Application of LOC106509199 siRNA in preparation of anti-PDCoV proliferation drugs and vaccines

Abstract

The invention discloses an application of LOC106509199 siRNA (small interfering Ribonucleic Acid) in preparation of a medicine and a vaccine for resisting PDCoV (Post of Convergence Virus) proliferation. Belongs to the technical field of antiviral drugs. The invention finds that the proliferation of the PDCoV can be obviously inhibited by reducing the expression quantity of the LOC106509199 in IPEC-J2 cells infected with the PDCoV. The invention lays a foundation for further development of a new antiviral strategy, and provides a candidate molecular target for preparation of anti-PDCoV proliferation drugs and vaccines.

Description

Technical Field

[0001] The present invention relates to the technical field of antiviral drugs, and more particularly to the application of LOC106509199siRNA in the preparation of anti-PDCoV proliferation drugs and vaccines. Background Art

[0002] Porcine deltacoronavirus (PDCoV) is one of the main pathogens causing porcine diarrhea in my country. It primarily infects pigs through the fecal-oral route and can cause disease in pigs of all ages, leading to clinical symptoms such as diarrhea, vomiting, dehydration, and death. Finding strategies to combat PDCoV infection is a pressing issue.

[0003] Long non-coding RNA (lncRNA) is a type of RNA found in the genome that is greater than 200 base pairs (bp) in length and does not encode proteins. lncRNAs are widely found in plants and animals and strongly co-express with genes within the 2000 nt transcriptional region. They can target these genes and regulate the expression of functional genes or the formation of functional proteins through epigenetic modification, transcriptional regulation, and post-transcriptional regulation, thereby affecting viral proliferation.

[0004] The present invention discovered that the expression level of porcine lncRNA LOC106509199 was significantly elevated in PDCoV-infected porcine intestinal epithelial cell line J2 (IPEC-J2), suggesting that this lncRNA may be involved in regulating the proliferation of PDCoV. Furthermore, it was found that siRNA that inhibits LOC106509199 expression can effectively inhibit PDCoV replication. This invention provides a candidate target for the preparation of anti-PDCoV proliferation drugs and vaccines from a new perspective. Summary of the Invention

[0005] In view of this, the present invention provides the use of LOC106509199 siRNA in the preparation of anti-PDCoV proliferation drugs and vaccines.

[0006] The present invention transfects IPEC-J2 cells with siRNA that reduces LOC106509199 expression. 24 hours after transfection, the cells are infected with the PDCoV-TJ1 strain. 24 hours after infection, the expression of the PDCoV M gene in the cells is detected by fluorescent quantitative PCR technology. It is found that the expression of the PDCoV M gene is significantly reduced, indicating that the LOC106509199 siRNA can inhibit the proliferation of PDCoV in IPEC-J2 cells. The present invention provides a candidate target for the preparation of anti-PDCoV proliferation drugs and vaccines.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] An siRNA of LOC106509199, the nucleotide sequence of the siRNA being shown in SEQ ID NO.8;

[0009] The nucleotide sequence of LOC106509199 is shown in SEQ ID NO.9;

[0010] CCUCACGGUUAAUCCGCUAAG, SEQ ID NO.8;

[0011] ccctgctatggaaaaaggaaaggacaacactgcagcaacacagttctccataacctcagtttccagagccaataggaggaggagaatttcaggcagcaaaag caactataaaaggttacaggagcccacccaccagtgaagctcgtgctgaaggcctgtttcctaggctacaaacgagggactagttccttatttacgcctaggg gaaagtccccggacctaaggcagagagtgccacgtgcgcctgcacgtagactgtccctgcacctcacggttaatccgctaagaagcgatttcgccgagcggcg tgtggcagggatgtcatccgtcagccgaaatagttacacaggcagtgcgcttccgcgcaccaaccacacggggctcattctcagcacggctgattttaa, seq ID NO.9.

[0012] Use of the above siRNA in knocking down LOC106509199 expression in IPEC-J2 cells.

[0013] The application of the above siRNA in the preparation of anti-PDCoV proliferation drugs and vaccines.

[0014] The use of the above-mentioned LOC106509199 as a target in the preparation of drugs and / or vaccines for treating and / or preventing PDCoV.

[0015] Furthermore, the expression level of LOC106509199 needs to be reduced.

[0016] A drug for resisting PDCoV proliferation, comprising a substance that reduces the expression level of LOC106509199.

[0017] Furthermore, the nucleotide sequence of the substance that reduces the expression of LOC106509199 is as follows:

[0018] CCUCACGGUUAAUCCGCUAAG, SEQ ID NO. 8.

