Canine parvovirus CPV-2c subtype virus strain and application thereof

Abstract

The invention discloses a canine parvovirus CPV-2c subtype virus strain and application thereof, and relates to the technical field of biology. The canine parvovirus CPV-2c subtype virus strain is preserved in the China Center for Type Culture Collection on November 12, 2024, the preservation address is Wuhan University, Wuhan, China, and the preservation number is CCTCC NO: V202492. Genetic evolution analysis shows that the canine parvovirus CPV-2c subtype virus strain obtained through separation has a better genetic relationship with other epidemic strains published domestically. The strain has good pathogenicity, can show typical CPV clinical symptoms when infected dogs, has great advantages for verifying therapeutic drugs and evaluating vaccine efficacy in vivo, and plays an important role in research and development of the therapeutic drugs and vaccines. In addition, the strain can be cultured and proliferated in vitro and has the potential of being developed into vaccines.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a canine parvovirus CPV-2c subtype virus strain and application thereof. Background Art

[0002] Canine parvovirus disease is an acute and severe infectious disease caused by canine parvovirus (CPV). It is divided into enteritis type and myocarditis type according to clinical symptoms. Dogs with enteritis type are often accompanied by symptoms such as loss of appetite, depression, fever, vomiting, diarrhea, dehydration, etc. In addition, dogs usually excrete "tomato-like feces" with a foul odor. Myocarditis type often occurs in puppies, and once it occurs, the mortality rate is close to 100%.

[0003] CPV belongs to the Protoparvovirus genus of the Parvoviridae family. It is a single-stranded negative-strand DNA virus. The total length of the viral genome is about 5200 nt, including two open reading frames (ORFs), encoding non-structural proteins (NS1 and NS2) and structural proteins (VP1 and VP2), respectively. There are hairpin structures at both ends of the genome that regulate gene replication and expression. The virus particles have no envelope and are icosahedral structures with a diameter of 25 nm. The capsid is composed of 6 structural proteins VP1 and 54 VP2, of which VP2 plays an important role in virus infection and determining the host range.

[0004] Appel et al.'s survey results showed that CPV-2 began to spread widely around the world in the 1990s. Since then, under the selection pressure and the replication mismatch of the virus itself, new variants have continued to appear. CPV-2a (426Asn), CPV-2b (Asn 426Asp), and CPV-2c (Asn 426Glu) were discovered and reported in 1979, 1984, and 2000, respectively. In addition, new CPV-2a and new CPV-2b were discovered in succession at the end of the 20th century. With the continuous emergence of new genotypes, the pathogenicity of CPV is also constantly changing.

[0005] Although China has a vast territory and the prevalence of CPV varies in various regions of the country, a large number of recent survey results have shown that CPV-2c has become the main prevalent genotype in China.

[0006] Vaccination is currently the most effective and economical means of prevention and control, but interference from maternal antibodies, unscientific immunization procedures, unreasonable vaccine storage methods, incorrect vaccine injection techniques, and differences between vaccine strains and epidemic strains can all lead to immunization failure, which is also an important reason for the frequent occurrence of canine parvovirus disease in clinical practice. Once canine parvovirus infection occurs, symptomatic treatment, antiviral therapy, and supportive therapy are mostly used clinically, among which antiviral therapy plays a key role. However, in the screening of antiviral drugs and the evaluation of the effectiveness of serum treatment, an ideal and representative indicator strain is crucial.

[0007] Therefore, isolating a strain with strong pathogenicity and representative of CPV-2c is of great significance in the process of screening antiviral drugs, evaluating the effects of therapeutic antibodies and the immune protection effects of vaccines. Summary of the invention

[0008] The purpose of the present invention is to provide a canine parvovirus CPV-2c subtype virus strain and its application to solve the problems existing in the above-mentioned prior art. The strain has good pathogenicity, and infected dogs can show typical CPV clinical symptoms, which has great advantages for in vivo verification of therapeutic drugs and evaluation of vaccine efficacy, and plays an important role in the research and development of therapeutic drugs and vaccines.

[0009] To achieve the above object, the present invention provides the following solutions:

[0010] The present invention provides a canine parvovirus (Canine Parvovirus), which is a CPV-2c subtype virus strain CPV-Ao. The CPV-2c subtype virus strain CPV-Ao was deposited in the China Center for Type Culture Collection on November 12, 2024, with a deposit address of Wuhan University, Wuhan, China, and a deposit number of CCTCC NO: V202492.

