KASP marker primer combination for detecting gloss character of watermelon peel and application of KASP marker primer combination

Abstract

The invention discloses a KASP marker primer combination for detecting the gloss character of watermelon peel and application of the KASP marker primer combination, and belongs to the technical field of watermelon breeding molecular biology. The KASP labeled primer combination comprises an upstream primer 1, an upstream primer 2 and a downstream primer 1, the nucleotide sequence of the upstream primer 1 is as shown in SEQ ID NO. 1; the nucleotide sequence of the upstream primer 2 is as shown in SEQ ID NO. 2; and the nucleotide sequence of the downstream primer 1 is as shown in SEQ ID NO.3. According to the KASP marker primer combination, a KASP molecular marker Cla27993083 is used as a detection target. When the primer combination is applied to amplification, the luster character of the watermelon peel can be accurately and quickly identified, and a new technical path is provided for screening and identifying a watermelon material with the luster peel and breeding a watermelon variety with the luster peel.

Description

Technical Field

[0001] The invention relates to the technical field of watermelon breeding molecular biology, in particular to a KASP marker primer combination for detecting watermelon peel gloss traits and an application thereof. Background Art

[0002] Watermelon is an important horticultural crop. my country is the largest producer and seller of watermelon, and its output has always been the world's first. It occupies an important position in the world's horticultural industry. Peel gloss is an important economic trait for watermelon fruit quality evaluation and germplasm improvement, and has a high impact on the commercial quality of watermelon. Studies have shown that plants with high gloss have good quality, which is manifested in firm fruit texture, salt-alkali tolerance, and drought resistance. Therefore, breeding high-gloss watermelon varieties is one of the important goals of watermelon breeders.

[0003] In the study of watermelon peel gloss, in 1988, Corey and Schlimme analyzed the changes in peel gloss of two watermelon varieties during the fruit ripening process and found that peel gloss was related to the maturity of watermelon pulp. When the soluble solids content and pulp color of watermelon in the mature period tended to be stable, the peel gloss value of the "Charleston" watermelon variety began to decline. At the same time, it was found that the peel gloss was different among different varieties, and it was speculated that it might also be related to the amount and structure of wax powder on the peel surface. Therefore, it was proposed that the peel gloss value could be used as a harvest standard for fruit maturity. The study on the correlation between peel gloss and the quantitative and structural changes of wax powder on the peel surface and pulp texture can provide a non-destructive detection technology for selecting high-quality watermelons in harvesting and grading operations. Subsequently, the researchers screened and cloned genes related to watermelon peel color through genetic positioning, library construction, RNA-seq and other technologies. However, these studies mainly focused on the formation of peel color, such as the differential genes of yellow peel and green peel color, the differential genes of dark green fruit stripes and light green fruit stripes, etc., and no related research on peel gloss was carried out.

[0004] In summary, the identification of watermelon peel gloss trait is still limited to visual inspection, and there is no report on molecular markers for identifying watermelon peel gloss trait. Therefore, it is necessary to provide a molecular identification technology that can quickly perform watermelon peel gloss trait. Summary of the invention

[0005] The purpose of the present invention is to provide a KASP marker primer combination for detecting the gloss trait of watermelon peel and its application, so as to solve the problems existing in the above-mentioned prior art. The KASP marker primer combination of the present invention can accurately and quickly identify the gloss trait of watermelon peel.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] Technical solution 1: The KASP marker primer combination includes upstream primer 1, upstream primer 2 and downstream primer 1; the nucleotide sequence of the upstream primer 1 is shown in SEQ ID NO.1; the nucleotide sequence of the upstream primer 2 is shown in SEQ ID NO.2; the nucleotide sequence of the downstream primer 1 is shown in SEQ ID NO.3.

[0008] Preferably, the molecular marker closely linked to the watermelon peel gloss trait is a T to A mutation occurring at the 27993083bp position on chromosome 8 of the watermelon genome. The primers designed for the watermelon peel gloss trait mutation are as follows:

[0009] FAM fluorescently labeled upstream primer 1 (Cla_27993083-F1): 5'-GAAGGTGACCAAGTTCATGCTCTCTATGAATGCAAAATTCTACAAACT-3' (SEQ ID NO. 1);

[0010] VIC fluorescent-labeled upstream primer 2 (Cla_27993083-F2): 5′-GAAGGTCGGAGTCAACGGATTCTCTATGAATGCAAAATTCTACAAACA-3′ (SEQ ID NO. 2);

[0011] Downstream primer 1 (Cla_27993083-R): 5′-AAACACAAGGTAGGAGTGGGCT-3′ (SEQ ID NO. 3).

