Construction method and application of iPSC (induced pluripotent stem cell) derived mesenchymal stem cell strain for overexpressing VEGFA (vascular endothelial growth factor A) gene based on CRISPR / Cas9 (CRISPR / Cas9) technology

Abstract

The invention discloses a construction method and application of an iPSC-derived mesenchymal stem cell strain for overexpressing a VEGFA gene based on a CRISPR / Cas9 technology, and relates to the technical field of biological cells, the construction method of the iPSC-derived mesenchymal stem cell strain for overexpressing the VEGFA gene based on the CRISPR / Cas9 technology comprises the following steps: S1, designing sgRNA and ssDNA for an insertion site AAVS1, and detecting the cutting efficiency of the sgRNA; s2, introducing a CRISPR (clustered regularly interspaced short palindromic repeats) system into the cells in an electroporation manner to obtain an iPSC cell strain into which an exogenous gene VEGFA is inserted at a fixed point; s3, carrying out directional induced differentiation on the iPSC cell strain to the iMSC to obtain an iMSC cell strain with overexpression of VEGFA (Vascular Endothelial Growth Factor A) protein; the iMSC of the overexpressed VEGFA protein can well stimulate vascular endothelial growth and promote angiogenesis, and more possibilities are provided for repair treatment of ischemia-related diseases.

Description

Technical Field

[0001] The present invention relates to the field of biological cells, and in particular to a method for constructing an iPSC-derived mesenchymal stem cell line that overexpresses the VEGFA gene based on CRISPR / Cas9 technology and its application. Background Art

[0002] Gene Editing refers to the process of modifying specific targets in the genome of an organism through gene editing technology. Gene insertion, deletion or replacement can be achieved efficiently and accurately, thereby changing its genetic information and phenotypic characteristics.

[0003] To date, iMSC evaluation based on in vitro and in vivo studies has shown that iMSC have superior performance compared with primary or natural human-derived MSCs in terms of cell proliferation, expansion capacity, immunomodulatory properties, and effects on paracrine signaling and immunomodulation.

[0004] VEGFA is a glycoprotein composed of two domains: the extracellular region and the intracellular region. The extracellular region has a variety of biological activities, such as stimulating vascular endothelial growth and promoting angiogenesis. The intracellular region contains the vascular endothelial growth factor A gene (VEGFA gene), which encodes a protein that plays an important role in vascular endothelial cells.

[0005] The existing technology has not constructed a stable, long-term overexpression of VEGFA iMSC cell line through gene editing, which is inconvenient to be used for the symptoms of lower limb ischemia; therefore, in view of this situation, there is an urgent need to develop a construction method and application of an iPSC-derived mesenchymal stem cell line overexpressing the VEGFA gene based on CRISPR / Cas9 technology to meet actual needs. Summary of the invention

[0006] In view of this, the present invention aims at the deficiencies in the prior art, and its main purpose is to provide a construction method and application of an iPSC-derived mesenchymal stem cell line that overexpresses the VEGFA gene based on CRISPR / Cas9 technology. The construction method uses the gene-editing CRISPR system to introduce the VEGFA gene into the iPSC genome to achieve high expression of the VEGFA protein, and then induces the iPSC cell line to differentiate into iMSC to obtain iMSC that overexpresses the VEGFA protein. The iMSC that overexpresses the VEGFA protein of the present invention can well stimulate the growth of vascular endothelial cells and promote angiogenesis, providing more possibilities for the repair and treatment of ischemia-related diseases.

[0007] To achieve the above purpose, the present invention adopts the following technical solutions: A method for constructing an iPSC-derived mesenchymal stem cell line that overexpresses the VEGFA gene based on CRISPR / Cas9 technology, comprising the following steps: S1. Design sgRNA and ssDNA for the insertion site AAVS1 and test the cutting efficiency of sgRNA; S2. Introduce the CRISPR system into cells by electroporation to obtain an iPSC cell line with the exogenous gene VEGFA inserted at a specific site; S3. Directed induction of differentiation of iPSC cell lines into iMSCs to obtain iMSC cell lines overexpressing VEGFA protein.