[0011] The present invention also provides the use of the canine parvovirus in the effect evaluation of anti-canine parvovirus drugs or vaccines.

[0012] The present invention also provides use of the canine parvovirus strain in preparing a canine parvovirus vaccine.

[0013] The present invention also provides a canine parvovirus vaccine, the active component of which includes the canine parvovirus that has been attenuated and / or inactivated.

[0014] Furthermore, the canine parvovirus vaccine also includes a pharmaceutically acceptable excipient.

[0015] The present invention also provides a method for preparing the canine parvovirus vaccine, comprising the steps of attenuating and / or inactivating the canine parvovirus to obtain the canine parvovirus vaccine.

[0016] The present invention also provides the use of the canine parvovirus in preparing canine parvovirus antibodies.

[0017] Furthermore, the canine parvovirus antibody includes a binding antibody or a neutralizing antibody.

[0018] The present invention also provides the use of the canine parvovirus in preparing a product for detecting canine parvovirus.

[0019] Furthermore, the product includes a reagent or a kit.

[0020] The present invention discloses the following technical effects:

[0021] The present invention isolates a canine parvovirus CPV-2c subtype virus strain, and genetic evolution analysis shows that the strain has a better relationship with other epidemic strains published in China. The strain has good pathogenicity, and infected dogs can show typical CPV clinical symptoms, which has great advantages for in vivo verification of therapeutic drugs and evaluation of vaccine efficacy, and plays an important role in the research and development of therapeutic drugs and vaccines. In addition, the strain can be cultured and proliferated in vitro, and has the potential to be developed into a vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0023] Figure 1 Microscopic observations of normal F81 cells and CPV-Ao infected F81 cells;

[0024] Figure 2 The figure is the result of PCR detection of CPV-Ao; wherein, lane 1 represents marker 2000bp, lane 2 represents CPV-Ao, and lanes 3 and 4 represent positive control CPV-2 and negative control respectively;

[0025] Figure 3 Indirect immunofluorescence detection of normal F81 cells and CPV-Ao infected F81 cells;

[0026] Figure 4 This is the genetic evolutionary tree diagram of CPV-Ao;

[0027] Figure 5 is the growth curve of CPV-Ao;

[0028] Figure 6 The figure is the body temperature statistics of dogs in the challenge group and the blank control group;

[0029] Figure 7 The figure is a statistical chart of the weight of dogs in the challenge group and the blank control group;

[0030] Figure 8 The figure is a statistical chart of lymphocyte counts of dogs in the challenge group and the blank control group;

[0031] Fig. 9 It is the survival curve of dogs in the challenge group and the blank control group;

[0032] Fig.10 The intestinal pathological sections of CPV-Ao challenged dogs and blank control dogs;

[0033] Fig.11 The statistical chart of body temperature of dogs immunized with vaccine A and dogs controlled with DMEM after CPV-Ao challenge;

[0034] Fig.12 This is a statistical chart of the body weight of dogs immunized with vaccine A and DMEM control dogs after CPV-Ao challenge;

[0035] Fig.13 This is a statistical graph of the number of lymphocytes in dogs immunized with vaccine A and dogs controlled with DMEM after CPV-Ao challenge;

[0036] Fig.14 This is a statistical chart of the survival rate of dogs immunized with vaccine A and dogs controlled with DMEM after CPV-Ao challenge;

[0037] Fig.15 These are intestinal pathological sections of dogs immunized with vaccine A and DMEM control dogs after CPV-Ao challenge. DETAILED DESCRIPTION

[0038] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0039] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0040] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0041] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0042] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0043] Example 1 Isolation and Identification of CPV-Ao

[0044] 1. Methods

[0045] 1. Separation

[0046] (1) Vortex the CPV-positive anal swab from a pet hospital with sterile PBS for 1 min, 4°C, 8000 rpm, 20 min. Centrifuge to obtain the supernatant, filter with a 0.22 μm filter, dispense into sterile EP tubes, and store at -80°C as the virus to be isolated.

