0173] Example 12 Effect of Lactobacillus paracasei HOM1212 strain on the expression of cariogenic genes in Streptococcus mutans CICC10438

[0174] (1) Activation of strains

[0175] The Lactobacillus paracasei HOM1212 strain and the Lactobacillus rhamnosus GG strain isolated in Example 1 were inoculated into MRS liquid culture medium at an inoculum size of 3%, cultured at 37° C. for 24 h, and activated for 2 generations. After the activation of the strains, the supernatant was removed after centrifugation at 11000 rpm for 10 min, and the strains were washed twice with sterile saline.

[0176] Mutans Streptococcus CICC10438 was inoculated into BHI liquid culture medium at an inoculum size of 3%, and cultured anaerobically at 37°C for 24 hours. After the strain was activated twice, the supernatant was removed after centrifugation at 11000 rpm for 10 minutes, and the culture was washed twice with sterile saline.

[0177] (2) Probiotics Lactobacillus paracasei HOM1212 and Lactobacillus rhamnosus GG were co-cultured with Streptococcus mutans CICC10438

[0178] The probiotics Lactobacillus paracasei HOM1212 strain and Lactobacillus rhamnosus GG strain were adjusted to the same viable count as Streptococcus mutans CICC10438 using fresh MRS+2% sucrose and BHI+2% sucrose culture media, respectively. 200 μL of probiotics Lactobacillus paracasei HOM1212 strain and Lactobacillus rhamnosus GG strain were added to the upper chamber of the Transwell plate, and 600 μL of Streptococcus mutans CICC10438 was added to the lower chamber. Only MRS+2% sucrose culture medium was added to the upper chamber of the control group, and anaerobically cultured at 37°C for 48 hours.

[0179] (3) RT-qPCR technology

[0180] RNA of mutans Streptococcus CICC10438 was extracted and quality tested. If the purity, concentration and integrity of RNA met the requirements of subsequent experiments, the next step of reverse transcription experiment would be carried out. After RNA was reverse transcribed into cDNA, the expression levels of internal reference genes and target genes were determined by real-time fluorescence quantitative PCR, and the results were processed and analyzed. The cariogenic genes and primer designs measured are shown in Table 8. The housekeeping gene gyrA was selected as the internal reference gene. The results are shown in Figure 3 middle.

[0181] Table 8. Reference genes and cariogenic genes of Streptococcus mutans and their primer designs

[0182]

[0183] Studies have shown that gtfD is related to the formation of glucan in biofilms, and ftf is related to the formation of fructan in biofilms. Inhibiting the expression of gtfD and ftf can reduce the formation of biofilms, thereby reducing the risk of dental caries. In addition, the LuxS gene is involved in the regulation of oxidative stress tolerance of Streptococcus mutans, which can reduce the ability of Streptococcus mutans to adapt to the environment.

[0184] from Figure 3 It can be seen that compared with the control group of Streptococcus mutans CICC10438, the Lactobacillus paracasei HOM1212 strain can significantly reduce the expression of the cariogenic genes gtfD, ftf and LuxS of Streptococcus mutans CICC10438 (p<0.01), while the Lactobacillus rhamnosus GG strain can significantly reduce the expression of ftf and LuxS (p<0.01), but cannot reduce the expression of gtfD (p>0.05). Compared with the commercial strain Lactobacillus rhamnosus GG, the Lactobacillus paracasei HOM1212 strain has a more significant effect in inhibiting the expression of gtfD / LuxS genes (p<0.01). This shows that the Lactobacillus paracasei HOM1212 strain can effectively reduce the expression of the above three cariogenic genes of Streptococcus mutans, thereby affecting the restriction of the cariogenic effect of Streptococcus mutans in the oral cavity.

[0185] Example 13 Effect of Lactobacillus paracasei HOM1212 on the adhesion of Streptococcus mutans CICC10438 on the tooth model

[0186] (1) Preparation of hydroxyapatite

[0187] Hydroxyapatite was suspended in sterile potassium chloride (KCl) buffer, washed 10 times with distilled water, and dried in a 60°C incubator for 48 h. 12 mg of treated hydroxyapatite and 1 mL of sterile KCl buffer were added to a suitable tube and placed at 4°C for 16 h for adhesion experiments.

[0188] (2) Activation of strains

[0189] The probiotics Lactobacillus paracasei HOM1212 strain and Lactobacillus rhamnosus GG strain isolated in Example 1 were activated twice with Streptococcus mutans CICC10438, and the activated strains were washed three times with sterile KCl buffer, and the viable counts of the probiotics Lactobacillus paracasei HOM1212 strain and Lactobacillus rhamnosus GG strain were adjusted to 1.5×10 8 CFU / mL, the viable count of Streptococcus mutans CICC10438 was adjusted to 7.5×10 7 CFU / mL.

[0190] (3) Pre-incubation of probiotics Lactobacillus paracasei HOM1212 strain and Lactobacillus rhamnosus GG strain with artificial saliva containing bovine serum albumin (BSA)

[0191] In the experimental group, the bacterial suspension of probiotics Lactobacillus paracasei HOM1212 strain and Lactobacillus rhamnosus GG strain were mixed with saliva at a volume ratio of 1:1, incubated anaerobically at 37°C for 1 hour, and the samples were filtered through a 0.22 μm filter membrane after the incubation. In the control group, the probiotics were replaced with sterile KCl buffer.

