Application of PHF8 as glioma stem cell specific molecular marker or target

Abstract

The invention discloses application of PHF8 as a glioma stem cell specific molecular marker or target spot, the invention proposes that PHF8 in GSC cells in GBM is highly expressed for the first time, and the PHF8 with a high expression level promotes dry maintenance, proliferation, balling and invasion and migration capabilities of GSC; by inhibiting the PHF8 in the GSC, the expression level of the PHF8 in the GSC can be reduced, and the dry maintenance, proliferation, balling, invasion and migration capabilities of the GSC are inhibited, so that the malignant development of GBM is inhibited. Besides, compared with high expression of neural progenitor cells, non-stem glioma cells and PHF8 in GSC, the invention finds that the expression has significant difference, which can provide a basis for judgment of glioma stem cells, and further provides a new scheme for diagnosis of GBM and judgment of malignancy degree.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and in particular relates to the application of PHF8 as a specific molecular marker or target of glioma stem cells. Background Art

[0002] Glioblastoma (GBM) is the most common and most aggressive primary brain tumor in adults, with high malignancy and strong invasiveness. Current treatment strategies include surgical resection, temozolomide chemotherapy, and radiotherapy, but the tumor is obviously resistant to treatment and is prone to recurrence. The overall median survival time of patients is short, only 15-16 months, and there is an urgent need to find effective treatment strategies.

[0003] Glioblastoma stem cells (GSCs) are a subpopulation of cells in GBM that are highly resistant to conventional treatments. They have unique self-renewal ability, multidirectional differentiation potential, tumorigenesis drive, and strong proliferation ability, and are closely related to tumor evolution and recurrence. Therefore, screening the key targets of GSCs and elucidating their new regulatory mechanisms may provide new ideas for the treatment of GBM.

[0004] Recent studies have shown that changes in epigenetic modifications are closely related to the proliferation, invasion and prognosis of gliomas, and their regulation mainly includes DNA methylation, histone modification, microRNA abnormalities, chromatin remodeling, etc. Histone methylation modification is a key epigenetic regulatory feature, which is mainly regulated by histone methyltransferases (HMTs) and histone demethylases (KDMs). The histone lysine (K)-specific demethylase (KDM) protein family plays an important role in the occurrence and development of tumors. Their dysregulation is often associated with human diseases such as cancer, immune disorders, neurological disorders and developmental abnormalities.

[0005] PHF8 is a member of the histone demethylase family containing the JmjC domain. Its N-terminal PHD domain can recognize and bind to nucleosomes modified with H3K4me3, and its C-terminal JmjC domain can eliminate H3K9me1, H3K9me2, H4K20me1, and H3K27me2 chromatin repressive modifications, and participate in regulating many biological functions such as cell cycle progression and individual development. Although the role of PHF8 in regulating the occurrence and development of various tumors has been widely reported in tumors such as leukemia, gastric cancer, breast cancer, and prostate cancer, the role of histone demethylase PHF8 in GBM progression and whether it affects the stemness phenotype of GSCs remains unclear. It is urgent to conduct in-depth research on the histone demethylase PHF8 that regulates GSCs, so as to provide new targets or markers for targeting GSCs to treat glioblastoma and distinguish the malignancy of glioma. Summary of the invention

[0006] In view of this, the primary purpose of the present invention is to provide the application of PHF8 as a glioma stem cell-specific molecular marker or target. The present invention determines that PHF8 is highly expressed in glioblastoma, and PHF8 can be used as a marker for evaluating the malignancy of glioma; the present invention also determines that the mRNA and protein levels of PHF8 in glioma stem cells are significantly upregulated, and knocking out PHF8 can not only inhibit the proliferation, 3D clone formation, migration and invasion of glioma stem cells, but also inhibit the maintenance of glioma stem cell stemness; in addition, the present invention also determines the expression difference of PHF8 in glioma stem cells and neural progenitor cells or non-stem glioma cells, providing a new idea for distinguishing glioma stem cells.

[0007] The specific technical solutions of the present invention are as follows:

[0008] One aspect of the present invention provides the use of a reagent for detecting the expression level of PHF8 in the preparation of at least any one of the following products:

[0009] a: Evaluate the malignancy of glioma;

[0010] b: Differentiation between glioma stem cells and neural progenitor cells;

[0011] c: Differentiation between glioma stem cells and non-stem glioma cells;

[0012] d: Evaluation of the content of glioma stem cells in tumor tissues.

[0013] Another aspect of the present invention provides an in vitro detection product, which is used to determine the malignancy of glioblastoma, or to distinguish glioma stem cells from neural progenitor cells, or to distinguish glioma stem cells from non-stem glioma cells, or to evaluate the content of glioma stem cells in tumor tissue, and the in vitro detection product contains a reagent for detecting the expression level of PHF8.

[0014] Another aspect of the present invention provides the use of a PHF8 inhibitor in the preparation of a medicament or a pharmaceutical composition, wherein the medicament or the pharmaceutical composition has at least any one of the following effects:

[0015] a: Inhibit the stemness of glioma stem cells;

[0016] b: Inhibit the maintenance and / or proliferation of glioma stem cells;

[0017] c: inhibiting the sphere size, number, and / or frequency of spheres of glioma stem cells;

[0018] d: Inhibit the migration and / or invasion ability of glioma stem cells;

[0019] e: Inhibit the progression of glioblastoma.

[0020] Another aspect of the present invention provides a medicament or a pharmaceutical composition, wherein the medicament or the pharmaceutical composition contains an effective amount of a PHF8 inhibitor.

[0021] Another aspect of the present invention provides a method for inhibiting glioma stem cells for non-therapeutic purposes, the method comprising the step of applying an effective amount of a PHF8 inhibitor to the glioma stem cells.