[0047] (2) F81 cells in good growth condition were inoculated into six-well plates. When the cell confluence reached 50%-60%, the supernatant obtained in (1) was diluted with DMEM culture medium at a ratio of 1:100 and then inoculated into cat kidney cells (F81). The cells were placed in a 37°C incubator for adsorption for 2 h, and then replaced with 2% DMEM maintenance medium containing 2x double antibody and placed in a 37°C, 5% CO2 incubator for 3-5 days to observe whether any lesions appeared.

[0048] (3) If no lesions appear in the first generation, take out the first generation culture and freeze-thaw it three times between -80℃ and room temperature, at 8000rpm, 4℃, 20min, take the supernatant, and inoculate it on 50%-60% density F81 cells at a ratio of 1:10, adsorb for 2h, change to maintenance medium, culture for 5d, and observe lesions. Repeat this blind transmission for 3-5 generations until lesions appear.

[0049] (4) The passage with pathological changes was frozen and thawed three times, centrifuged, and the supernatant was collected and dispensed into sterile centrifuge tubes. This was the original virus, recorded as the P0 generation virus. The isolated strain was named CPV-Ao.

[0050] 2. Plaque Purification

[0051] (1) After the F81 cells were evenly digested, the cell concentration was adjusted and inoculated into a 6-well plate at an appropriate concentration. When the cell density was 50%-60%, CPV-Ao virus solution was prepared and diluted 10 times to obtain five concentrations of virus solution. 100 μL of the diluted virus solution was added to each well and adsorbed at 37°C for 2 h. The plate was shaken every 15 min to allow the virus solution to fully adsorb the cells. After 2 h, the virus solution was discarded and washed twice with PBS.

[0052] (2) Prepare a 2% low melting point agarose solution, melt it at 72°C, and keep it warm in a 37°C water bath. Preheat 2×DMEM in a 37°C water bath as well.

[0053] (3) The above 2% low melting point agarose solution was mixed with 2×DMEM maintenance solution (2% serum, 1% double antibody in a ratio of 1:1) and added to each well, 2 mL / well. The 6-well plate was placed in a 4°C refrigerator for 10 min to allow it to fully solidify. After the agarose solidified, it was inverted and cultured in a 37°C, CO2 incubator. The lesions were observed at 24 and 36 hours.

[0054] (4) Observe under light, mark the plaques, select plaques of appropriate size and pick them up together with agar using a yellow gun tip. Cut off the tip in advance to make the gun tip caliber similar to the plaque size. Then use a pipette to directly aspirate the covering material into the gun tip and dissolve it in an appropriate amount of cell culture medium for the next round of virus proliferation and identification. Repeat this process for 3 rounds.

[0055] 3. Identification

[0056] (1) PCR identification: Extract the genome of the virus liquid with pathological changes and perform PCR identification. The identification system is 5μL of 2×Taqmaster mix, 0.5μL of upstream primer, 0.5μL of downstream primer, 1μL of template, and 3μL of water. Mix the above reagents thoroughly and amplify under the following conditions: denaturation at 95℃ for 3min and then enter the cycle. The cycle parameters are: 95℃ for 15s, 56℃ for 15s, 72℃ for 30s, and extension at 72℃ for 10min after 35 cycles, and 16℃ for 5min. After the reaction is completed, the PCR reaction solution is detected by agarose gel electrophoresis.

[0057] Primer sequences: Upstream primer: GAATCTGCTACTCAGCCACCAAC (SEQ ID NO. 3); Downstream primer: GTGCACTATAACCAACCTCAGC (SEQ ID NO. 4).

[0058] (2) Indirect immunofluorescence identification (IFA): F81 cells in good growth state were inoculated into 12-well plates. When the confluence reached about 50-60%, 100 μL of virus solution was added, adsorbed for 2 hours, replaced with 2% maintenance solution, and placed in an incubator for 48 hours. When 50% of the lesions appeared, the culture medium in the wells was discarded, washed with PBS three times, and then 4% paraformaldehyde was added for 30 minutes at room temperature; the waste liquid was discarded, washed with PBS three times, and then blocked with blocking solution containing 1% BSA in PBST at 37°C for about 1 hour; after washing with PBS three times, a 1:3000 dilution of primary antibody (CPV mouse monoclonal antibody 3A7) was added, and incubated at 37°C for 1 hour; after washing with PBST for 4 times, a 1:1000 dilution of goat anti-mouse fluorescent secondary antibody was added, and incubated at 37°C for 1 hour in the dark; the secondary antibody was discarded, washed with PBS three times, 1 mL of PBST was added to each well, and the images were observed under a fluorescence microscope and collected.

