A method for reducing corn plant height

By mutating the 341 site T to A of the ZmGA2ox2 gene in corn and using M-MLV fused nSpCas9 for gene editing, the problem of reducing corn plant height and ear height was solved while keeping the yield unaffected, achieving effective dwarfing in corn breeding.

CN119552908BActive Publication Date: 2025-09-26JILIN ACAD OF AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411711379.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-27
Publication Date
2025-09-26
Estimated Expiration
2044-11-27

AI Technical Summary

Technical Problem

Existing technologies make it difficult to reduce corn plant height without affecting yield, and overexpression of GA2ox-type gene materials causes plant morphological changes and affects fertility.

Method used

By mutating the T at position 341 of the ZmGA2ox2 gene in corn to A, using M-MLV-fused nSpCas9 for gene editing, and designing specific pegRNA molecules and vectors for targeted editing, the plant height and ear height of corn were reduced.

Benefits of technology

The plant height and ear height of corn were successfully reduced without affecting yield, providing mutant materials with industrial application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119552908B_ABST
    Figure CN119552908B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of molecular genetics and specifically relates to a method for reducing corn plant height. The present invention provides a method for reducing corn plant height through precise point mutation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of molecular genetics, and in particular relates to a method for reducing corn plant height. Background Art

[0002] Dwarfing traits have brought breakthroughs in crop yields, and methods to reduce plant height have great potential for application. Among the key agronomic traits of corn, plant height and ear height influence lodging resistance, photosynthetic efficiency, and harvest index, and are closely related to corn yield. Therefore, plant height and ear height are of great value in corn breeding practices and germplasm resource improvement.

[0003] Gibberellin oxidase is a major regulatory site that catalyzes the late stages of GA biosynthesis and catabolism, playing a key role in regulating gibberellin homeostasis in plants. Gibberellin oxidases include GA20ox, GA3ox, and GA2ox.

[0004] Because changes in GA2ox gene expression can affect gibberellin content, most genetically modified materials containing these genes often exhibit significant changes in plant morphology and even compromise plant fertility, hindering their application. Studies have shown that rice overexpressing wild-type OsGA2ox6 exhibits complete dwarfism, while rice overexpressing the GA2ox6 mutants Y123A, E140A, A141E, H143A, and G343A exhibit varying degrees of reduced plant height. E140A and A141E increase yield, while the other mutants, while able to influence plant height, have no positive effect on yield (Plant Biotechnology Journal, 2017, 15:850–864).

[0005] The ZmGA2ox6 mutants E144A and A145E in maize (corresponding to E140A and A141E in rice) have the effect of improving drought tolerance in Arabidopsis (CN111778265 B), but it is not yet clear what phenotypic changes will occur when expressed in maize. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to develop a method for reducing corn plant height by mutating ZmGA2ox2.

[0007] In order to solve the above problems, the present invention adopts the following technical solutions:

[0008] The present invention provides a method for reducing corn plant height and / or ear height without reducing yield, characterized in that: the T at position 341 of the protein of the sequence shown in SEQ ID NO. 2 in corn is mutated to A.

[0009] In some embodiments, the above method is to mutate the 2400th A to G in the gene of SEQ ID NO. 1 or the gene numbered Zm00001d002999 in corn.

[0010] In some embodiments, the above-mentioned A mutation to G is achieved by a guided editing approach targeting AGGAGGACGTCAAGAGGAC or GAAGAAAGATTGGGCTCCC or its reverse complementary sequence.

[0011] In some embodiments, the nuclease used in the above-mentioned gene editing is nSpCas9 fused with M-MLV.

[0012] In some embodiments, the amino acid sequence of the nSpCas9 is as shown in SEQ ID NO.4.

[0013] The present invention also provides a kit for reducing corn plant height and / or ear height without reducing yield, characterized in that it comprises any one of the following:

[0014] (1) a pegRNA molecule capable of recognizing the above target;

[0015] (2) a DNA molecule encoding the pegRNA described in (1);

[0016] (3) A vector for expressing the pegRNA described in (1).

