Detection test paper and detection kit for detecting telomerase activity and application of detection test paper and detection kit

Abstract

The invention discloses detection test paper and a detection kit for detecting telomerase activity and application, the detection test paper comprises a nitrocellulose membrane, the surface of the nitrocellulose membrane is provided with a test area, and a first detection line and a second detection line are printed in the test area; wherein the first detection line and the second detection line are respectively formed by printing a first capture probe sequence and a second capture probe sequence of streptavidin-biotinylation, the first capture probe is used for capturing a DNA neck ring structure extending after telomerase reaction, and the second capture probe is used for capturing a DNA sequence with a fluorophore replaced after telomerase reaction. Meanwhile, the invention discloses a detection kit, which contains a colloidal gold nucleic acid probe solution, can realize rapid dual visual detection of telomerase activity through colloidal gold color development and fluorescence detection, and has the advantages of sensitive and rapid response to telomerase extension products and high sensitivity. The problem of false positive rate in telomerase activity detection can be greatly reduced.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular detection, and in particular relates to a detection test paper and a detection kit for detecting telomerase activity and applications thereof. Background Art

[0002] Telomerase is a special reverse transcriptase composed of RNA and protein, which is related to the synthesis of telomeres (a specific nucleotide sequence and structure) at the end of eukaryotic cell DNA. The telomere length of normal somatic cells gradually shortens with cell division. The enhanced telomerase activity can maintain the length of telomeres and prevent cells from proliferating permanently and becoming cancerous. Therefore, the detection of telomerase activity can be used for tumor diagnosis.

[0003] Traditional technology for detecting telomerase activity is mainly based on the polymerase chain reaction (PCR) to amplify the telomerase repeat extension fragment (TTAGGG) (TRAP) to detect telomerase activity. In addition, there are also detection methods based on response signals such as fluorescence and electrochemistry, but these methods still have the problem of low detection sensitivity and a certain false positive rate. Summary of the invention

[0004] Based on the deficiencies in the prior art, the primary purpose of the present invention is to provide a test strip for detecting telomerase activity. The test strip can realize rapid dual visualization detection (dual response) of telomerase activity through colloidal gold color development and fluorescence detection, and has the advantages of rapid and sensitive response to telomerase extension products and high sensitivity, which can greatly reduce the problem of false positive rate in telomerase activity detection.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] One aspect of the present invention provides a test paper for detecting telomerase activity, which comprises a bottom plate, a nitrocellulose membrane is provided on the surface of the bottom plate, a sample plate and a water absorption plate are provided at both ends of the nitrocellulose membrane, the sample plate and the water absorption plate are both located on the upper part of the nitrocellulose membrane and partially overlapped therewith, a test area is provided on the nitrocellulose membrane, and a first test line close to the sample plate and a second test line close to the water absorption plate are printed in the test area;

[0007] Among them, the first and second detection lines are formed by printing the first and second capture probe sequences ylated with streptavidin-biotin respectively, the first capture probe is used to capture the DNA neck ring structure extended after the telomerase reaction, and the second capture probe is used to capture the DNA sequence connected with the fluorescent group that is replaced after the telomerase reaction.

[0008] Wherein, the nucleotide sequence of the first capture probe is shown as SEQ ID NO.3 (CCCTAACCCTAACCCT);

[0009] The nucleotide sequence of the second capture probe is shown in SEQ ID NO.4 (GCCCCTAAC).

[0010] Another aspect of the present invention provides a detection kit for detecting telomerase activity, comprising the above-mentioned detection test paper and an extension reaction solution, wherein the extension reaction solution comprises a colloidal gold spherical nucleic acid probe solution, wherein the colloidal gold spherical nucleic acid probe is formed by modifying double-stranded DNA on the surface of colloidal gold nanoparticles with colloidal gold nanoparticles as the core;

[0011] The double-stranded DNA is formed by hybridization of a long DNA chain TP-chain and a short DNA chain FL-chain, and the long DNA chain TP-chain contains a telomerase primer sequence, and the 3' end of the short DNA chain FL-chain is modified with a fluorescent group.