[0059] 4. Growth characteristics study

[0060] The purified CPV-Ao was inoculated synchronously with the digested and resuspended F81 cells at a ratio of 0.01 MOI in a 12-well plate. Three replicate wells were set up and the cell culture was collected at 24h, 48h, 72h, 96h and 120h, respectively. The cells were centrifuged at 12000rpm and 4℃ for 10min, and the supernatant was collected and stored at -80℃ for later use. After all the viruses were collected, the TCID 50 And draw a growth curve. TCID 50 The assay steps are as follows: after the prepared virus solution is thoroughly vortexed and mixed, 100 μL is pipetted into 900 μL DMEM, vortexed and mixed, and the dilution is repeated several times. Then, 100 μL of the diluted virus solution is added to the 96-well plate in accordance with the dilution multiple. Then, 100 μL of each well contains 1×10 4 The cell suspension of F81 cells was placed in a 37°C, 5% CO2 incubator for 4-5 days, and then IFA was performed to determine the virus titer. The results were processed with the help of GraphPad to create a growth curve.

[0061] 5. Biological Deposit

[0062] Canine Parvovirus (Canine Parvovirus) CPV-2c subtype virus strain CPV-Ao was deposited in the China Center for Type Culture Collection on November 12, 2024. The deposit address is Wuhan University, Wuhan, China, and the deposit number is CCTCCNO: V202492.

[0063] 2. Results

[0064] 1. Isolation and identification results

[0065] By isolating and identifying the virus from the samples of dogs suspected of being infected with CPV, a CPV-2c subtype virus strain was successfully isolated and named CPV-Ao. It showed CPV-like lesions on susceptible cells F81, with cells showing lesions such as netting, drawing, narrowing, breaking, and falling off ( Figure 1 ). By using CPV-specific primers for PCR detection, a band of corresponding size was detected ( Figure 2 ). Using IFA detection with CPV monoclonal antibody, specific fluorescence was detected in the cells ( Figure 3 In order to explore the genetic evolution relationship between this strain and domestic and foreign strains, the present invention constructed a genetic evolution tree, and the results showed that the CPV-Ao strain prevalent abroad has a closer relationship with the domestic prevalent strain ( Figure 4 ).

[0066] The nucleotide sequence of the VP2 gene of strain CPV-Ao (SEQ ID NO.1) is as follows:

[0067]

[0068] The nucleotide sequence of the genome of strain CPV-Ao (SEQ ID NO.2) is as follows:

[0069]

[0070] 2. Growth characteristics research results

[0071] Growth characteristics studies have shown that the CPV-Ao virus titer reaches its highest level and tends to stabilize at 96h-120h after infection. Figure 5 ).

[0072] Example 2 CPV-Ao pathogenicity study

[0073] The present invention uses 10 beagle dogs that are double negative for CPV antigen and antibody to explore the pathogenicity of the isolated CPV-Ao strain.

[0074] The beagle dogs were randomly divided into two groups (the challenge group and the blank control group), with 5 dogs in each group, and were housed in different animal rooms. Before the experiment, the two groups of dogs were weighed, their body temperatures were measured, and the number of lymphocytes was measured to obtain basic data before the challenge. After that, the challenge group was given 1 mL of the virus orally with a titer of 10 5.0 TCID 50 / mL of CPV-Ao virus solution, and the blank control group was orally administered with the same volume of culture medium (i.e., DMEM culture medium). From the day of the challenge, body temperature and body weight were measured every day, lymphocyte count was measured every 3 days, clinical symptoms were observed and recorded, and the entire experiment lasted for 14 days. Before the dogs in the challenge group died, they were anesthetized and bled, and the intestines were collected for pathological sections. After the entire observation period, the blank control dogs were also anesthetized, bled, and the intestines of the corresponding parts were collected for sections.