[0012] Preferably, the 5' ends of the two primers Cla_27993083-F1 and Cla_27993083-F2 are connected to FAM and VIC fluorescent linker sequences, respectively, FAM signal: GAAGGTGACCAAGTTCATGCT (SEQ ID NO.4); VIC signal: GAAGGTCGGAGTCAACGGATT (SEQ ID NO.5).

[0013] Preferably, the genotypes corresponding to the molecular markers are: A:A is a homozygous genotype with shiny fruit skin; T:T is a homozygous genotype with dull fruit skin; T:A is a heterozygous genotype with dull fruit skin.

[0014] Furthermore, the KASP marker primer combination uses the KASP molecular marker Cla_27993083 as a detection target; the Cla_27993083 is located at the 27993083 bp base of chromosome 8 of watermelon.

[0015] Technical solution 2: A method for identifying the glossiness of watermelon peel, comprising the following steps:

[0016] Extract the genomic DNA of the watermelon to be identified; use the genomic DNA of the watermelon to be identified as a template and adopt the KASP marker primer combination to perform PCR amplification; identify the genotype of the watermelon sample to be identified according to the difference in PCR fluorescence signals; the genotypes include A:A genotype, T:T genotype and T:A genotype.

[0017] Furthermore, the PCR amplification system includes: 2.5 μL 2×KASPmaster mix, 1.25 μL primer mix and 1.25 μL DNA template; the primers include upstream primer 1, upstream primer 2 and downstream primer 1; the primer mix is ​​a mixture of the upstream primer 1, the upstream primer 2 and the downstream primer 1 in a volume ratio of 1:1:3.

[0018] Furthermore, the PCR amplification program is: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 20 s, annealing and extension at 61-55°C for 60 s, decreasing 0.6°C in each cycle, 10 cycles; denaturation at 95°C for 20 s, annealing and extension at 55°C for 60 s, 27 cycles.

[0019] Furthermore, the genotype of the watermelon sample to be identified includes: reading the fluorescence signal value of the PCR product, if it is an A:A genotype, it is determined to be a homozygous individual plant with glossy watermelon rind; if it is a T:T genotype, it is determined to be a homozygous individual plant with dull watermelon rind; if it is a T:A genotype, it is determined to be a heterozygous individual plant with dull watermelon rind.

[0020] Technical solution three: Application of the KASP marker primer combination in detecting the gloss trait of watermelon peel.

[0021] The present invention discloses the following technical effects:

[0022] The present invention locates a significant association site that controls the gloss of watermelon peel by using the GWAS method, and develops a KASP molecular marker associated with the gloss of watermelon peel according to the variable site. The KASP marker for detecting the gloss of watermelon peel provided by the present invention is used to detect the gloss trait of watermelon peel. On the one hand, the operation is simple and time-saving. Traditional naked eye observation requires a growing season (about 4 to 5 months) to observe during the ripening period of watermelon fruit, and the detection using the KASP marker only takes 1 to 2 hours. It is very suitable for batch detection of large groups and multiple samples. On the other hand, traditional hybrid breeding requires 5 to 6 generations to obtain breeding materials with stable traits. The KASP marker can obtain materials with stable traits in only 3 generations, which greatly shortens the breeding cycle and improves the breeding efficiency. In summary, the present invention provides a KASP marker primer combination for identifying the gloss of watermelon peel in view of the lack of identification technology for the gloss trait of watermelon peel. The KASP marker primer combination can accurately and quickly identify the gloss trait of watermelon peel, and provides a new technical path for the screening and identification of glossy peel watermelon materials and the breeding of glossy peel watermelon varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0024] Figure 1 Manhattan plot for genomic association analysis of watermelon rind glossiness trait;

[0025] Figure 2 The genotyping results of the Cla_27993083 marker of the present invention in 69 watermelon samples are shown in Figure 1, wherein blue represents the A:A genotype fluorescence signal corresponding to the primer Cla_27993083, which is a homozygous individual plant with a glossy peel surface; green represents the T:A genotype fluorescence signal corresponding to the primer Cla_27993083, which is a heterozygous individual plant with a matte peel surface; and orange represents the T:T genotype fluorescence signal corresponding to the primer Cla_27993083, which is a homozygous individual plant with a matte peel surface. DETAILED DESCRIPTION