[0012] Wherein, the DNA long chain TP-chain has a nucleotide sequence shown in SEQ ID NO.1 (TTTTTGCCCCTAACCCTAAAATCCGTCGAGCAGAGTT), and is connected to a thiol group at the 5' end;

[0013] The short DNA chain FL-chain has a nucleotide sequence shown in SEQ ID NO.2 (GTTAGGGGC), and a fluorescent group is connected to the 3' end.

[0014] Another aspect of the present invention provides a method for detecting telomerase activity, comprising the following steps:

[0015] Providing the detection kit described above;

[0016] Extract telomerase from cells;

[0017] Adding the telomerase extract to be tested into the extension reaction solution, and incubating at a constant temperature to obtain a detection solution;

[0018] The detection solution is added dropwise to the sample plate of the detection kit, and the color and fluorescence changes of the colloidal gold on the detection test line are observed.

[0019] Another aspect of the present invention also provides the use of the above-mentioned test strip or test kit in the detection of telomerase activity or the visual detection of tumor cells.

[0020] Beneficial effects of the present invention:

[0021] The test strip of the present invention realizes a dual response to telomerase activity by combining colloidal gold color development and fluorescence detection, and achieves a naked eye visualization effect of telomerase activity, which is simple and intuitive. Compared with a single color development test strip, it is more reliable and effectively reduces the false positive rate.

[0022] The detection paper of the present invention prints the streptavidin-biotinylated capture probe sequence on the nitrocellulose membrane, combines with the target, has a cascade amplification effect, and can improve the detection sensitivity. In addition, the capture probe sequence in the present invention is fixed in the test area, so that the gold nanoparticles after detection are fixed in the test area, thereby ensuring the long-term preservation of the color development structure.

[0023] The detection kit of the present invention incubates DNA-colloidal gold nanoprobes with fluorescent group-modified DNA short chains FL-chains to obtain double-stranded DNA-colloidal gold nanoparticle spherical nucleic acid probes, thereby achieving a dual response for specific detection of telomerase sequences.

[0024] In addition, the present invention has the advantages of rapid, convenient and visual detection of telomerase activity. The sample reacting with telomerase is simply dropped onto the test paper, and color will develop within a few minutes (such as 5 minutes), which can be directly observed by the naked eye without the need for other auxiliary tools.

[0025] The test strip and the test kit of the present invention can achieve qualitative analysis of telomerase activity in tumor cells, distinguish whether it is a tumor cell by naked eye and ultraviolet light source, and establish a dual response system of naked eye visualization and fluorescence visualization of tumor cells. In addition, this probe does not need to be washed during the process of detecting telomerase activity in cells, and can be directly used for naked eye observation, which has significant advantages. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a schematic diagram of the detection principle of the dual-response telomerase rapid detection test strip prepared in Example 1.

[0027] Figure 2 is the electron transmission (TEM) image of the colloidal gold nanoparticles prepared in Example 1 ( Figure 2 A) and high resolution electron transmission (HRTEM) images ( Figure 2 B).

[0028] Figure 3 This is the fluorescence spectrum of the colloidal gold spherical nucleic acid probe prepared in Example 1.

[0029] Figure 4 This is a graph showing the specific response of the colloidal gold spherical nucleic acid probe to telomerase in Example 2.

[0030] Figure 5 This is a graph showing the fluorescence response of the colloidal gold spherical nucleic acid probe to telomerase in Example 2.

[0031] Figure 6 This is a fluorescence image of the colloidal gold spherical nucleic acid probe in Example 2 after responding to the fluorescence of telomerase under a flashlight-type ultraviolet lamp.

[0032] Figure 7 This is the visual detection of telomerase activity in Hela cell lysate in Example 2 (colloidal gold color development).