[0022] Another aspect of the present invention provides a method for distinguishing glioma stem cells, the method comprising the following steps:

[0023] Detecting the expression level of PHF8 in the cells to be tested;

[0024] Comparing the PHF8 expression level in the detected cells with the PHF8 expression level in reference cells, wherein the reference cells are neural progenitor cells or non-stem glioma cells;

[0025] If the expression level of PHF8 in the test cell is higher than that in the reference cell, the test cell is determined to be a glioma stem cell.

[0026] Beneficial effects of the present invention:

[0027] This study found for the first time that compared with normal tissues, the expression level of PHF8 was increased in glioblastoma tissues, and both the mRNA and protein levels of PHF8 were significantly upregulated in glioma stem cells. Knocking out PHF8 can not only inhibit the proliferation, 3D clone formation, migration and invasion of glioma stem cells, but also inhibit the maintenance of glioma stem cell stemness. In short, abnormal regulation of PHF8 plays an important role in glioblastoma, and the development of new drugs targeting it is expected to bring more effective treatment options for glioma patients. This discovery provides new ideas and directions for the clinical treatment and basic research of glioblastoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The expression and survival analysis of PHF8 in GBM using TCGA and CGGA RNA-Seq datasets showed that PHF8 expression was increased in GBM in both TCGA and CGGA databases ( Figure 1 a and Figure 1 b), Normal represents normal brain tissue, and Tumor represents glioblastoma tissue; and is positively correlated with the poor prognosis of GBM patients ( Figure 1 c and Figure 1 d), PHF8 expression level is positively correlated with the grade of glioma ( Figure 1 e).

[0029] Figure 2 To detect the expression of PHF8 in normal tissue (epileptic tissue), low-grade glioma (WHO grade 2), and high-grade glioma (GBM) by immunohistochemistry. Figure 2 a is the result of immunohistochemical staining. Figure 2 b is the statistical result.

[0030] Figure 3 In order to find out the expression of PHF8 gene in glioma stem cells through GSE86237 dataset and GSE102244 transcriptome dataset analysis ( Figure 3 a and Figure 3 b) and the correlation with dryness index ( Figure 3 c).

[0031] Figure 4 Real-time fluorescence quantitative PCR ( Figure 4 a) and Western blotting experiments ( Figure 4 b) Detect the expression of PHF8 in multiple GSC cell lines and NPC cells.

[0032] Figure 5 To detect the expression of PHF8 in glioma stem cells (GSC) and non-stem glioma cells (NSTC) by real-time fluorescence quantitative PCR and protein immunoblotting. Figure 5 a is the protein expression of PHF8 detected by western blot in two paired GSC-NSTC cell lines, with α-tubulin as the internal reference protein, SOX2 and OLIG2 as stemness markers, and GFAP as the differentiation marker; Figure 5 b and Figure 5 c Real-time fluorescence quantitative PCR detected the mRNA expression of PHF8 in two paired GSC-NSTC cell lines.

[0033] Figure 6 To detect whether PHF8 is highly expressed in the glioma stem cell GSC1 at the same location as the stemness markers SOX2 and OLIG2 by immunofluorescence, and to verify that PHF8 is associated with the stemness of glioma stem cells.

[0034] Figure 7 To verify the knockout effect of PHF8, the expression level of PHF8 was analyzed by protein immunoblotting.

[0035] Figure 8 To investigate the effect of PHF8 knockout on the proliferation of glioma stem cells using CCK-8 reagent, two cell lines GSC1 ( Figure 8 a) and GSC2( Figure 8 b) The experiment was performed in biological replicates.

[0036] Fig. 9 The 3D soft agar clone formation experiment was used to observe the changes in the clone formation ability of glioma stem cells after knocking out PHF8. Fig. 9 a Selected representative images are shown. Fig. 9 b presents the Fig. 9 a Statistical analysis of count data, where the counts in the control group were normalized to 1.

[0037] Fig.10 To explore the effect of knocking out PHF8 on the number and size of spheres of glioma stem cells, two cell lines were used for biological replication. Two indicators for judging the stemness of glioma stem cells—the number and size of spheres—were selected for indication. Fig.10 a Selected representative images are shown. Fig.10 b and Fig.10 c presents a Fig.10 a Statistical analysis of count data, where the counts in the control group were normalized to 1.

[0038] Fig.11 In order to investigate the effect of PHF8 knockout on the self-renewal ability of glioma stem cells through in vitro limiting dilution experiments, Fig.11 a and Fig.11b The statistical results of tumor spheroids with diameters greater than 50 μm in GSC1 and GSC2, Fig.11 c and Fig.11 d are the statistical results of ball formation frequency in GSC1 and GSC2, respectively.

[0039] Fig.12 To investigate the effect of PHF8 knockout on the migration and invasion ability of glioma stem cells. Fig.12 a, 12d show selected representative images of GSC1 and GSC2. Fig.12 b, 12c, 12e, and 12f present the Fig.12 a, Statistical analysis of 12-day counting data, where the counts in the control group were normalized to 1. DETAILED DESCRIPTION

[0040] Embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0042] The first aspect of the present invention discloses the use of a reagent for detecting the expression level of PHF8 in the preparation of at least any one of the following products:

[0043] a: Evaluate the malignancy of glioma;

[0044] b: Differentiation between glioma stem cells and neural progenitor cells;

[0045] c: Differentiation between glioma stem cells and non-stem glioma cells;

[0046] d: Evaluation of the content of glioma stem cells in tumor tissues.

[0047] The second aspect of the present invention discloses an in vitro detection product, which is used to determine the malignancy of glioblastoma, or to distinguish glioma stem cells from neural progenitor cells, or to distinguish glioma stem cells from non-stem glioma cells, or to evaluate the content of glioma stem cells in tumor tissue, and the in vitro detection product contains a reagent for detecting the expression level of PHF8.

[0048] The present invention determines that PHF8 is highly expressed in GBM through bioinformatics analysis and experimental verification, and verifies that PHF8 is differentially expressed in glioma stem cells, neural progenitor cells or non-stem glioma cells. Therefore, PHF8 can be used as a biomarker or target to evaluate or distinguish the malignancy of glioma and glioma stem cells, and an in vitro detection product is proposed based on this.