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0031] Example 1 Development and application of KASP molecular marker for watermelon peel gloss trait

[0032] 1. Genome-wide association analysis to locate the glossiness trait of watermelon rind

[0033] The whole genome resequencing of 143 natural watermelon population materials was carried out using Illumina sequencing technology, with an average sequencing depth of 15×. After filtering by the condition of minimum allele frequency (MAF) ≥ 5% and missing data rate (Missing data rate) ≤ 20%, a total of 2,923,709 SNPs were detected, providing rich genetic variation for watermelon breeding. The fruit peel gloss trait of 143 watermelon materials was analyzed, and the FaST-LMM (Factored Spectrally TransformedLinear Mixed Models) model was used to perform a genome-wide association analysis between the watermelon fruit peel gloss trait and all SNP variant sites. The association was found to be significantly associated with the watermelon fruit peel gloss trait in the interval 26922183-28011239 on chromosome 8. The Manhattan plot of the FaST-LMM model is shown in the figure below. Figure 1 As shown in the figure, there are 39 SNP sites in this association interval. The P values ​​of the 39 SNP sites were further analyzed. The smaller the P value, the stronger the trait association. The analysis found that the minimum P value was at SNP site 27993083, which is the SNP site most associated with the watermelon peel gloss trait.

[0034] 2. Development of KASP marker for detecting the glossiness of watermelon peel

[0035] By comparing the genome sequences of locus 27993083, which was significantly associated with the glossiness of the watermelon peel, we identified a 1bp variation at the genomic level between glossy and dull watermelon peels, which resulted in a mutation from T to A, thus resulting in differences in the glossiness of the peel.

[0036] According to the variation of this site, KASP marker primer combinations were designed in the 500bp region upstream and downstream of the variation site. The specific sequences are as follows:

[0037] FAM fluorescently labeled upstream primer 1 (Cla_27993083-F1): 5'-GAAGGTGACCAAGTTCATGCTCTCTATGAATGCAAAATTCTACAAACT-3' (SEQ ID NO. 1);

[0038] VIC fluorescent labeled upstream primer 2 (Cla_27993083-F2):

[0039] 5'-GAAGGTCGGAGTCAACGGATTCTCTATGAATGCAAAATTCTACAAA CA-3' (SEQ ID NO. 2);

[0040] Downstream primer 1 (Cla_27993083-R):

[0041] 5'-AAACACAAGGTAGGAGTGGGCT-3' (SEQ ID NO. 3).

[0042] The 5' ends of the two primers Cla_27993083-F1 and Cla_27993083-F2 were connected to FAM and VIC fluorescent linker sequences, respectively. The FAM signal was: GAAGGTGACCAAGTTCATGCT (SEQ ID NO. 4); the VIC signal was: GAAGGTCGGAGTCAACGGATT (SEQ ID NO. 5).

[0043] The above primers were synthesized by Nanjing Jisi Huiyuan Biotechnology Co., Ltd.

[0044] The above KASP marker primer combination is used to detect the glossiness trait of watermelon peel. If it is an A:A genotype, it is determined to be a homozygous individual plant with glossy watermelon peel; if it is a T:T genotype, it is determined to be a homozygous individual plant with dull watermelon peel; if it is a T:A genotype, it is determined to be a heterozygous individual plant with dull watermelon peel.

[0045] 3. Detection of watermelon peel gloss traits using KASP marker primer combination

[0046] (1) Genomic DNA extraction. The total DNA of leaves of 69 natural watermelon population samples was extracted using the FlaPure Plant DNA Extraction Kit (Beijing Jinsha Biotechnology Co., Ltd.). The peel gloss traits of the 69 watermelon samples are shown in Table 1.

[0047] Table 169 natural watermelon population materials and peel gloss phenotypes

[0048]

[0049] (2) PCR reaction system and procedure. The watermelon DNA extracted in step (1) was used as a template and the KASP labeled primer combination was used for PCR amplification. The PCR reaction system was 5 μl in total and consisted of the following components: 2.5 μL 2×KASP master mix, 1.25 μL Primer mix and 1.25 μL DNA template. The Primer mix was Cla_27993083-F1: Cla_27993083-F2: Cla_27993083-R in a ratio of 1:1:3. The PCR reaction procedure was: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 20 s, annealing and extension at 61-55°C for 60 s, decreasing 0.6°C for each cycle, for 10 cycles; denaturation at 95°C for 20 s, annealing and extension at 55°C for 60 s, for 27 cycles.