[0033] Figure 8 This is the visualization detection (fluorescence detection) of telomerase activity in the Hela cell lysate in Example 2. DETAILED DESCRIPTION

[0034] Embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0035] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0036] The first aspect of the present invention provides a test strip for detecting telomerase activity. The test strip described herein has a structure that is substantially the same as the common telomerase activity test strip in the art, and comprises a bottom plate, a nitrocellulose membrane is provided on the surface of the bottom plate, a sample plate and a water absorption plate are provided at both ends of the nitrocellulose membrane, the sample plate and the water absorption plate are both located on the upper part of the nitrocellulose membrane and partially overlapped therewith, and in addition, a binding plate is overlapped at one end of the sample plate away from the overlap of the nitrocellulose membrane, and the binding plate is located on the upper part of the sample plate. The overlap described herein means that a part of the A component overlaps with another part of the B component and does not completely cover it.

[0037] In the present invention, a test area is provided on the nitrocellulose membrane, and a first test line close to the sample plate and a second test line close to the water absorption plate are printed in the test area;

[0038] Among them, the first and second detection lines are formed by printing the first and second capture probe sequences ylated with streptavidin-biotin respectively, the first capture probe is used to capture the DNA neck ring structure extended after the telomerase reaction, and the second capture probe is used to capture the DNA sequence connected with the fluorescent group that is replaced after the telomerase reaction.

[0039] The present invention sets two detection lines in the test area, one of which is a DNA sequence complementary to the more stable DNA neck ring structure formed after telomerase catalysis extension, and the other is a DNA sequence complementary to the DNA sequence modified with a fluorescent group replaced after the telomerase reaction. Through the design in the present invention, dual response visualization (colloidal gold and fluorescence) of telomerase detection can be achieved, and the telomerase extension product and the replaced DNA containing a fluorescent group have a rapid and sensitive response, reduce the false positive rate, and can achieve dual visualization detection of tumor cell telomerase activity.

[0040] In some specific embodiments of the present invention, the nucleotide sequence of the first capture probe is shown as SEQ ID NO.3 (CCCTAACCCTAACCCT);

[0041] The nucleotide sequence of the second capture probe is shown in SEQ ID NO.4 (GCCCCTAAC).

[0042] In addition, the test area also includes a control line, which is located between the second detection line and the water absorption plate. The control line is formed by printing a streptavidin-biotinylated control probe sequence. The nucleotide sequence of the control probe is shown in SEQ ID NO.5 (AACTCTGCTCGACGGATT), which can hybridize with telomerase substrate DNA.

[0043] In the present invention, the formation of the first detection line, the second detection line and the control line adopts methods well known in the art without special restrictions. For example, in some specific embodiments of the present invention, the nucleotide sequences of the first capture probe, the second capture probe and the control probe are first provided, and then biotin is connected to the 5' end of the nucleotide sequence, respectively, and then the modified sequence is incubated with streptavidin to prepare a streptavidin-biotinylated detection line or control line sequence, which is printed on the test area of ​​the nitrocellulose membrane.

[0044] There is no particular limitation on the printing method, and conventional means in the art, such as spraying, etc., may be used.

[0045] Further, in the present invention, the sample plate contains a cross-linking buffer, so as to control the pH value and ionic strength of the solution flowing out of the sample plate, minimize the fluctuation factors, and improve the specificity and sensitivity of the detection. The specific cross-linking buffer can be of a type or type well known in the art, for example, in some specific embodiments of the present invention, the cross-linking buffer contains Triton X-100, BSA, glucose and polyethylene glycol-400.

[0046] The second aspect of the present invention provides a detection kit for detecting telomerase activity, comprising the above-mentioned detection test paper and an extension reaction solution.

[0047] In the present invention, the extension reaction liquid includes a colloidal gold spherical nucleic acid probe solution, wherein the colloidal gold spherical nucleic acid probe is formed by modifying double-stranded DNA on the surface of the colloidal gold nanoparticles with colloidal gold nanoparticles as the core; wherein the double-stranded DNA is formed by hybridization of a long DNA chain TP-chain and a short DNA chain FL-chain, and the long DNA chain TP-chain contains a telomerase primer sequence, and the 3' end of the short DNA chain FL-chain is modified with a fluorescent group.