[0019] Through the above technical solution, it can be seen that compared with the prior art, the beneficial effects achieved by the present invention are as follows: the present invention transfects siRNA that reduces the expression of LOC106509199 and control siRNA-NC into porcine intestinal epithelial cells (IPEC-J2), and PDCoV is used to infect the cells 24 hours after transfection. The expression of the PDCoV M gene in the cells is detected by fluorescent quantitative PCR technology 24 hours after virus infection. It is found that compared with the control siRNA-NC, the siRNA that reduces the expression of LOC106509199 can significantly reduce the expression of the PDCoV M gene, indicating that LOC106509199 siRNA can inhibit the proliferation of PDCoV in IPEC-J2 cells. The present invention lays the foundation for the further development of new antiviral strategies and provides a candidate molecular target for the preparation of anti-PDCoV proliferation drugs and vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0021] Figure 1 The expression results of the PDCoV M gene after PDCoV infected IPEC-J2 cells in Example 1 of the present invention are as follows;

[0022] Figure 2is the relative expression level of LOC106509199 after PDCoV infected IPEC-J2 cells in Example 2 of the present invention, where *** represents P < 0.001;

[0023] Figure 3 LOC106509199 siRNA reduces the expression of LOC106509199 in IPEC-J2 cells infected with PDCoV in Example 3 of the present invention, where *** represents P < 0.001;

[0024] Figure 4 In Example 3 of the present invention, reducing the expression of LOC106509199 can inhibit the proliferation of PDCoV in IPEC-J2 cells, wherein *** represents P < 0.001. DETAILED DESCRIPTION

[0025] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0026] IPEC-J2 cells were purchased from Guangzhou Geneo Biotechnology Co., Ltd.;

[0027] Fetal bovine serum was purchased from Yikesai Biotechnology (Taicang) Co., Ltd.;

[0028] High-glucose DMEM medium was purchased from Gibco;

[0029] The PDCoV-TJ1 strain was isolated and preserved by the Animal and Poultry Disease Prevention and Control Innovation Team of the Institute of Animal Husbandry and Veterinary Medicine, Tianjin Academy of Agricultural Sciences; (Zheng Li, Li Xiuli, Yan Minghua, Ren Weike, Zhang Lei, Lu Chao, Tian Xiangxue, Han Wei. Isolation, Identification and Biological Characteristics Analysis of Porcine Delta Coronavirus TJ1 Strain[J]. Chinese Journal of Animal Husbandry and Veterinary Medicine (Chinese Core Journal). 2018, 45(1): 219-224).

[0030] Opti-MEM medium was purchased from Thermo Fisher Scientific;

[0031] Lipofectamine 3000 Reagent was purchased from Thermo Fisher Scientific;

[0032] PrimeScript TMRT reagent Kit (Perfect Real Time) was purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.;

[0033] Probe qPCR Master Mix reagent was purchased from Promega (Beijing) Biotechnology Co., Ltd.;

[0034] TB Premix Ex Taq TM II (Tli RNaseH Plus) was purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.;

[0035] Experimental reagents and supplies not mentioned are conventional experimental reagents and supplies, purchased from commercial channels;

[0036] The experimental methods not mentioned are conventional experimental methods and will not be described in detail here.

[0037] Example 1

[0038] PDCoV infected IPEC-J2 cells and the virus proliferated significantly

[0039] 1. Experimental cell culture:

[0040] IPEC-J2 cells were seeded into 6-well plates and cultured in high-glucose DMEM medium containing 10% volume concentration of fetal bovine serum at 37° C. and 5% CO 2 to form a cell monolayer with 80% confluence.

[0041] 2. Virus inoculation:

[0042] The PDCoV-TJ1 strain was inoculated into IPEC-J2 cells (1.6 mL per well, containing a final volume concentration of 1% pancreatic protease) at an MOI of 1.0 (inoculated group). A control group that was not inoculated with the virus was also set up, and the cells were then cultured at 37°C and 5% CO2.

[0043] 3. Total RNA extraction and cDNA product synthesis:

[0044] Total RNA was extracted using the TRIzol method and PrimeScript TM Total RNA was reverse transcribed into cDNA using RT reagent Kit (Perfect Real Time). 1 μg of total RNA was added to every 20 μL system. The reverse transcription procedure was 30°C for 10 min, 42°C for 1 h, and 99°C for 5 min.