[0008] As a preferred embodiment, the cutting efficiency of sgRNA is detected in step S1 as follows: Cas9 protein and sgRNA incubated RNP are transfected into 293T cells, the cells are collected, genomic DNA is extracted, and PCR amplification is performed using the DNA as a template, and the primers are shown in SEQ ID NO: 3 and SEQ ID NO: 4; the PCR product is sequenced by Sanger to verify the cutting efficiency.

[0009] As a preferred embodiment: the sgRNA in step S1 is a chemically synthesized RNA, the sgRNA sequence is a sequence that can guide the Cas9 protein to accurately cut the AAVS1 site, and the sgRNA sequence is shown in SEQ ID NO: 1.

[0010] As a preferred embodiment: the CRISPR system in step S2 includes sgRNA, cas9 protein and a single-stranded DNA donor template encoding VEGFA.

[0011] As a preferred embodiment, the CRISPR system is introduced into the cells in step S2 as follows: Cas9 protein and sgRNA are mixed, incubated at room temperature to form an RNP mixture, and the RNP mixture and ssDNA are introduced into the host cells together by electroporation.

[0012] As a preferred embodiment: in step S2, the host cell is an iPSC cell, and the molar ratio of sgRNA to Cas9 protein in the RNP mixture is 1:1-1:3.

[0013] As a preferred embodiment: the VEGFA protein expression sequence of the iPSC cell line into which the exogenous gene VEGFA is site-specifically inserted in step S2 includes a promoter, homology arms, a VEGFA protein CDS region sequence, a connecting peptide, a puromycin CDS region sequence and a terminator, the promoter is an EF1α promoter sequence, the connecting peptide is P2A, the terminator is a bGH Poly (A) signal sequence, and the VEGFA protein expression sequence is as shown in SEQ ID NO: 2.

[0014] As a preferred solution: in step S2, the CRISPR system is introduced into the cells by electroporation, and then the cells are screened, cultured and identified to select iPSC cell lines with inserted sequences.

[0015] As a preferred embodiment, the induced differentiation in step S3 is in vitro induced differentiation; the iPSC cell line is directed induced to differentiate into iMSC as follows: the iPSC cell line is induced to form a neural crest cell line through a first stage of culture, and the neural crest cell line is induced to differentiate into iMSC through a second stage to obtain an iMSC cell line that can overexpress VEGFA protein.

[0016] The application of the method for constructing an iPSC-derived mesenchymal stem cell line that overexpresses the VEGFA gene based on CRISPR / Cas9 technology, wherein the iMSC cell line that overexpresses the VEGFA protein is obtained by the construction method and is used for preparing cellular drugs for ischemia-related diseases.

[0017] Compared with the prior art, the present invention has obvious advantages and beneficial effects. Specifically, it can be seen from the above technical scheme that the present invention provides a method for constructing an iPSC-derived mesenchymal stem cell (iMSC) cell line that overexpresses the VEGFA gene based on CRISPR / Cas9 technology and its application. The construction method uses the gene-edited CRISPR system to introduce the VEGFA gene into the iPSC genome to achieve high expression of the VEGFA protein, and then the iPSC cell line is directed induced to differentiate into iMSC to obtain iMSC that overexpresses the VEGFA protein. The iMSC that overexpresses the VEGFA protein of the present invention can well stimulate the growth of vascular endothelial cells and promote angiogenesis, providing more possibilities for the repair and treatment of ischemia-related diseases.