[0049] Specifically, PHF8 has a higher expression level in glioblastoma compared to normal tissues. The expression level of PHF8 in glioma is related to the grade. High-grade glioblastoma has a high expression level of PHF8, while the corresponding normal tissue and low-grade glioma tissue have a low expression level of PHF8. Therefore, the malignancy of glioma can be evaluated by detecting the expression level of PHF8 in glioma tissue.

[0050] The in vitro detection product described in the present invention is not for diagnostic or therapeutic purposes. The in vitro detection product contains a reagent for detecting the expression level of PHF8, so the detection result of PHF8 in the sample can be obtained, which provides support for evaluating the malignancy of glioma, distinguishing glioma stem cells or detecting the content of glioma stem cells in tumor tissue. The sample mentioned here refers to the glioma tumor tissue of the subject.

[0051] In the present invention, the type of the product is not particularly limited, and may be a common kit or chip in the art, but is not limited thereto, and is preferably a kit.

[0052] In the present invention, the PHF8 expression level may be the protein expression level of PHF8 or the mRNA expression level of PHF8.

[0053] It is understandable that the reagents for detecting the expression level of PHF8 vary according to the detection target and the detection technology used, and the reagents may be antibodies, primers or probes, etc. In some specific embodiments of the present invention, the reagents are antibodies, such as rabbit antibodies.

[0054] In addition, it is understandable that the in vitro detection product may also include reagents or test solutions required to adapt to the corresponding detection technology, such as buffer solutions, cleaning solutions, digestion solutions, etc., which can be selected as needed. Those skilled in the art have such ability, so there is no specific limitation here.

[0055] The third aspect of the present invention provides use of a PHF8 inhibitor in the preparation of a medicament or a pharmaceutical composition.

[0056] The fourth aspect of the present invention provides a medicine or a pharmaceutical composition, wherein the medicine or the pharmaceutical composition contains an effective amount of a PHF8 inhibitor.

[0057] The present invention experimentally verified that knocking out the PHF8 gene can not only significantly inhibit the proliferation, spheroidization, migration and invasion of GSCs, but also inhibit the stemness of GSCs, thereby inhibiting the malignant progression of GBM, providing a new approach for the treatment of glioblastoma. In addition, the high expression of PHF8 regulates the stemness phenotype of glioma stem cells. Therefore, PHF8 is a potential target for the treatment of glioblastoma.

[0058] Therefore, in the present invention, the drug or pharmaceutical composition has at least any one of the following effects:

[0059] a: Inhibit the stemness of glioma stem cells;

[0060] b: Inhibit the maintenance and / or proliferation of glioma stem cells;

[0061] c: inhibiting the sphere size, number, and / or frequency of spheres of glioma stem cells;

[0062] d: Inhibit the migration and / or invasion ability of glioma stem cells;

[0063] e: Inhibit the progression of glioblastoma.

[0064] In the present invention, the PHF8 inhibitor refers to a class of substances that can make PHF8 not expressed or significantly reduce its expression, for example, it can be a molecule that can bind to the PHF8 protein and inhibit its activity; for example, it can also be a molecule that binds to the PHF8 protein residue through a covalent bond, thereby inhibiting its biological function. In the present invention, specific examples of the PHF8 inhibitor include at least one of sgRNA, siRNA, dsRNA, miRNA, cDNA, antisense RNA / DNA, low molecular weight compounds, peptides and antibodies, but are not limited thereto. In some specific embodiments of the present invention, the PHF8 inhibitor is sgRNA; preferably, the sgRNA is sgPHF8-2: GAACGCCGTGGATCTTCAAAG (nucleotide sequence SEQ ID NO.9) or sgPHF8-3: GAGTACATGGTACCAGACAG (nucleotide sequence SEQ ID NO.10).

[0065] In the present invention, the effective amount refers to the amount that can achieve the expected effect after administration, and such expected effects include but are not limited to the treatment or cure of glioma blasts, the alleviation of the course of the disease, or the improvement of the spheroidization of glioma stem cells, the inhibition of stemness, proliferation, etc. Generally, the effective amount described in the art usually refers to the dose that produces a positive effect in 50% of individuals. It is understood that the effective amount can be determined by a person skilled in the art by methods or experiments known in the art, so there is no special limitation.

[0066] In addition, it is understandable that the drug or pharmaceutical composition also includes at least one pharmaceutically acceptable excipient and / or carrier. These excipients and / or carriers are routinely selected by those skilled in the art and are selected according to different drug dosage forms, etc. Those skilled in the art have such ability, so they are not specifically limited here.

[0067] The dosage form of the drug or pharmaceutical composition described in the present invention can be any common oral preparation in the art such as tablets, capsules, etc., and can also be an injection, preferably an injection.

[0068] A fifth aspect of the present invention provides a method for inhibiting glioma stem cells for non-therapeutic purposes, the method comprising the step of applying an effective amount of a PHF8 inhibitor to the glioma stem cells.

[0069] The sixth aspect of the present invention provides a method for distinguishing glioma stem cells. In the present invention, it is found that the expression pattern of PHF8 is different from that of neural progenitor cells and non-stem glioma cells. The expression level of PHF8 in glioma stem cells is relatively high. Therefore, detecting the protein level of PHF8 can distinguish glioma stem cells and help determine the content of glioma stem cells in tumor tissues, thereby providing important information for the diagnosis and treatment of gliomas.

[0070] In the present invention, the method comprises the following steps:

[0071] Detecting the expression level of PHF8 in the cells to be tested;

[0072] Comparing the PHF8 expression level in the detected cells with the PHF8 expression level in reference cells, wherein the reference cells are neural progenitor cells or non-stem glioma cells;

[0073] If the expression level of PHF8 in the test cell is higher than that in the reference cell, the test cell is determined to be a glioma stem cell.