[0075] Since the beginning of the experiment, the body temperatures of all dogs were within the normal range in the first 3 days. From the 4th day, the dogs in the challenge group developed fever, which then began to decline until they died, while the body temperatures of the dogs in the blank control group always fluctuated within the normal range ( Figure 6 The results of weight measurement showed that the weight change trend of dogs in the challenge group and the blank control group was basically the same in the first 4 days. However, as the dogs in the challenge group became ill, their weight gradually decreased with the progression of the disease until they died, while the blank control group always showed an increasing trend ( Figure 7 Since CPV is an immunosuppressive pathogen, the change characteristics of lymphocyte count cannot be ignored. The experimental results showed that the lymphocyte count of the challenge group after CPV infection dropped below the normal value on the 6th day, while the blank control group remained in the normal range. Figure 8 After the entire 14-day observation period, the present invention conducted a survival curve analysis, and the mortality rate of the CPV-Ao-challenged dogs was 100%, while the blank control group was healthy and alive ( Fig. 9 CPV mainly infects the intestines. Pathological sections showed that the intestinal villi in the challenge group became shorter and fell off, while those in the blank control group were intact and normal ( Fig.10 ).

[0076] Example 3 Application of CPV-Ao strain in vaccine immune effect evaluation

[0077] Ten beagle experimental dogs with CPV neutralizing antibodies less than 1:32 were selected and divided into two groups. One group was immunized with vaccine A (Kewangfu; produced by Keqian Biotechnology Co., Ltd.), and the other group was given the same dose of DMEM culture medium as a control. Blood was collected and measured every week after immunization for 3 weeks. The blood collected in the third week was used to measure the number of lymphocytes, and the remaining part was used to measure the titer of CPV neutralizing antibodies. After blood collection, the two groups of dogs were orally challenged with CPV-Ao (each dog was gavaged with 1 mL of virus with a titer of 10 5.0 TCID 50 / mL of virus liquid). From the day of virus challenge, the body temperature and weight of the experimental dogs were measured daily, and the clinical symptoms were observed. The changes in the number of lymphocytes were measured every week. This process lasted for 2 weeks, and the experimental results were statistically analyzed.

[0078] The experimental results showed that after the virus attack, the body temperature of the vaccine-immunized group remained within the normal range without significant fluctuations, while the control group showed fever ( Fig.11 In addition, the body weight of the vaccine-immunized group was not significantly affected by the virus challenge and remained on the rise, while the body weight of the control group increased in the early period after the virus challenge, but gradually decreased as the disease progressed ( Fig.12 Although the lymphocyte count in the vaccine-immunized group decreased slightly, it recovered quickly and remained within the normal range. In the control group, the lymphocyte count continued to decrease as the disease progressed ( Fig.13 During the 14-day observation period, the vaccine group remained in good health and there was no death. The control group gradually became ill over time and eventually died. Fig.14 ). The intestinal tract of the vaccinated dogs and the dying control dogs after the virus attack was collected for pathological sections. The experimental results showed that the intestinal villi of the vaccinated dogs were normal, while the intestinal villi of the control dogs were obviously broken and shed ( Fig.15 ).

[0079] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A canine parvovirus, characterized in that The canine parvovirus is the CPV-2c subtype virus strain CPV-Ao. The CPV-2c subtype virus strain CPV-Ao was deposited in the China Center for Type Culture Collection on November 12, 2024. The deposit address is Wuhan University, Wuhan, China, and the deposit number is CCTCC NO: V202492.

2. Use of the canine parvovirus according to claim 1 in the evaluation of the effect of anti-canine parvovirus drugs or vaccines.

3. Use of the canine parvovirus according to claim 1 in the preparation of a canine parvovirus vaccine.

4. A canine parvovirus vaccine, characterized in that: The active ingredient comprises the canine parvovirus according to claim 1 which has been attenuated and / or inactivated.

5. The canine parvovirus vaccine according to claim 4, characterized in that The canine parvovirus vaccine further comprises a pharmaceutically acceptable excipient.

6. A method for preparing a canine parvovirus vaccine according to claim 4 or 5, characterized in that: The method comprises the steps of attenuating and / or inactivating the canine parvovirus according to claim 1 to obtain the canine parvovirus vaccine.

7. Use of the canine parvovirus according to claim 1 in preparing canine parvovirus antibodies.

8. The use according to claim 7, characterized in that: The canine parvovirus antibodies include binding antibodies or neutralizing antibodies.

9. Use of the canine parvovirus according to claim 1 in preparing a product for detecting canine parvovirus.

10. The use according to claim 9, characterized in that: The product comprises a reagent or a kit.

Images