[0018] In order to more clearly illustrate the structural features and effects of the present invention, it is described in detail below in conjunction with the accompanying drawings and specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is a schematic diagram of the structure of a single-stranded DNA template for overexpressing VEGFA at the AAVS1 site of the present invention; Figure 2 This is a schematic diagram of the sgRNA cutting efficiency of overexpressing VEGFA at the AAVS1 site of the present invention; Figure 3 A schematic diagram of agarose gel and sequencing results after overexpression of VEGFA at the AAVS1 site of the present invention; Figure 4 A schematic diagram of an iPSC clone overexpressing VEGFA and an iPSC-derived mesenchymal stem cell line of the present invention; Figure 5 Schematic diagram of the three-lineage differentiation of the iPSC-derived mesenchymal stem cell line overexpressing VEGFA of the present invention; Figure 6 It is a schematic diagram of the relative expression levels of markers of the iPSC-derived mesenchymal stem cell line overexpressing VEGFA of the present invention; Figure 7 It is a schematic diagram of the flow cytometry results of the markers of the iPSC-derived mesenchymal stem cell line overexpressing VEGFA of the present invention; Figure 8 It is a schematic diagram of the relative expression level of the VEGFA gene in the iPSC-derived mesenchymal stem cell line overexpressing VEGFA of the present invention; Fig. 9 It is a schematic diagram of the in vitro angiogenesis results of the iPSC-derived mesenchymal stem cell line overexpressing VEGFA of the present invention; Fig.10 This is a statistical diagram of the in vitro angiogenic effect of the iPSC-derived mesenchymal stem cell line overexpressing VEGFA of the present invention; Fig.11 This is a diagram showing the effect of ischemia-reperfusion on lower limbs of mice after treatment with the iPSC-derived mesenchymal stem cell line overexpressing VEGFA of the present invention; Fig.12 This is a statistical graph of lower limb ischemia-reperfusion data after treatment with the iPSC-derived mesenchymal stem cell line overexpressing VEGFA of the present invention. DETAILED DESCRIPTION

[0020] The present invention Figure 1 As shown in FIG12 , a method for constructing an iPSC-derived mesenchymal stem cell line overexpressing the VEGFA gene based on CRISPR / Cas9 technology comprises the following steps: S1. Design sgRNA and ssDNA for the insertion site AAVS1 and test the cutting efficiency of sgRNA; S2. Introduce the CRISPR system into cells by electroporation to obtain an iPSC cell line with the exogenous gene VEGFA inserted at a specific site; S3. Directed induction of differentiation of iPSC cell lines into iMSCs to obtain iMSC cell lines overexpressing VEGFA protein.

[0021] The specific method for detecting the cutting efficiency of sgRNA in step S1 is as follows: transfecting RNP incubated with Cas9 protein and sgRNA into 293T cells, collecting the cells, extracting genomic DNA, and performing PCR amplification using the DNA as a template, with primers as shown in SEQ ID NO: 3 and SEQ ID NO: 4; and verifying the cutting efficiency of the PCR product after Sanger sequencing.

[0022] In step S1, the sgRNA is a chemically synthesized RNA, and the sgRNA sequence is a sequence that can guide the Cas9 protein to accurately cut the AAVS1 site. The sgRNA sequence is shown in SEQ ID NO: 1.

[0023] In step S2, the CRISPR system includes sgRNA, cas9 protein and a single-stranded DNA donor template encoding VEGFA. The cas9 protein is selected from the finished wild-type Cas9 protein. The present application uses chemically synthesized Cas9 protein, sgRNA and ssDNA, which have lower toxicity, higher insertion efficiency and are safer.

[0024] In step S2, the CRISPR system is introduced into the cells as follows: Cas9 protein and sgRNA are mixed, incubated at room temperature to form an RNP mixture, and the RNP mixture and ssDNA are introduced into the host cells together by electroporation.

[0025] In step S2, the host cell is an iPSC cell, and the molar ratio of sgRNA to Cas9 protein in the RNP mixture is 1:1-1:3.

[0026] The VEGFA protein expression sequence of the iPSC cell line into which the exogenous gene VEGFA is site-specifically inserted in step S2 includes a promoter, homology arms, a VEGFA protein CDS region sequence, a connecting peptide, a puromycin CDS region sequence and a terminator, wherein the promoter is an EF1α promoter sequence, the connecting peptide is P2A, the terminator is a bGH Poly (A) signal sequence, and the VEGFA protein expression sequence is as shown in SEQ ID NO: 2.