[0048] In the present invention, the long DNA chain TP-chain in the double-stranded DNA modified on the surface of colloidal gold nanoparticles has three functional domains, a TP sequence for the specificity of the telomerase catalytic core, a sequence complementary to the telomeric repeat sequence, and a spacer, which helps to reduce steric hindrance. The short DNA chain FL-chain is modified with a fluorescent group at its 3' end, which is quenched due to its proximity to the colloidal gold nanoparticles. In the presence of telomerase, the chain carrying TP is recognized by the catalytic core of telomerase, and the telomeric repeat sequence is extended, thereby forming a more stable DNA neck ring structure. The FL chain is replaced into the solution to restore its fluorescence. Among them, the formed DNA neck ring structure can be complementary to the first capture sequence of the test area, and the replaced DNA sequence modified with the fluorescent group can be complementary to the second capture sequence of the test area, thereby achieving a dual response for telomerase activity detection.

[0049] In some specific embodiments of the present invention, the DNA long chain TP-chain has a nucleotide sequence shown in SEQ ID NO.1 (TTTTTGCCCCTAACCCTAAAATCCGTCGAGCAGAGTT), and is connected to a thiol group at the 5' end, so that the DNA long chain TP-chain is loaded onto the surface of the colloidal gold particles by gold-thiol bonding.

[0050] The short DNA chain FL-chain has a nucleotide sequence shown in SEQ ID NO.2 (GTTAGGGGC), and is connected to a fluorescent group at the 3' end, wherein the fluorescent group can be a common type in the art, and examples that can be mentioned include FAM, Cy3, Cy5, FITC, Alexa Fluor 488 or TAMRA, but are not limited thereto. In some specific embodiments of the present invention, preferably, the connected fluorescent group is FAM.

[0051] In the present invention, the preparation of the colloidal gold spherical nucleic acid probe comprises the following steps:

[0052] The colloidal gold nanoparticles were connected with the thiol-modified DNA long chain TP-chain by incubation to obtain DNA-colloidal gold nanoprobes;

[0053] A short DNA chain FL-chain connected with a fluorescent group is incubated with a DNA-colloidal gold nanoprobe to obtain a double-stranded DNA-colloidal gold nanoparticle spherical nucleic acid probe.

[0054] There is no particular limitation on the specific preparation conditions, and those skilled in the art can determine them based on known methods or experiments, and those skilled in the art have such capabilities.

[0055] It is understandable that the concentration of the colloidal gold spherical nucleic acid probe solution can be selected or optimized by those skilled in the art as needed, without special restrictions. In the present invention, preferably, the concentration of the colloidal gold spherical nucleic acid probe solution is 5nM to 2mM, for example, it can be any concentration of 5nM, 6nM, 8nM, 1mM, 1.2mM, 1.5mM, 1.6mM, 1.8mM, 2mM. In some specific embodiments of the present invention, the colloidal gold spherical nucleic acid probe solution is a 6mM mother solution of the colloidal gold spherical nucleic acid probe dispersed in a PBS buffer, and then diluted to a corresponding concentration as needed.

[0056] Further, it is understood that the extension reaction solution also includes an amplification buffer and dNTPs required for the telomerase reaction, and their specific types and preparations are well known to technicians in the field, so there is no special limitation here. In some specific embodiments of the present invention, the amplification buffer is 10×TRAP, which specifically consists of 200mM Tris-HCl, pH 8.3, 15mM MgCl2, 630mM KCl, 0.5% Tween 20, 10mM EGTA and 100mM RIPA.

[0057] In the present invention, the preparation method of the detection kit is not particularly limited, and can be prepared by conventional methods in the art. For example, in some specific embodiments of the present invention, the following steps are specifically included:

[0058] preparing a colloidal gold spherical nucleic acid probe solution;

[0059] Providing a biotinylated detection line sequence, incubating the biotinylated detection line sequence with streptavidin to prepare a streptavidin-biotinylated detection line sequence, and spraying the streptavidin-biotinylated detection line sequence onto a test area of ​​a nitrocellulose membrane;

[0060] The sample plate was soaked in cross-linking buffer and dried.

[0061] On the bottom plate, the sample plate, the nitrocellulose membrane and the water absorption plate are overlapped in sequence.