[0045] 4. Fluorescence quantitative PCR:

[0046] The cDNA product obtained by reverse transcription was used as a template for fluorescent quantitative PCR; the PDCoV M gene primers and probes were diluted to 10 μM, respectively. The nucleotide sequences of the upstream primer, downstream primer and probe of the PDCoV M gene were SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, respectively. Configure the system and set the program according to the Probe qPCR Master Mix reagent instructions (set the annealing temperature to 61°C) and use the kit to complete the fluorescent quantitative PCR experiment.

[0047] According to the standard curve equation, the Ct value obtained by the fluorescence quantitative PCR test is substituted into the fluorescence quantitative PCR linear equation: Ct value = -3.68 × lgX + 41.21, and the initial copy number of the sample can be calculated to achieve the purpose of quantification.

[0048] CGGTTGGATCTATGTTATTAAAC, SEQ ID NO.1;

[0049] CAGGATATGAAGGTCAGTA, SEQ ID NO.2;

[0050] FAM-CTGCTCCAACCCTTCACCCTA-TAMRA, SEQ ID NO. 3.

[0051] The results are as follows Figure 1 As shown, Figure 1 The results showed that the expression level of PDCoV M gene increased in IPEC-J2 cells 24 h after PDCoV TJ1 infection.

[0052] Example 2

[0053] PDCoV infection of IPEC-J2 cells increases the expression of LOC106509199

[0054] 1. Experimental cell culture:

[0055] IPEC-J2 cells were seeded into 6-well plates and cultured in high-glucose DMEM medium containing 10% volume concentration of fetal bovine serum at 37° C. and 5% CO 2 to form a cell monolayer with 80% confluence.

[0056] 2. Virus inoculation:

[0057] The PDCoV-TJ1 strain was inoculated into IPEC-J2 cells (1.6 mL per well, containing a final volume concentration of 1% pancreatic protease) at an MOI of 1.0 (inoculated group). A control group that was not inoculated with the virus was also set up, and the cells were then cultured at 37°C and 5% CO2.

[0058] 3. Total RNA extraction and cDNA product synthesis:

[0059] Total RNA was extracted using the TRIzol method and PrimeScript TM Total RNA was reverse transcribed into cDNA using RT reagent Kit (Perfect Real Time). 1 μg of total RNA was added to every 20 μL system. The reverse transcription procedure was 30°C for 10 min, 42°C for 1 h, and 99°C for 5 min.

[0060] 4. Fluorescence quantitative PCR:

[0061] The cDNA product obtained by reverse transcription was used as a template for fluorescent quantitative PCR; the primers of LOC106509199 and the internal reference gene GAPDH were diluted to 10 μM, respectively. The nucleotide sequences of the upstream primer and downstream primer of LOC106509199 were SEQ ID NO.4 and SEQ ID NO.5, respectively, and the nucleotide sequences of the upstream primer and downstream primer of the internal reference gene GAPDH were SEQ ID NO.6 and SEQ ID NO.7, respectively.

[0062] According to TB Premix Ex Taq TM II (Tli RNaseH Plus) instructions to configure the system and set the program (annealing temperature is set to 61 ° C), use the kit to complete the fluorescence quantitative PCR experiment, according to the Ct value of the fluorescence quantitative PCR experiment, with GAPDH as the internal reference gene, with 2 -ΔΔCt The formula was used to calculate the fold change of LOC106509199 expression between the control group and the infected group.

[0063] CCCTGCACCTCACGGTTAAT, SEQ ID NO.4;

[0064] TCAGCCGTGCTGAGAATGAG, SEQ ID NO.5;

[0065] AGGAGTAAGAGCCCCTGGA, SEQ ID NO.6;

[0066] TCTGGGATGGAAACTGGAA, SEQ ID NO.7.

[0067] The results are as follows Figure 2 As shown, Figure 2 The results showed that the expression level of LOC106509199 was significantly increased in IPEC-J2 cells 24 hours after PDCoV TJ1 infection.

[0068] Example 3

[0069] Reducing the expression of LOC106509199 inhibits the proliferation of PDCoV in IPEC-J2 cells

[0070] 1. Experimental cell culture:

[0071] IPEC-J2 cells were seeded into 96-well plates and cultured in high-glucose DMEM medium containing 10% volume concentration of fetal bovine serum at 37° C. and 5% CO 2 to form a cell monolayer with 80% confluence.

