OsFBX421 gene and application thereof in salt tolerance of rice

Abstract

The invention discloses an OsFBX421 gene and application of the OsFBX421 gene in the aspect of improving the salt tolerance of rice. The nucleotide sequence of the OsFBX421 gene is as shown in SEQ ID NO: 1 in a sequence table. The invention further discloses a phenotype of an OsFBX421 gene mutant strain under treatment of 120 mM NaCl, and the protein and the coding gene thereof have important theoretical and practical significance on research of a plant salt-tolerant mechanism and improvement of salt tolerance and related traits of plants, can play an important role in plant salt-tolerant molecular breeding and have wide application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of biological gene technology and specifically relates to OsFBX421 Genes and their applications in salt tolerance. Background Art

[0002] Rice is one of the most important food crops in the world and the main food source for more than half of the world's population. Due to the continuous increase in the global population, overfertilization and other unhealthy farming methods, soil salinization has destroyed arable land resources and caused huge losses in agricultural production. At the same time, China has a large number of coastal tidal flats and inland saline-alkali lands, and these land reserve resources have great potential for comprehensive utilization. However, the existence of saline-alkali land restricts the growth of crops, reduces land utilization, and poses a threat to agricultural production. The development and utilization of saline-alkali land has important practical significance for improving the ecological environment and ensuring food security potential.

[0003] Rice is a salt-sensitive crop, and its sensitivity to salt stress varies at different developmental stages. During the germination stage of rice seeds, the saline-alkali environment will significantly reduce indicators such as germination rate, germination potential, germination index, and seed vigor index. During the seedling stage, saline-alkali stress will lead to a decrease in plant height and root length, curling of leaves, reduction in root length and the number of lateral roots, and a decrease in seedling biomass, root number, and root volume. In addition, saline-alkali stress will also lead to a decrease in the number of effective tillers of rice, a delay in heading, a decrease in pollen vigor, and obstruction of panicle differentiation, ultimately affecting rice yield.

[0004] Saline-alkali land is an important reserve arable land resource and "potential granary" in my country. By promoting the cultivation technology of salt-alkali tolerant rice, we can make full use of saline-alkali land resources and improve grain production and quality. At the same time, salt-alkali tolerant rice also has the advantages of wind resistance, waterlogging resistance, disease and pest resistance, which is conducive to protecting national food security. Rice is the preferred food crop for the improvement of coastal tidal flats and saline-alkali land, and has produced considerable economic benefits. Replanting rice on saline-alkali land has the advantages of simple methods, no impact on agricultural production progress, no pollution to the environment, and significant improvement effects. Studies have found that planting salt-tolerant rice can not only significantly reduce soil salinity and soil bulk density, but also increase soil organic matter content and increase soil water retention capacity.

[0005] In short, the technical background of rice salt tolerance involves many aspects, including the impact of saline-alkali land on rice growth, breeding technology of salt-alkali tolerant rice, and related research progress. In the future, with the continuous development of science and technology, more rice varieties with strong salt tolerance, high yield and good quality will be selected and bred and promoted and applied in actual production. It is of great significance to ensure the high and stable yield of rice on salinized cultivated land, increase the planting area and total yield of crops by using marginal saline-alkali land, and ensure global food security. Summary of the invention

[0006] The object of the present invention is to provide OsFBX421 Genes and their application in improving salt tolerance in rice.

[0007] A sort of OsFBX421 Gene, OsFBX421 The polynucleotide of the gene is shown as (a), (b), (c) or (d): (a) a polynucleotide as shown in SEQ ID No: 1; or (b) a polynucleotide that can hybridize with the complementary sequence of SEQ ID No: 1 under stringent hybridization conditions, and the protein encoded by the polynucleotide still has the function of salt tolerance; (c) a polynucleotide having at least 90% homology with the polynucleotide shown in SEQ ID No: 1; or (d) A polynucleotide mutant obtained by deleting, substituting or inserting one or more bases based on the polynucleotide shown in SEQ ID No: 1, and the protein encoded by the polynucleotide mutant still has salt-tolerance activity.

[0008] An OsFBX421 protein, wherein the amino acid sequence of the OsFBX421 protein is as shown in (a), (b) or (c): (a) the amino acid sequence as shown in SEQ ID No: 2 in the sequence listing; or (b) an amino acid having at least 90% homology with the amino acid shown in SEQ ID No: 2; or (c) A protein mutant obtained by deleting, substituting or inserting one or more amino acids in the protein shown in SEQ ID No: 2, and the protein still has salt-tolerance activity.

[0009] Contains the OsFBX421 Gene vector.

[0010] Contains the OsFBX421 Engineered bacteria that carry gene vectors.

[0011] Detection OsFBX421 Primers for any fragment of a gene.

[0012] Said OsFBX421 Application of genes in breeding salt-tolerant rice varieties.