[0062] The third aspect of the present invention provides a method for detecting telomerase activity, comprising the following steps:

[0063] Providing the detection kit described in the above item;

[0064] Extract telomerase from cells;

[0065] Adding the telomerase extract to be tested into the extension reaction solution, and incubating at a constant temperature to obtain a detection solution;

[0066] The detection solution is added dropwise to the sample plate of the detection kit, and the color and fluorescence changes of the colloidal gold on the detection test line are observed.

[0067] The present invention drips the sample after the specific catalytic extension of the telomerase substrate DNA onto the test paper, which can spontaneously carry out a series of reactions such as liquid flow, gold nanoparticle hydration, DNA hybridization, color development, etc. The color development can be observed within 10 minutes, thereby being used for rapid and convenient detection of telomerase activity.

[0068] The extraction of telomerase in the present invention is a conventional technique in the art and will not be described in detail here.

[0069] The fourth aspect of the present invention provides the use of the above-mentioned test strip or the above-mentioned detection kit in the detection of telomerase activity or the visual detection of tumor cells.

[0070] Those skilled in the art know that the lateral flow technique uses the spontaneous migration of samples on the nitrocellulose porous membrane under capillary action, and utilizes the enrichment and accumulation of particles that play a signal reporting role in a specific area to form a visual strip, and completes the separation and detection during the chromatography process. It has the advantages of low professional requirements for personnel, short analysis time, no reliance on complex instruments, easy to carry and store, etc., and can better meet the needs of fixed-point rapid analysis. Gold nanoparticles (colloidal gold nanoparticles) have good stability and biocompatibility, can rely on covalent binding, coordination and hydrophobic effects to connect a variety of biomolecules, and because the visible light wavelength meets its surface plasma resonance conditions, it can show strong colors at nanomolar concentrations, and is an ideal material for biomolecule loading and strip color development. Compared with antibodies commonly used in lateral flow technology, DNA molecules are easy to synthesize, have high stability, long shelf life, and are easy to modify. DNA-modified gold nanoparticles have anti-degradation stability due to the local high salt concentration of the surface DNA layer, and can maintain their recognition characteristics under flow conditions after rehydration during the chromatography process.

[0071] The present invention is based on the specific catalytic extension of telomerase substrate DNA by telomerase, utilizes the hybridization characteristics of DNA chains, and constructs a telomerase activity detection test strip and a detection kit with the help of lateral flow technology. The detection test strip and the detection test strip of the present invention respond sensitively and rapidly to the telomerase extension product, and realize the dual detection effect of visual detection of telomerase activity and fluorescence detection.

[0072] The present invention is described below by means of specific examples. It should be noted that the following specific examples are only for illustrative purposes and do not limit the scope of the present invention in any way. In addition, unless otherwise specified, methods without specific conditions or steps are conventional methods, and the reagents and materials used can be obtained from commercial channels.

[0073] Example 1 Preparation of test strips and test kits for detecting telomerase activity

[0074] This embodiment discloses a method for preparing a test strip and a test kit for detecting telomerase activity, which specifically comprises the following steps:

[0075] 1. Preparation of test strips

[0076] (1) 10 mM biotinylated test line sequence or control line sequence (Table 1) was mixed with 1 mg / mL streptavidin and incubated at room temperature for 2 h to obtain streptavidin-biotinylated DNA.

[0077] (2) Spray the test line sequence (capturing colloidal gold chain and capturing fluorescent chain sequence in Table 1) and the control line sequence after the above treatment on the test line and the control line of the CN95 nitrocellulose membrane, respectively, and dry them.

[0078] (3) The sample plate was immersed in a cross-linking buffer (mass percentage: 1% BSA, 0.5% Triton X-100, 2% Glucose, 2% PEG-400) for 30 min and dried.

[0079] (4) Assemble the CN95 nitrocellulose membrane, the water absorption plate, and the sample plate on the bottom plate in sequence. The length of each part is: CN95 nitrocellulose membrane 26 mm, water absorption plate 18 mm, sample plate 14 mm, and the joints of each part overlap by 2 mm to ensure the fluidity of the liquid on the device;

[0080] (5) Cut the assembled large board into test strips with a width of 4 mm, secure them with white card covers to protect the test strips, and store them in a dry environment away from light.