[0017] In some embodiments, the sequence of the pegRNA molecule is

[0018] CAGGAGGACGUCAAGAGGACGUUUUAGAGCUAGAAAUAGCAAGUUA

[0019] AAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGCUCUUUCUUCCGGCCCUCUUGACGUCCUUU.

[0020] In some embodiments, the above-mentioned kit further includes nSpCas9 fused to M-MLV.

[0021] In some embodiments, the amino acid sequence of the nSpCas9 is shown as SEQ ID NO.4, and the amino acid sequence of the M-MLV is shown as SEQ ID NO.6.

[0022] The present invention also provides a method for increasing corn yield, characterized in that: the E at position 144 of the protein of the sequence shown in SEQ ID NO. 2 in corn is mutated to A.

[0023] In some embodiments, the above method is to mutate the 555th position A to C of the gene with the sequence shown in SEQ ID NO. 1 or the gene numbered Zm00001d002999 in corn.

[0024] In some embodiments, the above-mentioned mutation of A to C is achieved by gene editing targeting CCGCCACCTCTCGTGGTCGG or CGTCCCGCTCGCCAGCATC or its reverse complementary sequence.

[0025] In some embodiments, the nuclease used in the above-mentioned gene editing is nSpCas9 fused with M-MLV.

[0026] In some embodiments, the amino acid sequence of the nSpCas9 is shown as SEQ ID NO.4, and the amino acid sequence of the M-MLV is shown as SEQ ID NO.6.

[0027] The present invention also provides a kit for increasing corn yield, characterized in that it comprises any one of the following:

[0028] (1) RNA molecules capable of recognizing the above targets;

[0029] (2) a DNA molecule encoding the RNA described in (1);

[0030] (3) A vector for expressing the RNA described in (1).

[0031] In some embodiments, the sequence of the RNA molecule is

[0032] CCGCCACCUCUCGUGGUCGGGUUUUAGAGCUAGAAAUAGCAAGUUAA

[0033] AAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUGGAACUCCCGCCGACCACGAGAUUU.

[0034] In some embodiments, the above-mentioned kit further includes nSpCas9 fused to M-MLV.

[0035] In some embodiments, the amino acid sequence of the nSpCas9 is shown as SEQ ID NO.4, and the amino acid sequence of the M-MLV is shown as SEQ ID NO.6.

[0036] The advantages and beneficial effects of this invention are as follows: Using guide editing technology to mutate the maize ZmGA2ox2 gene, the resulting mutant, T341A, exhibits reduced plant and ear height without affecting yield; while the E144A mutant significantly increases yield. Both mutants have industrial application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 Vector components for overexpressing and knocking out the ZmGA2ox2 gene. A: Schematic diagram of the T-DNA region of the overexpression vector. B: Schematic diagram of the T-DNA region of the gene editing knockout vector. C: Target location and sequence of the knockout vector. D: Mutation profile of the edited gene.

[0038] Figure 2 Plant height performance in the field of maize overexpressing and knocking out the ZmGA2ox2 gene. WT: wild-type maize; KO: knockout maize; OE: overexpression maize.

[0039] Figure 3 Plant height performance in the field of maize overexpressing the ZmGA2ox2 mutant gene. E144A-OE(+): Maize with positive E144A overexpression; A145E-OE(+): Maize with positive A145E overexpression; E144A-OE(-): Negative control for E144A overexpression; A145E-OE(-): Negative control for A145E overexpression.

[0040] Figure 4 The creation process of E144A and T341A precision editing materials. A: Diagram of the T-DNA region of the precision editing vector; B: Location and sequence of the target gene; C: Specific mutation details. DETAILED DESCRIPTION

[0041] The following definitions and methods are provided to better define this application and to guide those skilled in the art in practicing this application. Unless otherwise noted, terms are to be understood according to conventional usage by those skilled in the relevant art. All patent documents, academic papers, industry standards, and other publications cited herein are hereby incorporated by reference in their entirety.

