GRNA sequence and application thereof in construction of osteosclerosis animal model
By designing the gRNA sequence targeting the mouse LRRK1 gene and using CRISPR-Cas9 technology to construct LRRK1 knockout mice, the problem of difficulty in effectively building an animal model of osteosclerosis in the existing technology is solved, and the pathological state of osteosclerosis is simulated and the bone density and structure of the mouse femur are significantly improved.
Patent Information
- Application Number
- CN202411674120.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-21
- Publication Date
- 2025-02-28
AI Technical Summary
The prior art is difficult to effectively construct animal models of osteosclerosis, especially in regulating osteoclast function and bone resorption, and there is a lack of effective targeting methods.
A pair of new gRNA sequences were designed to target the mouse LRRK1 gene and LRRK1 knockout mice were constructed through CRISPR-Cas9 technology to simulate the pathological status of osteosclerosis.
Animal model of osteosclerosis was successfully constructed, which showed that the bone density, trabecular thickness and number of bone trabecular bone, cortical bone thickness and area of the mouse femur was significantly increased, indicating that the gRNA sequence effectively regulates the expression of the LRRK1 gene and simulates the pathological characteristics of osteosclerosis.
Smart Images
Figure CN119530224A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to a gRNA sequence and an application thereof in constructing an osteosclerosis animal model. Background Art
[0002] The dynamic balance of bone development and bone remodeling homeostasis depends on bone resorption involving osteoclasts and bone formation involving osteoblasts. On the one hand, osteoblasts synthesize and secrete bone matrix and differentiate into osteocytes. On the other hand, mature multinucleated osteoclasts continuously absorb adjacent bone matrix. Osteopetrosis (OP) is a rare congenital disease of abnormal bone structure development, characterized by a lack of osteoclasts or impaired bone resorption function, which causes excessive bone mineralization and increased bone mass. In addition to pathological bone damage, patients may also suffer from anemia, impaired intellectual development and other symptoms.
[0003] Leucine-rich repeat kinase 1 (LRRK1) belongs to the ROCO protein family and is characterized by its unique domains, including leucine-rich repeats (LRR) and / or ankyrin repeats (ANK), a GTPase-like domain (ROC) of the complex protein ras, a C-terminal Roc domain (COR) of unknown function, a serine / threonine kinase domain with sequence similarity to MAPKKK, and a series of WD40 repeats at its C-terminus. In a high-throughput screening that identified the functions of more than 4,500 genes, researchers found that LRRK1 is a key regulator of osteoclast function and bone resorption, with little effect on bone formation. At the same time, severe osteosclerosis of long bones was found in LRRK1 knockout mice, making LRRK1 an ideal drug target for the prevention and treatment of osteoporotic fractures. Summary of the invention
[0004] In view of this, one of the objects of the present invention is to provide a gRNA sequence; the second object of the present invention is to provide the application of the gRNA sequence in constructing an animal model of osteosclerosis; the third object of the present invention is to provide the application of the gRNA sequence in increasing the bone density of the femur of mice; the fourth object of the present invention is to provide the application of the gRNA sequence in increasing the thickness and number of trabeculae in the femur of mice; the fifth object of the present invention is to provide the application of the gRNA sequence in increasing the cortical bone thickness and area of the femur of mice.
[0005] In order to achieve the above object, the present invention provides the following technical solutions: 1. A gRNA sequence, wherein the nucleotide sequence of the crRNA sequence of the gRNA sequence is: crRNA-1: 5′-CAUCCGCAUUUCAUGAUGGGUGGGAACACUAGUGCACUUAUCCGUUUUAGAGCUAUGCUGUUUUG-3′ and crRNA-2: 5′-GCCAGCCAACUGAUGUGAAUAGGUGAACACUAGUGCACUUAUCCGUUUUAGAGCUAUGCUGUUUUG-3′; The crRNA targets the following sites of the mouse LRRK1 gene: gRNA-A1:CATCCGCATTTCATGATGGGTGG; gRNA-A2:GCCAGCCAACTGATGTGAATAGG.
[0006] 2. Application of the gRNA sequence in constructing an animal model of osteosclerosis, wherein the animal is a mouse.
[0007] 3. Application of the gRNA sequence in increasing the bone density of mouse femur.
[0008] 4. Application of the gRNA sequence in increasing the thickness and number of trabecular bones in mouse femur.
[0009] 5. Application of the gRNA sequence in increasing the cortical bone thickness and area of mouse femur.