[0027] In step S2, the CRISPR system is introduced into the cells by electroporation, and then the cells are screened, cultured and identified to select iPSC cell lines with the inserted sequence.

[0028] The induced differentiation in step S3 is in vitro induced differentiation; the iPSC cell line is directed to iMSC as follows: the iPSC cell line is induced to form a neural crest cell line through a first stage of culture, and the neural crest cell line is induced to differentiate towards iMSC through a second stage, thereby obtaining an iMSC cell line that can overexpress VEGFA protein.

[0029] The application of the method for constructing an iPSC-derived mesenchymal stem cell line that overexpresses the VEGFA gene based on CRISPR / Cas9 technology, the iMSC cell line that overexpresses the VEGFA protein obtained by the construction method is used to prepare cell drugs for ischemia-related diseases.

[0030] Example 1: A method for constructing an iPSC-derived mesenchymal stem cell line overexpressing the VEGFA gene based on CRISPR / Cas9 technology, comprising the following steps: S1. Design sgRNA and ssDNA for the insertion site AAVS1 and test the cutting efficiency of sgRNA: Design of sgRNA and ssDNA For the insertion site AAVS1, sgRNA was designed using the sgRNA design website https: / / chopchop.cbu.uib.no / ; the schematic diagram of the ssDNA structure is shown in Figure 1 shown.

[0031] sgRNA efficiency test (1) Cas9 protein and sgRNA-incubated RNPs were transfected into 293T cells by electroporation. Cells were collected 48 hours after transfection and genomic DNA was extracted.

[0032] (2) PCR amplification was performed using the above DNA as a template, and the primers were as shown in SEQ ID NO:3 and SEQ ID NO:4; the PCR product was sequenced by Sanger sequencing to verify the cleavage efficiency, as shown in Figure 2 shown.

[0033] S2. Introduce the CRISPR system into cells by electroporation to obtain an iPSC cell line with the exogenous gene VEGFA inserted at a specific site; Transduction of foreign genes (1) iPSC recovery and culture: Prepare Matrigel-coated cell culture plates 30 minutes in advance, and prepare stem cell culture medium with CEPT added to inhibit cell apoptosis and promote cell adhesion. Open the water bath, take out the iPSC cells from the liquid nitrogen tank, immediately put them into a 37°C water bath, shake them continuously until they are completely melted, and wipe the outer wall of the cryopreservation tube with alcohol. Take a 15ml centrifuge tube, add 5ml PBS, transfer the cells from the cryopreservation tube to the 15ml centrifuge tube, mix gently, and centrifuge at 200g for 4min. Discard the supernatant, resuspend the cells with stem cell culture medium with CEPT added to inhibit cell apoptosis and promote cell adhesion, inoculate the cells into Matrigel-coated cell culture plates, and culture them in a 37°C incubator overnight.

[0034] (2) Electroporation: When the density of iPSC grows to 90%, start electroporation. Prepare cas9 protein, sgRNA and electroporation solution, mix them evenly, leave them at room temperature for half an hour to form RNP structure, then mix them with ssDNA, leave them at room temperature for 2 minutes, and the electroporation system is complete. Resuspend the prepared cells with the total system and perform electroporation. After completion, inoculate the cells into Matrigel-coated cell culture plates and culture them in a 37°C incubator overnight.

[0035] (3) Isolation and identification of clones: After 24 hours, the cells were replaced with a new medium. After two days of culture, the cells were digested and counted. 5,000 cells were inoculated into one well of a six-well plate, shaken evenly by the "cross shaking method", and cultured overnight in a 37°C incubator. After 24 hours, the medium was replaced. After 10 days of culture, a single clone was picked and transferred to a 48-well plate. The cells were amplified once in the middle. After 5 days, the cells were collected, some for seed preservation and some for identification.