[0081] 2. Synthesis of colloidal gold nanoparticles and DNA modification

[0082] (1) Colloidal gold nanoparticles were synthesized by reducing HAuCl4·4H2O with sodium citrate. Specifically, 100 mL of HAuCl4·4H2O aqueous solution was heated to boiling, and 2 mL of 1% sodium citrate solution was quickly added under vigorous stirring. The mixture was boiled for 10 min, and then the heating was stopped and stirring was continued for 15 min. The solution was cooled to room temperature and filtered through a 0.22 μm filter membrane to obtain the colloidal gold nanoparticles required for the experiment, which were then stored in a refrigerator at 4°C.

[0083] in, Figure 2 The electron transmission TEM image of colloidal gold nanoparticles is shown in ( Figure 2 A) and high resolution electron transmission (HRTEM) images ( Figure 2 B), it can be seen from the figure that the particle size of the colloidal gold nanoparticles prepared in this embodiment is 15nm to 20nm.

[0084] (2) The probe sequence long chain TP-chain (Table 1) was activated with 10 mmol / L tris(2-carboxyethyl)phosphine hydrochloride (TCEP), and 5 μl of the activated probe sequence was added dropwise to 100 μl of a stirred solution of gold nanoparticles concentrated ten times, and 600 μl of n-butanol was added for dehydration, and the solution was shaken until the solution was colorless, and centrifuged at 800 rpm to remove the supernatant. Then, the solution was washed with 100 μl of deionized water and PBS respectively, and centrifuged (8000 rpm, 15 min), the supernatant was removed, and dissolved with 100 μl of PBS. Then, 5 μl of a fluorescent group (FAM) modified DNA short chain FL-chain (Table 1) was added thereto, and the solution was incubated in a water bath at 37°C for 4 h. After the temperature dropped to room temperature, the solution was centrifuged at 8000 rpm, the supernatant was removed, and the solution was washed twice with PBS to remove the free fluorescent group modified DNA short chain (centrifugation speed 8000 rpm). Finally, it was dispersed in 100 μl of PBS buffer to obtain the colloidal gold spherical nucleic acid probe solution used in the experiment.

[0085] The colloidal gold spherical nucleic acid probe was analyzed by fluorescence spectroscopy. Figure 3 As shown in , it can be seen that the synthesized colloidal gold spherical nucleic acid probe has almost no fluorescence and the fluorescent group is quenched.

[0086] The detection kit consists of: a detection test strip and an extension reaction solution, the extension reaction solution includes a colloidal gold spherical nucleic acid probe solution, an amplification buffer 10×TRAP and dNTPs; 10×TRAP is composed of 200mM Tris-HCl, pH 8.3, 15mMMgCl2, 630mM KCl, 0.5% Tween 20, 10mM EGTA and 100mM RIPA.

[0087] Table 1 Oligonucleotide sequences involved in Example 1

[0088] name Sequence (5'→3') Long chain TP-chain 5'-HS-TTTTTGCCCCTAACCCTAAAATCCGTCGAGCAGAGTT-3' Fluorescent chain FL-chain 5′-GTTAGGGGC-3′-FAM Capturing Colloidal Gold Chains 5'-biotin-CCCTAACCCTAACCCT Capturing fluorescent chains 5'-biotin-GCCCCTAAC Control Chain 5'-biotin-AACTCTGCTCGACGGATT

[0089] The principle of the detection kit in this embodiment is as follows Figure 1 As shown: When telomerase is active, the substrate DNA undergoes chain extension under the catalysis of telomerase; the molecular beacon consists of a long chain carrying the telomerase primer (TP) and a short DNA chain (FL) modified with a fluorophore, which are pre-hybridized before being fixed on the surface of colloidal gold nanoparticles through a strong Au-thiol linkage. The chain carrying TP has three functional domains: a TP sequence (18 bp) for specific recognition by the catalytic core of telomerase, an extended (CCCTAA)3 sequence complementary to the telomeric repeat sequence, and an additional sequence of TTTTTGCAGC, where GCAGC is partially complementary to the FL chain and T5 is a spacer that helps to reduce steric hindrance. The FL chain (5′-GTTAGGGGC-3′) contains a fluorophore (FAM) at its 3′ end, which is quenched due to its proximity to the colloidal gold nanoparticle. In the presence of telomerase, the chain carrying TP is recognized by the catalytic core of telomerase, and the telomeric repeat sequence TTAGGG is elongated, thereby forming a more thermally stable DNA hairpin structure. The FL chain is then displaced into solution, restoring its fluorescence for detection.