[0074] In the present invention, the PHF8 expression level is the PHF8 protein expression level or mRNA expression level. The specific detection method and detection reagent are similar to those described above, so they will not be described in detail here.

[0075] The present invention is described below by means of specific examples. It should be noted that the following specific examples are only for illustrative purposes and do not limit the scope of the present invention in any way. In addition, unless otherwise specified, methods without specific conditions or steps are conventional methods, and the reagents and materials used can be obtained from commercial channels.

[0076] The main information of the materials used in the following examples is as follows:

[0077] BCA protein quantification kit was purchased from Solario; WB chemiluminescent substrates (Super Signal West chemiluminescent substrates) were purchased from Biosharp; Transwell chambers were purchased from JETBIOFIL; matrix gel was purchased from Corning; primary antibody Anti-L-Lactyl Lysine Rabbit mAb was purchased from PTM BIO; primary antibody Anti-PHF8 antibody was purchased from Abcam; primary antibody anti-actin and primary antibody anti-α-tubulin were purchased from Cell Signaling Technology; secondary antibody Anti-mouse and secondary antibody Anti-rabbit were purchased from Cell Signaling Technology; Accutase digestion solution was purchased from STEMCELL Biotechnology, Canada.

[0078] The Lysis lysis solution formula is as follows:

[0079] 20mM beat-GPA (Tianjin Ai (Shanghai) Chemical Industry Development Co., Ltd., G0097); 200mM PMSF (Sangon Biotech, A610425-0005); 50mM Tris (Sangon Biotech, A501492-0005)-HCL (Sinopharm Chemical Reagent Co., Ltd., I04328) pH7.4; 150mM NaCl (Biosharp, BS112-1kg); 2mM EDTA pH8.0 (Biosharp, BL518A); 1% NP-40 (Sangon Biotech, A600385-0100); 0.1% SDS (BioFROXX, 3250GR500); 500mM Na3VO4 (Sangon Biotech, A600869-0100); 500mM NaF (Sangon Biotech, A500850); 1M DTT (BioFROXX, 111GR005); 1:50Cocktails (RocheDiagnostics GmbH, 11873580001).

[0080] The statistical analysis involved in the present invention was performed using GraphPad Prism statistical software, the mean values ​​of two groups were compared using t-test, and the mean values ​​of multiple groups were compared using one-way analysis of variance, and P<0.05 was considered to be statistically significant.

[0081] Example 1 PHF8 gene is highly expressed in GBM and predicts poor prognosis

[0082] In this example, the expression of PHF8 in glioblastoma tissues was analyzed using the TCGA and CGGA (Chinese Glioma Genome Atlas) databases.

[0083] By using the GBM RNA-Seq datasets from the TCGA database (URL: https: / / portal.gdc.cancer.gov / ) and the CGGA database (URL: https: / / cgga.org.cn / download.jsp), we compared the PHF8 mRNA levels in GBM patient samples with those in normal brain tissue samples and found that PHF8 expression in GBM was significantly upregulated compared with that in normal brain tissue ( Figure 1 a and Figure 1 b).

[0084] Furthermore, in order to study the correlation between PHF8 mRNA expression level and patient survival rate, the GBM RNA-Seq datasets in TCGA and CGGA were also used to comprehensively analyze the prognosis of patients. Kaplan-Meier curve analysis showed that compared with patients with lower expression levels, patients with significantly increased PHF8 expression levels had a significantly worse overall survival (OS) ( Figure 1 c and Figure 1 d).

[0085] In addition, this example also analyzed the GBM RNA-Seq data set in the CGGA database and found that as the GBM grade increased, the PHF8 expression level also gradually increased, indicating that the malignancy of the patient's tumor was positively correlated with the expression of PHF8 ( Figure 1 e).

[0086] Example 2 The expression level of PHF8 is positively correlated with the grade of GBM

[0087] In this example, the clinical samples were all from the First Affiliated Hospital of the University of Science and Technology of China (4 cases of non-tumor epileptic brain tissue, 3 cases of WHO grade 2 glioma, and 4 cases of WHO grade 4 glioblastoma). The PHF8 expression levels of non-tumor epileptic brain tissue, WHO grade 2 glioma, and WHO grade 4 glioblastoma were detected by immunohistochemistry (IHC) staining. Three 20× fields of view were randomly selected from each slice for statistical analysis, and anti-PHF8 antibodies were used. According to the positive rate and staining intensity, the expression level of PHF8 was determined by immunohistochemistry (IHC) scoring (H-score). The following antibodies were used for immunohistochemistry (IHC) in this example: rabbit anti-PHF8 (Abcam, 36068).

[0088] The specific immunohistochemistry (IHC) staining steps are as follows:

[0089] 1) Bake the paraffin sections at 65°C for 2.5 hours to fix the tissue.

[0090] 2) The sections were dewaxed in xylene for 30 minutes and then immersed in a series of alcohol gradients (100%, 95%, 85%, 75%) for 5 minutes each.

[0091] 3) The sections were washed three times with PBS for 5 minutes each time and incubated in 3% hydrogen peroxide for 30 minutes to inactivate endogenous peroxidase.

[0092] 4) The sections were washed again with PBS and subjected to antigen retrieval using a diluted 1× EDTA retrieval solution (EDTA antigen retrieval solution (50X)) and heated in a pressure cooker for 2.5 minutes.

[0093] 5) After washing the slices, wipe them with PBS, mark the tumor area with an immunohistochemical pen, and block them with a membrane blocking solution (1% BSA + 0.3% Triton X-100 in PBS) for 1 hour.

[0094] 6) Wash the sections, dilute the primary antibody with 1% BSA (add rabbit anti-PHF8, dilution ratio 1:200), and incubate at 4°C overnight.

[0095] 7) Rewarm at room temperature for 30 minutes, wash and stain with ready-to-use HRP-labeled goat anti-rabbit secondary antibody (proteintech, PR30009) and incubate at room temperature for 30 minutes.