[0042] As used herein, "corn" refers to any corn plant and includes all plant varieties that can be bred with corn, including whole plants, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant callus, intact plant cells in plants or plant parts, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, etc. Unless otherwise indicated, nucleic acids are written from left to right in a 5' to 3' orientation; amino acid sequences are written from left to right in an amino to carboxyl orientation. Amino acids can be represented herein by their commonly known three-letter symbols or by the single-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Similarly, nucleotides can be represented by commonly accepted single-letter codes. Numerical ranges include numbers that define the range. As used herein, "nucleic acid" includes deoxyribonucleotides or ribonucleotide polymers in single-stranded or double-stranded form, and unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) having the basic properties of natural nucleotides that hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides. As used herein, the terms "encoding" or "encoded" are used in the context of a specific nucleic acid to refer to a nucleic acid that contains the necessary information to direct the translation of the nucleotide sequence into a specific protein. Codons are used to represent information encoding proteins. As used herein, "full-length sequence" relating to a specific polynucleotide or its encoded protein refers to the entire nucleic acid sequence or the entire amino acid sequence with a natural (non-synthetic) endogenous sequence. A full-length polynucleotide encodes the full-length, catalytically active form of the specific protein. The terms "polypeptide" and "protein" are used interchangeably herein to refer to polymers of amino acid residues. The term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids. The term is also used for naturally occurring amino acid polymers. The terms "residue" or "amino acid residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide, or peptide (collectively, "protein"). The amino acid can be a naturally occurring amino acid and, unless otherwise limited, can include known analogs of a naturally occurring amino acid that can function in a manner similar to the naturally occurring amino acids.

[0043] As used herein, the terms "isolated" and "purified" are used interchangeably to refer to a nucleic acid or polypeptide, or biologically active portion thereof, that is substantially or essentially free from components that normally accompany or react with the nucleic acid or polypeptide as found in its naturally occurring environment. Thus, an isolated or purified nucleic acid or polypeptide is substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. An "isolated" nucleic acid is typically free of sequences (such as protein-encoding sequences) that naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, an isolated nucleic acid may comprise less than about 0.5 kb of nucleotide sequence that naturally flanks the nucleic acid in the genomic DNA of the cell from which the nucleic acid is derived.

[0044] In this application, the words "comprises," "comprising," or variations thereof are to be understood as including, in addition to the described elements, numbers, or steps, other elements, numbers, or steps. A "test plant" or "test plant cell" refers to a plant or plant cell in which a genetic modification has been effected, or a progeny of a plant or cell so modified that contains the modification. A "control," "control plant," or "control plant cell" provides a reference point for measuring phenotypic changes in the test plant or plant cell. Control plants or plant cells can include, for example: (a) wild-type plants or cells, i.e., plants or cells having the same genotype as the genetically modified starting material that produced the test plant or cell; (b) plants or plant cells having the same genotype as the starting material but that have been transformed with an empty construct (i.e., with a construct that has no known effect on the trait of interest, such as a construct comprising a marker gene); (c) plants or plant cells that are non-transformed segregants of the test plant or plant cell; (d) plants or plant cells that are genetically identical to the test plant or plant cell but that have not been exposed to conditions or stimuli that would induce expression of the gene of interest; or (e) the test plant or plant cell itself, which is under conditions where the gene of interest is not expressed.

[0045] Those skilled in the art will readily recognize that advances in the field of molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, provide a wide range of appropriate tools and procedures for modifying or engineering the amino acid sequence and underlying gene sequence of proteins of agricultural interest.