[0010] The beneficial effect of the present invention is that the present invention proposes a pair of new gRNA sequences for constructing LRRK1 knockout mice, and the LRRK1 knockout mice show typical symptoms of osteosclerosis, such as increased bone density of the mouse femur, increased thickness and number of trabeculae, and increased thickness and area of cortical bone, indicating that the gRNA sequence can be used to construct an osteosclerosis animal model. BRIEF DESCRIPTION OF THE DRAWINGS
[0011] In order to make the purpose, technical solution and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration: Figure 1 This is a diagram of the gene knockout model.
[0012] Figure 2 This is the electrophoresis diagram of mice.
[0013] Figure 3 WB validation for mice.
[0014] Figure 4 MicroCT and related index analysis of gene knockout mice. DETAILED DESCRIPTION
[0015] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.
[0016] Example 1. Target sequence and mouse construction 1. gRNA Design Design the gRNA of mouse LRRK1 gene (NCBI ID: 233328) on the website http: / / crispor.tefor.net / and select the gRNA target sequence: gRNA-A1:CATCCGCATTTCATGATGGGTGG (SEQ ID NO.1); gRNA-A2:GCCAGCCAACTGATGTGAATAGG (SEQ ID NO. 2).
[0017] 2. gRNA synthesis Artificially synthesized crRNA (CRISPR RNA) sequence (IDT Corporation) and tracrRNA (trans-activating crRNA) sequence (GenScript Biotech Co., Ltd.). The tracrRNA is designed to contain a sequence complementary to the 3' end of the crRNA, allowing the two molecules to hybridize and bind the 5' end of the tracrRNA to the 3' end of the crRNA to form the gRNA sequence.
[0018] The sequence information is as follows: crRNA-1: 5′-CAUCCGCAUUUCAUGAUGGGUGGGAACACUAGUGCACUUAUCCGUUUUAGAGCUAUGCUGUUUUG-3′ (SEQ ID NO. 3, the underlined sequence indicates the target sequence); crRNA-2: 5′-GCCAGCCAACUGAUGUGAAUAGGUGAACACUAGUGCACUUAUCCGUUUUAGAGCUAUGCUGUUUUG-3′ (SEQ ID NO. 4, the underlined sequence indicates the target sequence); tracrRNA: 5'-AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAGUGGCACCGAGUCCGGUGCU-3' (SEQ ID NO. 5).
[0019] 3. Preparation of RNP complexes (1) Add 0.8 µL of 100 pmol / µL crRNA to 5.2 µL RNase-free water; (2) Add 0.6 µL of 100 pmol / µL tracRNA, mix well and incubate for 5 min; (3) Add 0.2 µL of Cas9 protein (NEB, Catalog No.: M0646M), mix well, and incubate for 10 min to obtain the RNP injection complex.
[0020] 4. Preparation of fertilized eggs (1) Preparation of fertilized eggs: 4-week-old C57BL / 6 female mice were first injected with pregnant mare serum gonadotropin (PMSG), and then injected with human chorionic gonadotropin (HCG) 46-48 hours later; (2) After HCG injection, the female mouse is mated with an adult fertile male mouse to fertilize the female mouse; (3) The next day, the female mouse was euthanized, and the fertilized eggs were collected from the fallopian tubes and placed in a 37°C, 5% CO2 incubator for later use.
[0021] 5. Pronuclear Microinjection (1) Prepare microinjection needles and fixation needles; (2) Mix the RNP complex and Cas9 mRNA evenly and add the mixture into the microinjection needle; (3) Place a normally developed fertilized egg in an injection dish and inject the mixture into the nucleus of the fertilized egg under an inverted microscope at 200-400 times magnification; (4) Transfer the injected fertilized eggs into M16 culture medium and place them in a 37°C, 5% CO2 incubator for 0.5-1 hour before transplantation; or culture them until they reach 2 cells and transplant them the next day.
[0022] 6. Surrogate Mouse Preparation and Embryo Transfer (1) Preparing pseudo-pregnant female mice: Select fertile female mice of appropriate age and mate them with male mice that have been sterilized after vasectomy to stimulate a series of pregnancy changes in the female mice to obtain pseudo-pregnant female mice as surrogate mice; (2) Transplant the injected fertilized egg into the oviduct of the surrogate mother mouse on the day of thrombosis; (3) After transplantation, place the surrogate mother mouse in a clean cage and keep it warm until it wakes up and then return it to the cage for feeding; (4) After successful fallopian tube transplantation, the mother mouse will generally give birth 19-20 days after the operation.