[0013] A method for improving the salt tolerance of rice, reducing OsFBX421 Protein expression level in rice.

[0014] The method comprises transforming rice cells with the DNA molecule or polypeptide or silencing or mutating the DNA molecule or polypeptide contained in target rice, and then cultivating the transformed rice cells into plants to obtain transgenic rice with altered salt tolerance, wherein the salt tolerance can be increased or decreased.

[0015] Beneficial effects of the present invention: The present invention is the first to identify the OsFBX421 Gene expression can significantly improve the tolerance of rice seedlings to salt, so that the degree of growth inhibition of plant mutant transgenic strains is reduced compared with the wild type after a period of stress treatment. The protein and its encoding gene of the present invention have important theoretical and practical significance for the study of plant salt tolerance mechanism, and for improving plant salt tolerance and crop yield traits, and will play an important role in crop genetic breeding, with broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 for OsFBX421 Mutant plants fbx421 DNA identification results.

[0017] Figure 2 for OsFBX421 Results of tissue expression characteristics during maturity.

[0018] Figure 3 for OsFBX421 Mutant transgenic plants fbx421 Phenotypes after salt stress treatment.

[0019] Figure 4 for OsFBX421 Mutant transgenic plants fbx421 Survival rate after salt stress treatment. DETAILED DESCRIPTION

[0020] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0021] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0022] Embodiment 1: OsFBX421 Obtaining mutant transgenic plants 1. OsFBX421 Creation of mutant vector transgenic lines exist OsFBX421Select a suitable PAM site at the 5' end of the gene, and design a specific single-stranded guide RNA (sgRNA) based on the selected PAM site. Usually a 20-base long sequence is selected to ensure its binding specificity with the target gene. The designed sgRNA sequence is cloned into the vector to form a complete CRISPR-Cas9 expression vector. The constructed vector is transferred into Agrobacterium EHA105, and then transferred into ZH11 variety through callus infection to obtain mutant plants. fbx421 , DNA fragments were amplified using primer pair LP / RP and then sequenced. fbx421 The DNA identification results of the mutant plants and the corresponding encoded amino acid sequences are as follows Figure 1 shown.

[0023] LP: TTACAGTTTGATGACATTCCTGAGGT; RP:TTCATAAAGCAAAGCTTAAGATGCT; Embodiment 2: OsFBX421 Tissue expression characterization Different parts of the rice variety Nip seedlings at maturity were taken: panicle, leaf, leaf sheath, first internode, node, stem base, and root. Total RNA was extracted according to the instructions of the RNA extraction kit of Vazyme (Nanjing Novogene Biotechnology Co., Ltd.), and reverse transcribed into cDNA according to the instructions of the RNA reverse transcription kit of Vazyme, with ACTIN as the internal reference gene. OsFBX421 Design primers based on gene sequence X -F and X -R, qPCR analysis was performed, with 3 biological replicates for each site. The results showed that FBX421 The lowest expression was in leaves and the highest in nodes and internodes ( Figure 2 ).

[0024] X -F:5'-TTGTTGATGCTGCTCCAGTC-3'; X -R:5'-CAGATCTGTCAAGCCGATGA-3'.

[0025] Embodiment 3: OsFBX421 Analysis of salt tolerance in mutant transgenic plants right OsFBX421 Mutant strains fbx421 To identify the salt tolerance of seedlings, seeds with uniform germination were soaked at 37℃ for 1 day and then germinated. The seeds with uniform germination were selected and planted in 96-well plates for hydroponics. The seeds were cultured with Yashida medium until they reached the two-leaf and one-heart stage, and then the nutrient solution containing 120 mM NaCl was replaced for treatment. After two weeks of treatment, it was found that fbx421 Improved salt tolerance ( Figure 3 ). The survival rate of ZH11 is about 22%. fbx421 The survival rate was about 45%, and there was a significant difference between the two ( Figure 4 ),show OsFBX421 Negative regulation of salt tolerance in rice seedlings.

[0026] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A OsFBX421 A gene characterized by Said OSFBX421 The polynucleotide sequence of the gene is shown in SEQ ID No: 1 in the sequence listing.

2. An OsFBX421 protein, characterized in that The amino acid sequence of the OSFBX421 protein is shown in SEQ ID No: 2 in the sequence listing.

3. Containing the method described in claim 1 OsFBX421 Gene vector.

4. Containing the method described in claim 3 OsFBX421 Engineered bacteria that carry gene vectors.

5. Detection of claim 1 OsFBX421 Primers for any fragment of a gene.

6. The method according to claim 1 OsFBX421 Application of genes in breeding salt-tolerant rice varieties.

7. A method for improving salt tolerance of rice, characterized in that: Reduce the expression level of OsFBX421 protein in rice.

Images