[0096] 8) Wash the sections, prepare DAB color developing solution for color development, and then use hematoxylin for contrast staining.

[0097] 9) Dehydration treatment is carried out by soaking in alcohol and xylene at different levels.

[0098] 10) Use neutral resin to seal the slide.

[0099] 11) After air drying, a full-scale digital slide scanner was used for panoramic scanning.

[0100] 12) Use KFBIO slide viewer software to view the scanning results and perform statistical analysis.

[0101] Results Figure 2 .

[0102] Immunohistochemical staining results ( Figure 2a) and quantitative analysis of immunohistochemical images using ImageJ software, collecting IHC score data of all samples, and performing statistical analysis to obtain the statistical graph ( Figure 2 b) showed that the PHF8 expression level of GBM was significantly higher than that of non-tumor epileptic brain tissue and WHO grade 2 glioma, indicating that the expression of PHF8 was positively correlated with the clinical progression of GBM.

[0103] Example 3 Transcriptome analysis revealed that the PHF8 gene is highly expressed in glioma stem cells

[0104] Glioma stem cells (GSCs) are a subpopulation of cells in GBM that are highly resistant to conventional treatments. They have unique self-renewal ability, multidirectional differentiation potential, drive tumorigenesis and strong proliferation ability, and are closely related to tumor evolution and recurrence. Therefore, in this example, statistical analysis was performed on GSCs-related datasets (GSE86237, GSE102244) downloaded from the GEO (Gene Expression Omnibus, https: / / www.ncbi.nlm.nih.gov / geo / ) database. The results are as follows: Figure 3 As shown in .

[0105] Among them, the data obtained from the GSE86237 dataset showed that the expression level of PHF8 mRNA in GSCs was significantly increased compared with that in bulk tumor cells (BTCs). Figure 3 a); Data obtained from the GSE102244 dataset showed that the expression level of PHF8 mRNA in GSCs was significantly increased compared with that in non-stem tumor cells (NSTCs) ( Figure 3 b).

[0106] In addition, in this example, by comparing the expression levels of seven stemness-related genes (SOX2, OLIG2, POU5F1, PAX6, SOX9, NR2E1, and PROM1) between the high-expression group and the low-expression group of PHF8, it was found that the expression of these classic stemness genes increased in the high-expression group of PHF8 ( Figure 3 c).

[0107] The above results indicate that the PHF8 gene is highly expressed in glioma stem cells.

[0108] Example 4 The expression level of PHF8 in glioma stem cells is higher than that in neural progenitor cells

[0109] In order to compare the difference in the expression levels of PHF8 in glioma stem cells (GSCs) and neural progenitor cells (NPCs), in this example, the mRNA expression level of PHF8 in GSC cell lines (GSC1, GSC2, GSC3 and GSC4) and neural progenitor cells (NPC-16159) was detected by real-time fluorescence quantitative PCR; the protein expression level of PHF8 in GSC cell lines (GSC1, GSC2, GSC3, GSC4, GSC5 and GSC6) and neural progenitor cells (NPC-16159) was detected by Western blot.

[0110] For the preparation method of the cell line, see: Zhou K, Yao YL, He ZC, et al. VDAC2 interacts with PFKP to regulate glucose metabolism and phenotypic reprogramming of glioma stem cells. Cell Death Dis. 2018; 9(10): 988. Published 2018 Sep 24. doi: 10.1038 / s41419-018-1015-x). GSC cell lines and neural progenitor cells were cultured in NBM medium, and neural progenitor cells needed to be cultured in a culture dish covered with matrigel (matrix gel and culture medium were mixed in a ratio of 1:4).

[0111] The specific steps of real-time fluorescence quantitative PCR are as follows:

[0112] 1. RNA extraction

[0113] Total RNA was extracted from cells using the EZ-10 column-based total RNA extraction kit (Shanghai Sangon Biotechnology Co., Ltd., B610583). The specific steps are as follows:

[0114] 1) Maintain a clean environment, use 75% alcohol for disinfection, use RNase-free pipette tips, and wear a mask to prevent RNA degradation.

[0115] 2) Operate on ice, add 350 μl RLT lysis buffer to the cell pellet, pipette evenly and proceed to the next step immediately or freeze and store at -80°C.

[0116] 3) Add 175 μl of anhydrous ethanol, mix and transfer to the adsorption column.

[0117] 4) Centrifuge at 4°C and 12,000 rpm for 1 minute and discard the waste liquid;

[0118] 5) Add 500 μL RW solution, centrifuge for 1 min, and discard the waste liquid;

[0119] 6) Add 500 μL RPE solution, centrifuge for 1 min, and discard the waste liquid;

[0120] 7) Repeat the operation in step 5);

[0121] 8) Centrifuge the empty column for 1 min and let it stand for 3 min;

[0122] 9) Place the adsorption column in a new centrifuge tube, add 20 μL of DEPC water, and place in a 56°C metal bath for 5 minutes to fully dissolve the RNA;

[0123] 10) Centrifuge the RNA solution for 3 minutes to remove any remaining impurities that may be present.

[0124] 11) Collect the supernatant, which is the pure RNA solution, and use a micro-nucleic acid protein concentration meter to measure the RNA concentration.

[0125] 2. Reverse transcription to cDNA

[0126] 1) Calculate the volume of RNA solution required for 1 μg RNA based on the RNA concentration;

[0127] 2) Add 1 μg RNA solution and 4 μL 5× PrimeScript to the PCR tube. TM RT Master Mix (Perfect Real Time) (Takara, RR036Q), and finally RNase-free ddH2O was used to make up 20 μL of the system;

[0128] 3) Use a low-speed small centrifuge to centrifuge the liquid on the tube wall and mix it;

[0129] 4) Place the PCR tube into a PCR instrument for reverse transcription. The reverse transcription program is: 37°C, 15 min → 85°C, 5 sec → 4°C, forever;

[0130] 5) Store the reverse transcribed cDNA solution in a -20°C refrigerator for future use.