[0036] The harvested clones were lysed, and the lysate was used as a template for PCR amplification and sequencing. After amplification and sequencing, iPSCs with homozygous insertions were obtained. The primers are shown in SEQ ID NO: 5 and SEQ ID NO: 6; the sequencing results of the positive clones are shown in Figure 3 shown.

[0037] S3. Directed differentiation of iPSC cell lines into iMSCs to obtain iMSC cell lines that overexpress VEGFA protein Directed differentiation of iPSCs into iMSCs The iPSC cell line was induced to form a neural crest cell line after the first stage of culture, that is, the iPSC cell density was cultured to 50% and iMSC differentiation medium (E6+ SB431542+ CHIR99021) was added and cultured for 7 days; the neural crest cell line was induced to differentiate into iMSC in the second stage to obtain an iMSC cell line that can overexpress VEGFA protein, that is, after 7 days, the cells were passaged, the culture medium was replaced with MSC culture medium, and culture was continued. After 14 days, photos were taken and observed to obtain gene-overexpressing iMSC; the pictures of iPSC and iMSC are shown in Figure 4 As shown, it is consistent with normal cell morphology.

[0038] The cells were collected for iMSC tri-lineage differentiation identification, and the results of adipogenesis, osteogenic and chondrogenic differentiation were as follows Figure 5 As shown, all of them are consistent with the tri-lineage differentiation morphology of normal iMSCs.

[0039] The results of QPCR detection of iMSC markers for successful differentiation of iPSC into iMSCs are as follows Figure 6As shown, iPSC markers SOX2, OCT4, and NANOG are lowly expressed or not expressed, and iMSC markers CD73, CD90, and CD105 are highly expressed. QPCR primers are shown in SEQ ID NO:7 to SEQ ID NO:20.

[0040] The flow cytometry results are as follows Figure 7 As shown, the nine markers of iMSCs overexpressing VEGFA were in line with normal standards.

[0041] Effect Example 1: Detection of relative expression of VEGFA gene after iMSC differentiation The cells were harvested with trizol, and the RNA of the cells was extracted using the chloroform-alcohol method. cDNA was obtained by reverse transcription. The primers are shown in SEQ ID NO: 21 and SEQ ID NO: 22. The QPCR results are shown in Figure 8 As shown in Figure 3, gene-edited overexpressed iMSCs highly expressed VEGFA, with the expression level being more than 200 times that of WT-iMSCs.

[0042] Effect Example 2: In vitro functional verification of gene-edited overexpressed iMSCs The resuscitated HUC-MSCs were resuspended in MSC complete medium and inoculated in the upper chamber of Transwell according to SOP; corresponding control wells were set up and cultured overnight in a 37°C, 5% CO2 incubator. 24-well Transwell lower chamber coating: pre-cool PBS and related consumables (pipette tips, 24-well plates) in advance, place the matrix gel in an ice box at 4° refrigerator overnight to dissolve, dilute the matrix gel in proportion on the ice box, centrifuge briefly to remove the bubbles in the middle of the gel, draw an appropriate amount of diluted matrix gel, drop it vertically in the middle of the 24-well plate, tap it evenly on ice, and place it in a 37° constant temperature incubator to solidify for one and a half hours. The resuscitated HUVECs were inoculated in the lower chamber of 24-well Transwell. One hour after HUVECs were placed in the lower chamber, the pre-placed upper chamber MSCs were placed, and then observed once every 2 hours. After a large number of vascular networks were formed, the culture medium in the upper well was carefully removed. Add 300 μl of Calcein-AM diluted with D-PBS to a final concentration of 6.25 μg / ml (1u was added to 1ml of culture medium for dilution). Incubate with Calcein-AM (final concentration 6.25μg / ml) in the dark for 30 minutes, wash with D-PBS 3 times (add carefully along the tube wall to avoid washing away the vascular network), and take photos at 485 / 529nm. The photos were analyzed using software. The results are shown in the figure below. Fig. 9 and Fig.10 As shown, the angiogenic effect of iMSCs overexpressing VEGFA was greater than that of WT-iMSCs and greater than that of UC-MSCs.