[0072] 2. Cell transfection and inoculation experiments:

[0073] 4 pmol of LOC106509199 siRNA (nucleotide sequence shown in SEQ ID NO.8) and control siRNA-NC that reduce the expression of LOC106509199 were added to 5 μL Opti-MEM medium, mixed thoroughly, and allowed to stand for 10 minutes; 0.3 μl of Lipofectamine 3000 Reagent was added to 5 μL Opti-MEM medium, mixed thoroughly, and allowed to stand for 10 minutes; the diluted lncRNA siRNA and siRNA-NC solutions were mixed thoroughly with Lipofectamine 3000 Reagent added to Opti-MEM, and allowed to stand for 15 minutes; IPEC-J2 cells pre-seeded in 96-well plates were rinsed with Opti-MEM medium, and then the above lncRNA siRNA / siRNA-NC and Lipofectamine The mixture of 3000 Reagent was added to the cells in each well, 90 μL per well, and after gentle shaking, the cells were placed in a cell culture incubator at 37°C and 5% CO2. After 24 h, the PDCoV-TJ1 strain was inoculated into IPEC-J2 cells at an MOI of 1.0 (100 μL per well, containing a final volume concentration of 1% pancreatin), and then cultured at 37°C and 5% CO2. The IPEC-J2 cell pellet was harvested 24 h after infection.

[0074] CCUCACGGUUAAUCCGCUAAG, SEQ ID NO. 8.

[0075] 3. Total RNA extraction and cDNA product synthesis:

[0076] Total RNA was extracted using the TRIzol method and PrimeScript TMTotal RNA was reverse transcribed into cDNA using RT reagent Kit (Perfect Real Time). 1 μg of total RNA was added to every 20 μL system. The reverse transcription procedure was 30°C for 10 min, 42°C for 1 h, and 99°C for 5 min.

[0077] 4. Fluorescence quantitative PCR:

[0078] The cDNA product obtained by reverse transcription was used as a template for fluorescence quantitative PCR; the primers of PDCoV M gene, internal reference gene GAPDH and LOC106509199 were diluted to 10 μM respectively, and the results were analyzed according to TB. Premix Ex Taq TM II (Tli RNaseHPlus) manual configuration system and set the program (annealing temperature is set to 61 ° C), the use of the kit to complete the fluorescence quantitative PCR test, according to the Ct value of the fluorescence quantitative PCR experiment, with GAPDH as the internal reference gene, with 2 -ΔΔCt The formula was used to calculate the fold change in expression of the PDCoV M gene and the fold change in expression of LOC106509199 between the lncRNA siRNA transfection group and the siRNA-NC transfection group.

[0079] The results are as follows Figure 3 and Figure 4 As shown, Figure 3 It was shown that LOC106509199 siRNA reduced the expression of LOC106509199 in PDCoV-infected IPEC-J2 cells. Figure 4 The results showed that in PDCoV-infected IPEC-J2 cells with reduced LOC106509199 expression, the expression of the PDCoV M gene decreased significantly, indicating that the proliferation level of PDCoV was significantly reduced. This suggests that reducing the expression of LOC106509199 inhibits the proliferation of PDCoV in IPEC-J2 cells.

[0080] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0081] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A siRNA of LOC106509199, characterized in that The nucleotide sequence of the siRNA is shown in SEQ ID NO.8; The nucleotide sequence of LOC106509199 is shown in SEQ ID NO.9; CCUCACGGUUAAUCCGCUAAG, SEQ ID NO.8; ccctgctatggaaaaaggaaaggacaacactgcagcaacacagttctccataacctcagtttccagagccaataggaggaggagaatttcaggcagcaaaag caactataaaaggttacaggagcccacccaccagtgaagctcgtgctgaaggcctgtttcctaggctacaaacgagggactagttccttatttacgcctaggg gaaagtccccggacctaaggcagagagtgccacgtgcgcctgcacgtagactgtccctgcacctcacggttaatccgctaagaagcgatttcgccgagcggcg tgtggcagggatgtcatccgtcagccgaaatagttacacaggcagtgcgcttccgcgcaccaaccacacggggctcattctcagcacggctgattttaa, seq ID NO.

9.

2. Use of the siRNA described in claim 1 in knocking down the expression of LOC106509199 in IPEC-J2 cells.

3. Use of siRNA according to claim 1 in the preparation of anti-PDCoV proliferation drugs and vaccines.

4. Use of LOC106509199 described in claim 2 as a target in the preparation of drugs and / or vaccines for treating and / or preventing PDCoV.

5. The use according to claim 4, characterized in that The expression level of LOC106509199 needs to be reduced.

6. A drug for resisting PDCoV proliferation, characterized in that: Including substances that reduce the expression level of LOC106509199.

7. The drug according to claim 6, characterized in that The nucleotide sequence of the substance that reduces the expression amount of LOC106509199 is as follows: CCUCACGGUUAAUCCGCUAAG, SEQ ID NO. 8.

Images