[0131] 3. Real-time fluorescence quantitative PCR

[0132] 1) Dilute the primers. Centrifuge the centrifuge tube containing the primer powder at 12000rpm in a 4℃ centrifuge for 3 minutes. Add the corresponding volume of pre-cooled ddH2O according to the centrifuge tube label to dissolve the primer powder, so that the final concentration of the forward primer and reverse primer is 100μM, and store it in a -20℃ refrigerator. Dilute the 100μM primer to 10μM for use and store it in a -20℃ refrigerator. The primer information involved is as follows:

[0133]

[0134] 2) Dilute the cDNA according to the required cDNA.

[0135] 3) Add 10 μL 2×PCR Master Mix (SYBR Green), 8 μL cDNA solution and 2 μL primer solution to the PCR tube in sequence. Centrifuge the liquid on the tube wall using a low-speed mini centrifuge and mix well.

[0136] 4) Place the PCR tube in a real-time fluorescence quantitative PCR instrument and run the program. The program is: pre-denaturation, 94°C, 5 min, 1 round; denaturation, 94°C, 30 sec, 40 rounds; annealing, 65°C, 45 sec, 40 rounds; extension, 72°C, 30 sec, 40 rounds; re-extension, 72°C, 5 min, 1 round;

[0137] 5) After the program is completed, remove the PCR tube, copy the data, and use the 2-ΔΔCT formula for data analysis.

[0138] The specific steps of Western blot are as follows:

[0139] 1. Preparation: Pre-cool the centrifuge at 4℃; take out the Lysis solution from the -20℃ refrigerator and place it on ice to melt; clean the spectrophotometer measuring cup: first with alcohol and then with ddH2O, and dry it; dilute the 5-fold concentration of Coomassie Brilliant Blue: 400μl per sample.

[0140] 1) Centrifuge the culture medium containing glioma stem cells and neural progenitor cells at 1000 rpm for 3 min.

[0141] 2) Discard the supernatant and add an appropriate volume of protein lysis buffer according to the number of cell pellets, and lyse on ice for 5 minutes.

[0142] 3) Centrifuge at 4°C, 13,000 rpm for 15 min. Place the supernatant in a new EP tube.

[0143] 4) Quantify protein concentration using the BCA method.

[0144] 5) Using the low concentration as a reference, dilute the high concentration sample with Lysis lysis buffer; then add 4 times the concentration of loading buffer (Tris-Cl 200mM (pH6.8), SDS 8%, Glycerol 40%, Mercapitalethanol 4%, Bromophenol blue 0.40%), place in a 100℃ metal bath for 10 minutes, and store at -20℃.

[0145] 2. Preparation: prepare electrophoresis buffer (Tris base 250mM, Glycine 1.92mM, SDS 35mM); transfer buffer (Glycine 1.92M, Tris base 250mM, 20% volume of methanol), add HCl to adjust the pH to 7.6, which can be reused 3 to 4 times; TBST system (NaCl 2.74M, KCl 54mM, Tris base 380mM, 1 / 1000 volume of Tween 20); 5% skim milk powder (40mL TBST, 2g milk powder); antibody dilution (primary antibody 1:1000, secondary antibody 1:10000, use primary antibody diluent or 1% BSA).

[0146] 1) Prepare 8% SDS-PAGE gel (prepare according to the instructions) and aspirate the residual gel in the wells before loading the sample.

[0147] 2) Load 4 μL marker protein and 10 μg sample, calculate the corresponding volume based on the protein concentration, and use loading buffer to make up the maximum volume.

[0148] 3) Electrophoresis: 80 mV, 30 min; 120 mV, 80 min.

[0149] 4) Membrane transfer: Cut a PVDF membrane of 4 cm × 8 cm, place it in methanol for pre-activation, install the electroporation clamp in the order of black clamp-sponge-two layers of filter paper-glue-PVDF membrane-two layers of filter paper-sponge-white clamp, constant current 320 mA, and transfer for 2 h.

[0150] 5) Blocking: Block with 5% skim milk for 1 hour, and wash three times with TBST (conventional membrane washing solution), each time for 5 minutes.

[0151] 6) Membrane cutting: Cut the PVDF membrane according to the location of the target protein, α-tubulin 55kD, SOX2 34kD, OLIG232kD, GFAP 50kD, PHF8 135kD.

[0152] 7) Incubation with primary antibodies: Incubate with primary antibodies α-tubulin (internal reference protein), SOX2 and OLIG2 (stemness markers), GFAP (differentiation marker) and PHF8 at 4°C overnight, and wash three times with TBST, each time for 10 min.

[0153] 8) Incubate with secondary antibody (secondary antibody is an antibody that binds to the primary antibody and carries an enzyme that can react with the substrate in the luminescent solution) for 60 minutes, and wash three times with TBST, each time for 10 minutes.

[0154] 9) Add luminescent liquid and carry out development and exposure.

[0155] The results are as follows Figure 4 As shown in .

[0156] The results showed that the mRNA expression level of the PHF8 gene in multiple glioma stem cell lines was significantly higher than that in human neural progenitor cells ( Figure 4 a), and this trend was also consistently reflected at the protein expression level ( Figure 4 b).

[0157] Example 5 The expression level of PHF8 in glioma stem cells is higher than that in non-stem glioma cells

[0158] In order to compare the expression difference of PHF8 between glioma stem cells (GSC) and non-stem glioma cells (NSTC), in this example, two different glioma stem cell lines (GSC1 and GSC2) and paired non-stem glioma cell lines (cell line preparation method, see: Zhou K, Yao YL, He ZC, et al. VDAC2 interacts with PFKP toregulate glucose metabolism and phenotypic reprogramming of glioma stem cells. Cell Death Dis. 2018; 9(10): 988. Published 2018Sep 24. doi: 10.1038 / s41419-018-1015-x) were taken and cultured with NBM medium (Gibco, 12349-015) and 1640 medium (BI, C3010-0500), respectively. Western blot and real-time fluorescence quantitative PCR were used to detect the stemness markers of GSCs and the differentiation markers of NSTCs, as well as the expression levels of PHF8 in both, to evaluate the differences in the expression of stemness-related proteins between GSCs and NSTCs, and to compare the expression patterns of the specific protein PHF8 between GSCs and NSTCs.