[0023] 7. Identification of F0 mice (1) Collect tissues (tail or toe tissues) from 1-2 week old mice; (2) Lyse the tissue and extract the genome; (3) PCR amplification and electrophoresis detection were performed using the specific primers F1 / R1 for the target gene to screen out the offspring with gene knockout; F1: 5'-GTGCCCGTACTGTAAAAGGACAA-3' (SEQ ID NO.6); R1: 5'-CACTGGCTCCTCTTTCACGGGA-3' (SEQ ID NO. 7).
[0024] The gene knockout model is shown in the figure Figure 1 The electrophoresis results are shown in Figure 2 , positive band: 1138 bp; wild-type band: 2731 bp.
[0025] 8. Obtaining and Identifying Homozygous F2 Mice (1) Mating and passage of F0 mice with wild-type mice; each F0 mouse needs to be passaged independently; (2) Identify the F1 mice born, and if the F0 mice can be transmitted normally through the reproductive system, their offspring have a 50% chance of carrying the target gene; (3) When the positive F1 from the same source is mated with siblings, the F2 mice born will have a 25% chance of being homozygous; (4) Perform PCR detection on F2 mice, and verify the detected homozygotes by immunoblotting.
[0026] Mouse genotype identification (PCR): Primer Set 1: F1: 5'-GTGCCCGTACTGTAAAAGGACAA-3' (SEQ ID NO. 6); R1: 5'-CACTGGCTCCTCTTTCACGGGA-3' (SEQ ID NO. 7).
[0027] Primer set 2: F1:5'-GTGCCCGTACTGTAAAAGGACAA-3' (SEQ ID NO.6); R2: 5'-AGATGACATCATCAGCCTGTACT-3' (SEQ ID NO. 8). (- / -) homozygous: 1138 bp; (+ / -) heterozygotes: 1138 bp, 520 bp, and 2731 bp; (WT) Wild type: 2731 bp and 520 bp.
[0028] Mouse genotype identification (immunoblot analysis): The cells were lysed in RIPA lysis buffer (Proteintect, China) on ice for 30 minutes. After centrifugation at 15,000 r / min for 20 min at 4°C, the supernatant was boiled in 5X SDS buffer. Equal amounts of protein samples were separated by SDS-PAGE and transferred to PVDF membranes. After blocking with 5% skim milk powder for 2 hours, the membrane was incubated with the appropriate primary antibody (Thermo Fisher Scientific, PA5-13868) at 4°C overnight, and then incubated with the corresponding secondary antibody (CWBIO, CW0103S) at 25°C for 2 hours. The blot was detected using a chemiluminescent bottom (ThermoFisher Scientific). The experimental results are shown in Figure 2. Figure 3 As shown, it indicated that the LRRK1 gene was successfully knocked out.
[0029] Example 2: MicroCT detection of mice The distal femur of 4-week-old mice was fixed and subjected to micro-CT scanning and related index analysis. The results are as follows: Figure 4 As shown, the trabecular thickness (Tb.Th), trabecular number (Tb.N), bone mineral density (BMD), cortical bone thickness (Ct.Th), and cortical bone area (Ct.Ar) of the knockout group (KO) were significantly higher than those of the normal group (WT), indicating that the knockout mice showed symptoms of osteosclerosis compared with normal mice.
[0030] The above-described embodiments are only preferred embodiments for fully illustrating the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or changes made by those skilled in the art based on the present invention are within the protection scope of the present invention. The protection scope of the present invention shall be subject to the claims.
Claims
1. A gRNA sequence, characterized in that The nucleotide sequence of the crRNA sequence of the gRNA sequence is: crRNA-1: 5′-CAUCCGCAUUUCAUGAUGGGUGGGAACACUAGUGCACUUAUCCGUUUUAGAGCUAUGCUGUUUUG-3′ and crRNA-2: 5′-GCCAGCCAACUGAUGUGAAUAGGUGAACACUAGUGCACUUAUCCGUUUUAGAGCUAUGCUGUUUUG-3′; The crRNA targets the following sites of the mouse LRRK1 gene: gRNA-A1:CATCCGCATTTCATGATGGGTGG; gRNA-A2:GCCAGCCAACTGATGTGAATAGG.
2. The use of the gRNA sequence according to claim 1 in constructing an animal model of osteosclerosis, characterized in that: The animal is a mouse.
3. Application of the gRNA sequence according to claim 1 in increasing the bone density of mouse femur.
4. Use of the gRNA sequence described in claim 1 in increasing the thickness and number of trabecular bone in mouse femur.
5. Application of the gRNA sequence of claim 1 in increasing the cortical bone thickness and area of mouse femur.