[0050] (3) Reading the fluorescence signal value of the PCR amplification product. After the PCR amplification cycle is completed, the fluorescence signal value is read using a fluorescence quantitative PCR instrument, and the genotyping results of the watermelon samples are obtained based on the fluorescence difference. If it is a homozygous genotype A:A, it is judged as a watermelon sample with shiny peel, represented by a blue box in the genotyping diagram; if it is a homozygous genotype T:T, it is judged as a watermelon sample with dull peel, represented by an orange dot in the genotyping diagram; if it is a heterozygous genotype T:A, it is judged as a watermelon sample with dull peel, represented by a green triangle in the genotyping diagram.

[0051] 69 different watermelon samples were tested using primer Cla_27993083 to obtain genotyping diagrams, as shown in Figure 2 The KASP test results of 69 watermelon samples are shown in Table 2.

[0052] Table 2 KASP test results of 69 watermelon samples

[0053]

[0054]

[0055]

[0056] As can be seen from the results in Table 2, through the identification and screening of the Cla_27993083 primer combination, the material with the A:A fluorescence signal corresponding to the primer Cla_27993083 is detected, which is the homozygous material with glossy watermelon peel. The material with the T:T fluorescence signal corresponding to the primer Cla_27993083 is detected, which is the homozygous material with dull watermelon peel. The material with the T:A fluorescence signal is detected, which is the heterozygous material with dull watermelon peel. Therefore, the genotyping result of the Cla_27993083 primer combination of the present invention is completely consistent with the peel phenotype, and the detection accuracy is 100%, which can be applied to the rapid identification of the gloss trait of the watermelon peel. Through the screening of molecular markers, the workload of screening and identification by naked eye after the fruit matures is greatly reduced, the identification accuracy is improved, and the breeding process is accelerated.

[0057] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A KASP marker primer combination for detecting the gloss trait of watermelon peel, characterized in that: The KASP marker primer combination includes upstream primer 1, upstream primer 2 and downstream primer 1; the nucleotide sequence of the upstream primer 1 is shown in SEQ ID NO.1; the nucleotide sequence of the upstream primer 2 is shown in SEQ ID NO.2; the nucleotide sequence of the downstream primer 1 is shown in SEQ ID NO.

3.

2. The KASP marker primer combination according to claim 1, characterized in that: The KASP marker primer combination uses the KASP molecular marker Cla_27993083 as a detection target.

3. The KASP marker primer combination according to claim 2, characterized in that: The Cla_27993083 is located at the 27993083rd base of chromosome 8 of watermelon.

4. A method for identifying the glossiness of watermelon peel, characterized in that: The following steps are involved: Extracting genomic DNA of the watermelon to be identified; using the genomic DNA of the watermelon to be identified as a template, and adopting the KASP marker primer combination described in any one of claims 1 to 3 to perform PCR amplification; according to the difference of PCR fluorescence signals, identifying the genotype of the watermelon sample to be identified; the genotype includes A:A genotype, T:T genotype and T:A genotype.

5. The method according to claim 4, characterized in that The PCR amplification system includes: 2.5 μL 2×KASPmaster mix, 1.25 μL primer mix and 1.25 μL DNA template; the primers include upstream primer 1, upstream primer 2 and downstream primer 1; the primer mix is ​​to mix the upstream primer 1, the upstream primer 2 and the downstream primer 1 in a volume ratio of 1:1:

3.

6. The method according to claim 4, characterized in that The PCR amplification program is: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 20 s, annealing and extension at 61-55°C for 60 s, decreasing 0.6°C in each cycle, 10 cycles; denaturation at 95°C for 20 s, annealing and extension at 55°C for 60 s, 27 cycles.

7. The method according to claim 4, characterized in that The method for identifying the genotype of the watermelon sample to be identified includes: reading the fluorescence signal value of the PCR product, if it is an A:A genotype, it is determined to be a homozygous individual plant with shiny watermelon rind; if it is a T:T genotype, it is determined to be a homozygous individual plant with dull watermelon rind; if it is a T:A genotype, it is determined to be a heterozygous individual plant with dull watermelon rind.

8. Use of the KASP marker primer combination according to any one of claims 1 to 3 in detecting the gloss trait of watermelon peel.

Images