[0159] The steps of protein immunoblotting and real-time fluorescence quantitative PCR refer to Example 4. The real-time fluorescence quantitative PCR primer information involved in this example is shown in the following table:

[0160]

[0161] The results are as follows Figure 5 As shown in .

[0162] The results showed that in the two cell lines (GSC1 and GSC2), the protein expression of the stemness markers SOX2 and OLIG2 of glioma stem cells was higher than that of non-stem glioma cells ( Figure 5 a), indicating that glioma stem cells have stem cell characteristics; the protein expression of GFAP, a differentiation marker, in non-stem glioma cells is higher than that in glioma stem cells, indicating that non-stem glioma cells have differentiation characteristics. The protein expression of PHF8 in glioma stem cells is significantly higher than that in non-stem glioma cells.

[0163] also, Figure 5 b and Figure 5 The results of mRNA expression in c were similar to the protein results. In the two cell lines (GSC1 and GSC2), the mRNA expressions of SOX2 and OLIG2, the stemness markers of glioma stem cells, were higher than those of non-stem glioma cells, further indicating that glioma stem cells have stem cell characteristics; the mRNA expression of GFAP, the differentiation marker of non-stem glioma cells, was higher than that of glioma stem cells, further indicating that non-stem glioma cells have differentiation characteristics.

[0164] The above results showed that the expression level of PHF8 in glioma stem cells was significantly higher than that in non-stem glioma cells.

[0165] Example 6 PHF8 is highly expressed in glioma stem cells at the same location as the stemness indicators SOX2 and OLIG2. In this example, a glioma stem cell sphere formation experiment was performed using the GSC1 cell line and immunofluorescence staining was performed to verify the correlation between the expression of PHF8 and the stemness of glioma stem cells.

[0166] Among them, the experimental steps of glioma stem cell sphere formation are as follows:

[0167] 1) First, GSC1 cells that had been cultured in two 10 cm diameter culture dishes with NBM medium (Gibco, 12349-015) and formed spherical structures of moderate size were transferred to a 15 ml centrifuge tube and then left to stand for 30 minutes so that they could naturally settle to the bottom of the tube.

[0168] 2) Carefully discard the upper culture medium, and then add 2 ml of 4% paraformaldehyde solution to fix the cell spheres for 15 minutes.

[0169] 3) After fixation, carefully pour off the fixative solution again, and then wash the cell spheres three times with 5 ml of phosphate-buffered saline (PBS), each wash for 5 minutes.

[0170] 4) After washing, pour off the PBS, add 5 ml of 30% sucrose solution for dehydration, and let the cell sphere stand overnight.

[0171] 5) After dehydration, pour off the sucrose solution and transfer the cell spheroids into an embedding cassette containing OCT embedding medium. OCT is a medium used for cryosectioning that helps maintain the integrity of cell structure.

[0172] 6) In order to solidify the OCT embedding medium, it needs to be placed in pre-cooled alcohol for about 10 minutes until the embedding medium is completely solidified.

[0173] 7) After solidification, the cell pellet was cut into thin slices on ice and stored in a -80°C freezer.

[0174] The steps of immunofluorescence staining are as follows:

[0175] 1) Place the frozen sections in PBS to wash away the OCT embedding medium.

[0176] 2) The sections were fixed with 4% paraformaldehyde for 30 minutes. After fixation, the sections were washed with PBS for 3 times, 5 minutes each time.

[0177] 3) Treat the sections with a membrane blocking solution containing 0.3% Triton X-100, PBS solution and 1% bovine serum albumin (BSA) for 60 minutes to enhance the permeability of the antibody. After blocking, wash with PBS for 3 times, 5 minutes each time.

[0178] 4) PHF8 antibody (Abcam, 36068), SOX2 antibody (Millipore, 3579S) and OLIG2 antibody (Abcam, ab109186) were mixed with 1% BSA solution, and then the sections were incubated overnight at 4° C. After incubation, the sections were washed three times with PBS, each for 5 minutes.

[0179] 5) Incubate with fluorescently labeled secondary antibodies (Donkey anti-rabbit Alexa Fluor 488, A-21206 from Invitrogen, USA, Donkey anti-rabbit Alexa Fluor 568, A-10042 from Invitrogen, USA) at room temperature for 1 hour, keeping away from light. After incubation, wash with PBS three times, 5 minutes each time.

[0180] 6) Stain the sections with Hoechst dye for 20 minutes. This dye can bind to DNA and make it fluoresce. After staining, wash with PBS three times, 5 minutes each time.

[0181] 7) Finally, use mounting medium to seal the slices to prevent the weakening of the fluorescent signal.

[0182] 8) Observe the sections using a fluorescence microscope to detect the expression of specific proteins and the location of cell nuclei.

[0183] The results are as follows Figure 6 As shown in .

[0184] It can be seen that the protein level of PHF8 in the glioma stem cell sphere GSC1 is highly expressed at the same position as the stemness markers SOX2 and OLIG2, indicating that the expression of PHF8 is related to the stemness of glioma stem cells.

[0185] Example 7 Detection of the knockout efficiency of the PHF8 gene at the protein level using Western blotting

[0186] In order to stably knock out PHF8, in this example, sgRNA was cloned into the vector plasmid lentiCRISPR v2.0 (Plasmid#52961, Addgene). The lentiviral plasmids for knocking out PHF8 and the control sgRNA (sgNTC) were commissioned to be synthesized by Genewise Biotechnology Co., Ltd. Among them, the sgRNA sequence is shown in the following table:

[0187]

[0188] 1. Lentivirus packaging

[0189] In the experiment, the lentiviral packaging plasmids psPAX2 and pCI-VSVG provided by Addgene were used for virus packaging. The following is a simplified description of the steps:

[0190] 1) Prepare 400 μL of 2×HBS (see the recipe in the table below) and 400 μL of diluted CaCl2 solution (40 μL 2.5M CaCl2 dissolved in 360 μL ddH2O):

[0191]

[0192] 2) Add plasmids to the diluted CaCl2 solution: 6000ng psPAX2 + 6000ng pCI-VSVG + 3000ng target plasmid.