[0046] In some embodiments, the nucleotide sequences of the present application can be altered to make conservative amino acid substitutions. The principles and examples of conservative amino acid substitutions are further described below. In certain embodiments, the nucleotide sequences of the present application can be substituted without changing the amino acid sequence according to the disclosed monocot codon preferences, for example, codons encoding the same amino acid sequence can be replaced with codons preferred by monocots without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, part of the nucleotide sequence in the present application is replaced with different codons encoding the same amino acid sequence, thereby not changing the amino acid sequence encoded by the nucleotide sequence while changing the nucleotide sequence. Conservative variants include those sequences that encode the amino acid sequence of one of the proteins of the embodiments due to the degeneracy of the genetic code. In some embodiments, part of the nucleotide sequence in the present application is replaced according to the monocot codon preference. Those skilled in the art will recognize that amino acid additions and / or substitutions are generally based on the relative similarity of the amino acid side chain substituents, for example, the hydrophobicity, charge, size, etc. of the substituents. Exemplary amino acid substitution groups with various aforementioned properties are well known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. Guidance on appropriate amino acid substitutions that do not affect the biological activity of the protein of interest can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC) (incorporated herein by reference). Conservative substitutions such as replacing one amino acid with another amino acid having similar properties can be performed. Sequence identity identification includes hybridization techniques. For example, all or part of a known nucleotide sequence is used as a probe for selective hybridization with other corresponding nucleotide sequences present in cloned genomic DNA fragments or cDNA fragment groups (i.e., genomic libraries or cDNA libraries) from a selected organism.

[0047] In some embodiments, fragments of nucleotide sequences and the amino acid sequences they encode are also included. As used herein, the term "fragment" refers to a portion of the nucleotide sequence of a polynucleotide of an embodiment or a portion of the amino acid sequence of a polypeptide. Fragments of nucleotide sequences can encode protein fragments that retain the biological activity of a native or corresponding full-length protein and thus have protein activity. Mutant proteins include biologically active fragments of native proteins that contain contiguous amino acid residues that retain the biological activity of the native protein. Some embodiments also include transformed plant cells or transgenic plants that contain the nucleotide sequence of at least one embodiment. In some embodiments, plants are transformed using an expression vector that contains the nucleotide sequence of at least one embodiment and a promoter that drives expression in plant cells operably linked thereto. Transformed plant cells and transgenic plants refer to plant cells or plants that contain heterologous polynucleotides in their genomes. Generally speaking, the heterologous polynucleotides are stably integrated in the genome of the transformed plant cells or transgenic plants so that the polynucleotides are passed on to future generations. The heterologous polynucleotides can be integrated into the genome individually or as part of an expression vector. In some embodiments, the plants involved in the present application include plant cells, plant protoplasts, plant cell tissue cultures that can regenerate plants, plant calli, plant masses and plant cells, which are complete plants or parts of plants, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, kernels, ears, cobs, shells, stalks, roots, root tips, anthers, etc. The present application also includes plant cells, protoplasts, tissues, calli, embryos, flowers, stems, fruits, leaves and roots derived from the transgenic plants of the present application or their progeny, and thus at least partially comprising the nucleotide sequence of the present application.

[0048] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Without departing from the spirit and substance of the present invention, the modification or replacement of the inventive method, step or condition, all fall within the scope of the application. If not otherwise specified, the embodiments are according to conventional experimental conditions, such as the molecular cloning laboratory manual (Sambrook J & Russell DW, Molecular cloning: alaboratory manual, 2001) of Sambrook et al., or according to the conditions of manufacturer's instructions. If not otherwise specified, the chemical reagents used in the embodiments are conventional commercial reagents, and the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0049] Example

[0050] Example 1 Effects of Overexpression and Knockout of ZmGA2ox2 Gene on Maize Phenotype

[0051] To determine whether the ZmGA2ox2 gene (gene ID Zm00001d002999) is related to maize plant height, the inventors first used conventional overexpression and gene editing knockout techniques to overexpress and knockout the ZmGA2ox2 gene in the maize inbred line KN5585. Overexpression used the ubi promoter to drive the gene CDS sequence, while gene knockout used three sgRNAs to simultaneously knock out the gene (see the schematic diagram of the T-DNA vector for overexpression and gene editing). Figure 1 After obtaining overexpression and editing corn materials, the plant height and ear height traits were investigated. The results showed that the overexpression corn materials were extremely dwarfed and did not produce fruit, with plant height reduced by 52.53% and ear height reduced by 57.43%. The plant height and ear height of gene-edited corn increased significantly, with plant height increasing by 4.71% and ear height increasing by 7.97% ( Figure 2 )

[0052] The above results indicate that the ZmGA2ox2 gene has the function of regulating corn plant height, but direct overexpression and knockout cannot obtain corn materials with industrial application value.