[0090] Example 2 Detection of telomerase activity

[0091] This example detects telomerase activity based on the detection kit in Example 1, and the specific steps are as follows:

[0092] 1. Cell collection and extraction of intracellular telomerase

[0093] Human cervical cancer cells (Hela cells, from Shanghai Cell Bank) were cultured in a 37°C constant temperature incubator (95% air, 5% CO2) using DMEM medium (containing 10% fetal bovine serum) (L110KJ, purchased from China Bio-Industry (BI)). When the cell density reached 95%, the cells were digested with trypsin and counted. 10 7 Cells were centrifuged at 1200 rpm and 4°C for 5 min in a 1.5 mL EP tube and washed twice with PBS. Resuspended in 1 ml of cooled cell lysis buffer (RIPALysis Buffer II, Shanghai Bioengineering) and lysed at 4°C for 30 min by shaking. Centrifuged at 11000 rpm for 20 min at 4°C to remove cell debris, and the cell lysate was quickly frozen in liquid nitrogen and stored in a -80°C refrigerator.

[0094] 2. Different volumes of Hela cell lysate were incubated with a reaction solution containing 50 μl of the probe (6 nM), 20 μl of 10×TRAP (200 mM Tris-HCl, pH 8.3, 15 mM MgCl2, 630 mM KCl, 0.5% Tween 20, 10 mM EGTA, 100 mMRIPA), and 4 μl of a mixture of 10 mM dNTPs (the volume was adjusted to 200 μl with DEPC-treated water) at 37°C for 1 h.

[0095] Figure 4 This is the specific response diagram of colloidal gold spherical nucleic acid probe to telomerase. It can be seen that in the absence of telomerase, the colloidal gold spherical nucleic acid probe has basically no fluorescence. When reacting with 2000 human cervical cancer cell Hela cell lysate, that is, in the presence of telomerase, the long chain TP-chain is extended to form a neck ring structure, and the short chain with the fluorescent group falls off, and the fluorescence is restored. After the telomerase activity in the Hela cell lysate is inactivated and incubated with the colloidal gold spherical nucleic acid probe, the solution has basically no fluorescence.

[0096] Further, combined with Figure 5 , cell lysates with different telomerase contents were added to the reaction system containing colloidal gold spherical nucleic acid fluorescent probes. Under the action of telomerase, the long TP-chain was extended to form a neck ring structure, and the short chain with fluorescent groups fell off, and the fluorescence was restored. The fluorescence intensity was measured with a fluorescence meter. As the number of cells increased, the fluorescence intensity also gradually increased and eventually reached a platform.

[0097] Figure 6 This is an optical photograph of the solution after telomerase reaction was irradiated with a handheld UV lamp. It can be clearly observed that the solution emits fluorescence (the order from left to right in the figure is 10 4 cells, 2000 cells, 1000 cells, 100 cells).

[0098] At the same time, in this embodiment, the solution after the reaction is dripped into the hole of the test paper, and the colloidal gold color development can be clearly seen after 5 minutes ( Figure 7 ), the order in the figure is blank control, group 1 (100 cells), group 2 (200 cells), group 3 (500 cells), and group 4 (2000 cells). Figure 8 The corresponding fluorescence images on the test paper are displayed (from left to right: 100 cells, 200 cells, 500 cells, 2000 cells).