[0043] Effect Example 3: In vivo functional verification of gene-edited overexpressed iMSCs (1) Construction of mouse hind limb ischemia model The mice were anesthetized with isoflurane, placed on a constant temperature platform, and alcohol was sprayed on the thigh joint of the left lower limb of the mice. The skin of the left lower limb of the mice was cut open with scissors, and the common iliac artery and femoral artery of the mice were ligated with sutures and cut in the middle, and then the skin of the left lower limb of the mice was sutured. The physical signs of the mice were checked, and the laser speckle blood flowmeter was used to check whether the model was successful.

[0044] (2) Injection of cells for lower limb ischemia in mice Cell injection was performed within 24 hours after model establishment, with a cell volume of 1x10 6 The injection site was intramuscular injection around the ligature. The blood flow and lower limb conditions of the mice were observed 7, 14, 21, and 28 days after injection. Fig.11 and Fig.12 As shown in the figure, the application effect of gene-edited iMSC is better than that of unedited WT-iMSC and UC-MSC. It is confirmed that iMSC overexpressing VEGFA protein is successfully applied to the problem of lower limb ischemia in mice.

[0045] The design focus of the present invention is that the present invention provides a construction method and application of an iPSC-derived mesenchymal stem cell (iMSC) cell line that overexpresses the VEGFA gene based on CRISPR / Cas9 technology. The construction method uses the gene-editing CRISPR system to introduce the VEGFA gene into the iPSC genome to achieve high expression of the VEGFA protein, and then the iPSC cell line is directed induced to differentiate into iMSC to obtain iMSC that overexpresses the VEGFA protein. The iMSC that overexpresses the VEGFA protein of the present invention can well stimulate the growth of vascular endothelial cells and promote angiogenesis, providing more possibilities for the repair and treatment of ischemia-related diseases.

[0046] The above description is only a preferred embodiment of the present invention and does not limit the technical scope of the present invention. Therefore, any slight modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention are still within the scope of the technical solution of the present invention. Sequence Listing: SEQ ID NO:1 GGGGCCACTAGGGACAGGAT SEQ ID NO:2 <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:3<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> AGCCACCTCTCCATCCTCTT<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:4<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ATCCTCTCTGGCTCCATCGT<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:5<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> TCGACTTCCCCTCTTCCGAT<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:6<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> CCCGAAGAGTGAGTTTGCCA<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:7<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> GCTACAGCATGATGCAGGACCA<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:8<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> TCTGCGAGCTGGTCATGGAGTT<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:9<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> CCTGAAGCAGAAGAGGATCACC<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:10<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> AAAGCGGCAGATGGTCGTTTGG<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:11<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> CTCCAACATCCTGAACCTCAGC<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:12<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> CGTCACACCATTGCTATTCTTCG<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:13<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> AGTCCACTGGAGAGTTCCTGCA<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:14<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> TGAGAGGGTCATAACTGGGCAC<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:15<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> GAAGGTCCTCTACTTATCCGCC<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:16<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> TGATGCCCTCACACTTGACCAG<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:17<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> CGGTGGTCAATATCCTGTCGAG<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:18<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> AGGAAGTGTGGGCTGAGGTAGA<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:19<h2 style=";text-align:left;direction:ltr"> GTCTCCTCTGACTTCAACAGCG SEQ ID NO:20 ACCACCCTGTTGCTGTAGCCAA SEQ ID NO:21 TTGCCTTGCTGCTCTACCTCCA SEQ ID NO:22 GATGGCAGTAGCTGCGCTGATA

Claims

1. A method for constructing an iPSC-derived mesenchymal stem cell line overexpressing the VEGFA gene based on CRISPR / Cas9 technology, characterized in that: The steps include: S1. Design sgRNA and ssDNA for the insertion site AAVS1 and test the cutting efficiency of sgRNA; S2. Introduce the CRISPR system into cells by electroporation to obtain an iPSC cell line with the exogenous gene VEGFA inserted at a specific site; S3. Directed induction of differentiation of iPSC cell lines into iMSCs to obtain iMSC cell lines overexpressing VEGFA protein.