[0053] Example 2 Trait performance of corn overexpressing the ZmGA2ox2 mutant

[0054] Because direct overexpression of the ZmGA2ox2 gene results in extreme dwarfing and a very low seed set rate in corn, it has no practical application value. The inventors proposed point mutations in ZmGA2ox2 before overexpression. The protein mutation sites selected were three gibberellin binding sites: A145E, E144A, and T341A. The corresponding codons convert the original GAG to GCG, GCG to GAG, and ACC to GCC, respectively. Aside from the ZmGA2ox2 gene mutation, all other components of the overexpression vector were the same as in Example 1.

[0055] The overexpression vector of the mutant gene was transformed into the maize inbred line KN5585, and transgenic plants E144A-OE, A145E-OE, and T341A-OE were obtained. Among them, T341A-OE plants could not grow to harvest, while E144A-OE and A145E-OE plants were able to complete the growth cycle. The gibberellin content of E144A-OE and A145E-OE materials was significantly increased, and the corresponding plant height and ear height were significantly reduced ( Figure 3 ).

[0056] Further field investigations at a test base in Jilin Province revealed that plant and ear height were significantly reduced in A145E-OE compared to the negative control, with reductions ranging from 25% to 45%. Plant and ear height were also significantly reduced in E144A-OE, with reductions ranging from 12% to 30%. Field investigations at a test base in Hainan Province also revealed that plant and ear height decreased by more than 20% in both A145E-OE and E144A-OE (Table 1). However, ear length, ear diameter, and yield were also significantly reduced in A145E-OE and E144A-OE (Table 2), which also lacks practical application value.

[0057] Table 1 Plant height data of corn materials with overexpressed mutant genes (unit: cm)

[0058]

[0059]

[0060] “+” and “-” indicate overexpression positive and negative controls, respectively.

[0061] Table 2 Yield trait data of corn materials with overexpressed mutant genes

[0062]

[0063] “+” and “-” indicate overexpression positive and negative controls, respectively.

[0064] Example 3: Precise editing of maize traits at the ZmGA2ox2 gene locus

[0065] Although overexpression of the ZmGA2ox2 gibberellin binding site mutant can reduce plant height, it also reduces yield. The inventors further used precision gene editing technology (guided editing) to precisely edit the A145, E144, and T341 sites of the endogenous ZmGA2ox2 gene in maize to obtain A145E, E144A, and T341A mutant materials.

[0066] Finally, E144A and T341A mutant materials were successfully obtained. The editing vector structures, target sequences and base editing conditions used for these two mutant materials are shown in Figure 4 The two targets designed for the E144A mutation are CCGCCACCTCTCGTGGTCGG or CGTCCCGCTCGCCAGCATC;

[0067] The two targets designed for the T341A mutation are AGGAGGACGTCAAGAGGAC or GAAGAAAGATTGGGCTCCC.

[0068] The pegRNA (prime editing guide RNA) sequence of E144A is: CCGCCACCUCUCGUGGUCGGGUUUUAGAGCUAGAAAUAGCAAGUUAA AAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUGGAACUCCGCCGACCACGAGAUUU;

[0069] The pegRNA (prime editing guide RNA) sequence of T341A is: CAGGAGGACGUCAAGAGGACGUUUUAGAGCUAGAAAUAGCAAGUUA AAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGCUCUUUCUUCCGGCCCUCUUGACGUCCUUU.

[0070] The nSpCas9 used is a SpCas9 protein containing the H840A mutation, the nucleic acid sequence of which is shown in SEQ ID NO.3, and the encoded amino acid sequence is shown in SEQ ID NO.4. In addition, the C-terminus of nSpCas9 is also fused with M-MLV reverse transcriptase, the nucleic acid sequence of M-MLV is shown in SEQ ID NO.5, and the encoded amino acid sequence is shown in SEQ ID NO.6. Protein tags (such as Flag) or nuclear localization signals can be added to both ends of nSpCas9 or M-MLV as needed.