[0099] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0100] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A test strip for detecting telomerase activity, comprising a bottom plate, a nitrocellulose membrane is provided on the surface of the bottom plate, a sample plate and a water absorption plate are provided at both ends of the nitrocellulose membrane, the sample plate and the water absorption plate are both located on the upper part of the nitrocellulose membrane and partially overlapped therewith, characterized in that: The nitrocellulose membrane is provided with a test area, in which a first test line close to the sample plate and a second test line close to the water absorption plate are printed; Among them, the first and second detection lines are formed by printing the first and second capture probe sequences ylated with streptavidin-biotin respectively, the first capture probe is used to capture the DNA neck ring structure extended after the telomerase reaction, and the second capture probe is used to capture the DNA sequence connected with the fluorescent group that is replaced after the telomerase reaction.

2. The test strip for detecting telomerase activity according to claim 1, characterized in that: The nucleotide sequence of the first capture probe is shown in SEQ ID NO.3; The nucleotide sequence of the second capture probe is shown in SEQ ID NO.

4.

3. The test strip for detecting telomerase activity according to claim 1, characterized in that: The test area also includes a control line, which is located between the second test line and the water absorption plate. The control line is formed by printing a streptavidin-biotinylated control probe sequence, and the nucleotide sequence of the control probe is shown in SEQ ID NO.

5.

4. The test strip for detecting telomerase activity according to claim 1, characterized in that: The sample plate contains a cross-linking buffer; Preferably, the cross-linking buffer contains Triton X-100, BSA, glucose and polyethylene glycol-400.

5. A detection kit for detecting telomerase activity, characterized in that: The invention comprises the test strip according to any one of claims 1 to 4 and an extension reaction solution, wherein the extension reaction solution comprises a colloidal gold spherical nucleic acid probe solution, wherein the colloidal gold spherical nucleic acid probe is formed by using colloidal gold nanoparticles as the core and double-stranded DNA is modified on the surface of the colloidal gold nanoparticles; Wherein, the double-stranded DNA is formed by hybridization of a long DNA chain TP-chain and a short DNA chain FL-chain, and the long DNA chain TP-chain contains a telomerase primer sequence, and the 3' end of the short DNA chain FL-chain is modified with a fluorescent group; Preferably, the DNA long chain TP-chain has the nucleotide sequence shown in SEQ ID NO.1, and is connected to a thiol group at the 5' end; The short DNA chain FL-chain has the nucleotide sequence shown in SEQ ID NO.2, and a fluorescent group is connected to the 3' end; Preferably, the fluorescent group is FAM, Cy3, Cy5, FITC, Alexa Fluor 488 or TAMRA.

6. The detection kit for detecting telomerase activity according to claim 5, characterized in that: The concentration of the colloidal gold spherical nucleic acid probe solution is 5nM to 2mM.

7. The detection kit for detecting telomerase activity according to claim 5, characterized in that: The preparation of the colloidal gold spherical nucleic acid probe comprises the following steps: The colloidal gold nanoparticles were connected with the thiol-modified DNA long chain TP-chain by incubation to obtain DNA-colloidal gold nanoprobes; A short DNA chain FL-chain connected with a fluorescent group is incubated with a DNA-colloidal gold nanoprobe to obtain a double-stranded DNA-colloidal gold nanoparticle spherical nucleic acid probe.

8. The detection kit for detecting telomerase activity according to claim 5, characterized in that: The extension reaction solution also includes an amplification buffer and dNTPs; Preferably, the amplification buffer is 10×TRAP, specifically composed of 200 mM Tris-HCl, pH 8.3, 15 mM MgCl2, 630 mM KCl, 0.5% Tween 20, 10 mM EGTA and 100 mM RIPA.

9. A method for detecting telomerase activity, characterized in that: The following steps are involved: Providing a detection kit according to any one of claims 5 to 8; Extract telomerase from cells; Adding the telomerase extract to be tested into the extension reaction solution, and incubating at a constant temperature to obtain a detection solution; The detection solution is added dropwise to the sample plate of the detection kit, and the color and fluorescence changes of the colloidal gold on the detection line are observed.

10. Use of the test strip according to any one of claims 1 to 4 or the test kit according to any one of claims 5 to 8 in detecting telomerase activity or visually detecting tumor cells.

Images