2. The method for constructing an iPSC-derived mesenchymal stem cell line overexpressing the VEGFA gene based on CRISPR / Cas9 technology according to claim 1, characterized in that: The sgRNA cutting efficiency detection in step S1 is specifically as follows: the Cas9 protein and the sgRNA incubated RNP are transfected into 293T cells, the cells are collected, the genomic DNA is extracted, and the DNA is used as a template for PCR amplification, and the primers are shown in SEQ ID NO: 3 and SEQ ID NO: 4; the PCR product is subjected to Sanger sequencing to verify the cutting efficiency.

3. The method for constructing an iPSC-derived mesenchymal stem cell line overexpressing the VEGFA gene based on CRISPR / Cas9 technology according to claim 2, characterized in that: In step S1, the sgRNA is a chemically synthesized RNA, and the sgRNA sequence is a sequence that can guide the Cas9 protein to accurately cut the AAVS1 site. The sgRNA sequence is shown in SEQ ID NO:

1.

4. The method for constructing an iPSC-derived mesenchymal stem cell line overexpressing the VEGFA gene based on CRISPR / Cas9 technology according to claim 1, characterized in that: The CRISPR system in step S2 includes sgRNA, cas9 protein and a single-stranded DNA donor template encoding VEGFA.

5. The method for constructing an iPSC-derived mesenchymal stem cell line overexpressing the VEGFA gene based on CRISPR / Cas9 technology according to claim 4, characterized in that: In step S2, the CRISPR system is introduced into the cells as follows: Cas9 protein and sgRNA are mixed, incubated at room temperature to form an RNP mixture, and the RNP mixture and ssDNA are introduced into the host cells together by electroporation.

6. The method for constructing an iPSC-derived mesenchymal stem cell line overexpressing the VEGFA gene based on CRISPR / Cas9 technology according to claim 5, characterized in that: In step S2, the host cell is an iPSC cell, and the molar ratio of sgRNA to Cas9 protein in the RNP mixture is 1:1-1:

3.

7. The method for constructing an iPSC-derived mesenchymal stem cell line overexpressing the VEGFA gene based on CRISPR / Cas9 technology according to claim 1, characterized in that: The VEGFA protein expression sequence of the iPSC cell line into which the exogenous gene VEGFA is site-specifically inserted in step S2 includes a promoter, a homology arm, a VEGFA protein CDS region sequence, a connecting peptide, a puromycin CDS region sequence and a terminator, wherein the promoter is an EF1α promoter sequence, the connecting peptide is P2A, the terminator is a bGH Poly (A) signal sequence, and the VEGFA protein expression sequence is as shown in SEQ ID NO:

2.

8. The method for constructing an iPSC-derived mesenchymal stem cell line overexpressing the VEGFA gene based on CRISPR / Cas9 technology according to claim 1, characterized in that: In step S2, the CRISPR system is introduced into the cells by electroporation, and then the cells are screened, cultured and identified to select iPSC cell lines with inserted sequences.

9. The method for constructing an iPSC-derived mesenchymal stem cell line overexpressing the VEGFA gene based on CRISPR / Cas9 technology according to claim 1, characterized in that: The induced differentiation in step S3 is in vitro induced differentiation; the iPSC cell line is induced to differentiate into iMSC specifically as follows: the iPSC cell line is induced to form a neural crest cell line through a first stage of culture, and the neural crest cell line is induced to differentiate into iMSC through a second stage to obtain an iMSC cell line that can overexpress VEGFA protein.

10. An application of the method for constructing an iPSC-derived mesenchymal stem cell line overexpressing the VEGFA gene based on CRISPR / Cas9 technology as described in any one of claims 1 to 9, characterized in that: The iMSC cell line overexpressing VEGFA protein obtained by the construction method is used for preparing cell medicines for ischemia-related diseases.

Images