[0071] Field surveys at the Hainan base revealed that compared with the control, T341A-PE had increased gibberellin content and decreased plant and ear height. Plant height in the homozygous material decreased significantly, by 12.40%. While ear height did not decrease significantly, it did decrease by 7.94%. E144A-PE had decreased gibberellin content and significantly increased plant height (Table 3).

[0072] Further investigation of agronomic traits such as ear length, ear diameter, ear weight, and grain weight revealed that T341A-PE homozygous materials exhibited reduced plant height and ear height, while the aforementioned yield traits were unaffected. In contrast, E144A-PE homozygous materials exhibited significant increases in plant height and ear height, along with significant increases in the aforementioned yield traits (Table 4).

[0073] Table 3 Plant height trait data of precisely edited corn materials

[0074]

[0075] Table 4 Yield trait data of precisely edited corn materials

[0076]

[0077]

[0078] “+” and “-” indicate overexpression positive and negative controls, respectively.

[0079] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

Claims

1. A method for reducing corn plant height and / or ear height without reducing yield, characterized by: The T at position 341 of the protein of SEQ ID NO. 2 in corn was mutated to A.

2. The method according to claim 1, wherein: The A at position 2400 of the gene of the sequence shown in SEQ ID NO. 1 in corn was mutated to G.

3. The method according to claim 2, wherein: The mutation of A to G is achieved by a guided editing approach targeting AGGAGGACGTCAAGAGGAC or GAAGAAAGATTGGGCTCCC or its reverse complementary sequence.

4. The method according to claim 3, wherein: The nuclease used in the gene editing is nSpCas9 fused with M-MLV.

5. The method according to claim 4, characterized in that: The amino acid sequence of the nSpCas9 is shown in SEQ ID NO. 4, and the amino acid sequence of the M-MLV is shown in SEQ ID NO.

6.

6. A kit for reducing corn plant height and / or ear height without reducing yield, characterized by: Includes any of the following: (1) A pegRNA molecule capable of recognizing the target described in claim 3; the sequence of the pegRNA molecule is CAGGAGGACGUCAAGAGGACGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGUGCUCUUUCUUCCGGCCCUCUUGACGUCCUUU; (2) a DNA molecule encoding the pegRNA described in (1); (3) A vector for expressing the pegRNA described in (1).

7. The kit according to claim 6, wherein: The kit also includes nSpCas9 fused to M-MLV.

8. The kit according to claim 7, wherein: The amino acid sequence of the nSpCas9 is shown in SEQ ID NO. 4, and the amino acid sequence of the M-MLV is shown in SEQ ID NO.

6.

9. A method for increasing corn yield, characterized by: The E at position 144 of the protein of SEQ ID NO. 2 in corn was mutated to A.

10. The method according to claim 9, characterized in that: The 555th position A of the gene of the sequence shown in SEQ ID NO. 1 in corn was mutated to C.

11. The method according to claim 10, characterized in that: The mutation of A to C is achieved by gene editing targeting CCGCCACCTCTCGTGGTCGG or CGTCCCGCTCGCCAGCATC or its reverse complementary sequence.

12. The method according to claim 11, characterized in that: The nuclease used in the gene editing is nSpCas9 fused with M-MLV.

13. The method according to claim 12, wherein: The amino acid sequence of the nSpCas9 is shown in SEQ ID NO. 4, and the amino acid sequence of the M-MLV is shown in SEQ ID NO.

6.

14. A kit for increasing corn yield, characterized by: Includes any of the following: (1) An RNA molecule capable of recognizing the target described in claim 11; the sequence of the RNA molecule is CCGCCACCUCUCGUGGUCGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUGGAACUCCGCCGACCACGAGAUUU; (2) a DNA molecule encoding the RNA described in (1); (3) A vector for expressing the RNA described in (1).

15. The kit according to claim 14, characterized in that: The kit also includes nSpCas9 fused to M-MLV.

16. The kit according to claim 15, characterized in that: The amino acid sequence of the nSpCas9 is shown in SEQ ID NO. 4, and the amino acid sequence of the M-MLV is shown in SEQ ID NO. 6.

Citation Information

Patent Citations

  • Mutant genes, mutants, expression vectors, and applications of zeaxanthin oxidase

    CN111778265B