[0192] (4) Establishment of tooth model and adhesion of Lactobacillus paracasei HOM1212 and Lactobacillus rhamnosus GG to Streptococcus mutans CICC10438

[0193] The pre-incubated saliva was mixed with hydroxyapatite at room temperature for 1 hour, the saliva was removed after mixing, and the mixture was rinsed 3 times with sterile KCl buffer. Mutans Streptococcus CICC10438 was added and mixed at room temperature for 1 hour. The mixture was rinsed 3 times with sterile KCl buffer to remove the unadhered Mutans Streptococcus CICC10438. The sample was ultrasonically treated for 15 minutes, and the adhered bacteria were stained with Nile red for 1 hour. The cell-related fluorescence intensity (excitation wavelength 530 nm, emission wavelength 570 nm) was measured. The results are shown in Figure 4 .

[0194] The adhesion of Streptococcus mutans to teeth is a crucial step in the formation of biofilm. Figure 4 It can be seen that both Lactobacillus paracasei HOM1212 and Lactobacillus rhamnosus GG can reduce the adhesion of Streptococcus mutans CICC10438 to the tooth model (p<0.01). This shows that Lactobacillus paracasei HOM1212 can effectively inhibit the adhesion of Streptococcus mutans on teeth, thereby reducing the formation of biofilm and dental caries.

[0195] Example 14 Fermented milk test

[0196] Weigh 12 g skim milk powder, 2 g glucose, and 2 g yeast powder, add double distilled water to 100 mL, stir evenly, homogenize with a high-pressure homogenizer (60°C, 22 MPa), sterilize at 95°C for 10 min, and cool to 37°C for use.

[0197] The Lactobacillus paracasei HOM1212 strain prepared in Example 1 was inoculated into MRS liquid culture medium and cultured at 37° C. for 18 h. The culture was subcultured twice according to this method to obtain a high-activity bacterial solution for standby use.

[0198] The obtained bacterial solution was eluted and resuspended with 0.9% saline at 1×10 7 CFU / mL inoculation amount was inoculated into the milk, mixed evenly, and fermented at a constant temperature of 37°C for 16 hours to obtain a fermented dairy product. The content of active Lactobacillus paracasei HOM1212 strain in the fermented milk was higher than 4.0×10 8 CFU / mL, pH can reach 4.60, with a mellow taste, sweet and sour.

[0199] Example 15 Fermented oat milk test

[0200] Weigh 120 g of enzymatically hydrolyzed oatmeal powder and 20 g of yeast powder, add double distilled water to 1000 mL, homogenize at 200 bar, sterilize at 90 °C for 10 min, and cool to 37 °C for later use.

[0201] The seed liquid of Lactobacillus paracasei HOM1212 strain prepared in Example 1 was inoculated into MRS liquid culture medium, cultured at 37° C. for 18 h, subcultured twice, and a high-concentration bacterial liquid was obtained, which was stored at low temperature for later use.

[0202] The bacterial solution was washed with 0.9% saline and resuspended at 1×10 7 CFU / mL inoculation amount was inoculated into oat slurry, mixed evenly, and kept at 37°C for 6 hours to obtain fermented oat milk. The viable bacterial count of Lactobacillus paracasei HOM1212 strain in the fermented milk was higher than 8.5×10 8 CFU / mL, pH can be reduced to 4.50, and the taste is rich.

[0203] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes. They can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and the details shown and described herein.

Claims

1. A Lacticaseibacillus paracasei strain, characterized in that The deposit number of the Lactobacillus paracasei strain is CGMCC No.27974.

2. The Lactobacillus paracasei strain according to claim 1, characterized in that The Lactobacillus paracasei strain comprises the 16S rRNA gene represented by SEQ ID NO:

1.

3. Application of Lactobacillus paracasei strain according to claim 1 in the preparation of a product for preventing or treating dental caries.

4. The use according to claim 3, characterized in that: The strain is used to inhibit the growth of Streptococcus mutans.

5. The use according to claim 3, characterized in that: The strain is used for reducing the formation of dental plaque biofilm caused by mutans streptococci and reducing the content of mature dental plaque biofilm.

6. The use according to claim 3, characterized in that: The strain is used to inhibit the level of water-insoluble exopolysaccharide produced by mutans Streptococcus.

7. The use according to claim 3, characterized in that: The strain is used for reducing the expression levels of the cariogenic genes gtfB, gtfC, gtfD, ftf and LuxS of mutans streptococci.

8. The use according to claim 3, characterized in that: The strain is used for reducing the adhesion rate of Streptococcus mutans on a hydroxyapatite tooth model.

9. The use according to claim 3, characterized in that: The product is food, health care product, medicine or oral care product.

10. The use according to claim 9, characterized in that: The oral care product is selected from one or more of mouthwash, beverage, mouth spray, chewing gum, tooth gel, toothpaste, tooth powder, dental floss, tooth cleaning liquid, and tooth cleaning foam.

11. A fermentation product, characterized in that The fermentation product is obtained by fermenting the Lactobacillus paracasei strain according to claim 1 or 2.

12. The fermentation product according to claim 11, characterized in that The fermentation product is fermented milk, and the content of active Lactobacillus paracasei strains in the fermented milk is 4.0×10 8 CFU / mL and above.

13. The fermentation product according to claim 11, characterized in that The fermented product is fermented oat milk, and the number of viable bacteria of Lactobacillus paracasei in the fermented oat milk is 8.5×10 8 CFU / mL and above.

Images