[0193] 3) The solution of step 2) was mixed with the 2×HBS solution of step 1) and allowed to stand for 10 minutes.

[0194] 4) The solution of step 3) was added dropwise to the passaged 293T cells (purchased from the American Type Culture Collection (ATCC)) and cultured using DMEM medium (BI, Israel, C3113-0500).

[0195] 5) After 8 hours, the culture medium was replaced with fresh one. After 48 hours, the culture medium was collected and filtered through a 0.45 μm filter membrane to obtain the packaged virus.

[0196] 2. Construction of glioma stem cell lines with stable knockdown and knockout of PHF8

[0197] 1) When passage glioma stem cells (GSC1 and GSC2), seed 1 million cells per dish. Add the packaged lentiviral solution and NBM medium to the cells at a 1:1 mixing ratio for infection.

[0198] 2) 12-16 hours after infection, replace the culture medium with fresh NBM.

[0199] 3) After the glioma stem cells form a spherical structure, they are dissociated and passaged.

[0200] 4) Puromycin (Saiguo Biotech, 1299MG025) was added to the culture medium for screening. The final concentration of puromycin was 1 / 1000 of the total culture medium.

[0201] 5) To improve the efficiency of gene knockout, puromycin selection can be performed twice.

[0202] 6) The cells were then expanded and immunoblotting was performed to verify the knockout effect.

[0203] The results are as follows Figure 7 As shown in .

[0204] It can be seen that after knocking out the PHF8 gene, the PHF8 band became significantly lighter, indicating that the knockout PHF8 cell line was successfully constructed.

[0205] Example 8 Knocking out the PHF8 gene can significantly inhibit the proliferation of glioma stem cells

[0206] The CCK-8 kit is a convenient tool for evaluating cell growth and cytotoxicity. Its core ingredient is WST-8, a chemical whose full name is 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfonate)-2H-tetrazolyl monosodium salt. In the cell, WST-8 is catalyzed by intracellular dehydrogenases with the assistance of an electron transfer molecule 1-methoxy-5-methylphenazinium dimethyl sulfate (1-Methoxy PMS) to a water-soluble yellow formazan dye. The amount of this dye produced is proportional to the number of cells, thus reflecting the activity level of the cells.

[0207] The specific experimental steps in this embodiment are as follows:

[0208] 1) The sgNTC cells in the control group and the sgPHF8-2 and sgPHF8-3 cells in the experimental group were digested with Accutase (STEMCELL Biotechnology, Canada, 07922), and the digestion was terminated with NBM and the cells were collected. The collected cells were centrifuged at 1000 rpm for 3 min.

[0209] 2) Discard the supernatant, resuspend the cell pellet with culture medium, take a portion and count it with a counting plate, and adjust the cell density to about 3×10 4 / ml, take 100 μL / well and add it into 96-well plate. The cells in the experimental group and the control group need to be inoculated into the wells of 5 time periods (0h, 24h, 48h, 72h), and 6 replicate wells are set for each time period.

[0210] 3) After plating, add 10 μl / well of CCK8 reagent to the two groups every 0h, 24h, 48h, and 72h (be careful not to generate bubbles in the wells during the operation, which will affect the OD value). After incubation for 2h, place the wells in a 450nm wavelength microplate reader for detection, and record the absorbance (OD) value of each well. The OD value measured at 0h is used as the basic OD value.

[0211] The results are as follows Figure 8 As shown in .

[0212] The results showed that knocking out the PHF8 gene could significantly inhibit the proliferation of glioma stem cells, with statistically significant differences ( Figure 8 a and Figure 8 b).

[0213] Example 9 Knockout of PHF8 gene inhibits glioma stem cell 3D soft agar colony formation

[0214] In this example, a 3D soft agar colony formation experiment was performed, and the specific steps are as follows:

[0215] 1) Preparation of agar solution: Prepare 1.2% and 0.7% agar solutions, sterilize by autoclaving, and keep at 42°C to prevent solidification.

[0216] 2) Laying the bottom gel: Mix 1.2% agar with 2 times the concentration of NBM medium (Gibco, 12349-015), pour into a 6-well plate, about 1.5 ml per well, and incubate at 37°C for 30 minutes to solidify.

[0217] 3) Preparation of cell suspension: Glioma stem cells were prepared into a single cell suspension and mixed with 0.7% agar to ensure that the cells were evenly distributed.

[0218] 4) Spread a layer of gel: Add the cell-agar mixture into a 6-well plate, about 1.5 ml per well. After it solidifies, add an appropriate amount of culture medium.

[0219] 5) Culture: The 6-well plate was placed in an incubator at 37°C and 5% CO2 for 2 to 3 weeks, and the culture medium was replaced every 3 days.

[0220] 6) Fixation: When visible cell clumps appear in the wells, the culture can be terminated. Aspirate the supernatant, wash twice with PBS and remove the culture medium. Add 4% paraformaldehyde and fix at room temperature for 15 minutes.

[0221] 7) Staining: Aspirate the fixative and add a small amount of crystal violet staining solution. Incubate at room temperature for 15 minutes, then rinse the staining solution with a slow stream.

[0222] 8) Count the number of colonies and take photos.

[0223] See the results Fig. 9 .

[0224] It can be concluded that after knocking out the PHF8 gene, the number of tumor spheres formed by glioma stem cell 3D cloning was significantly reduced, and there was a statistical difference.

[0225] Example 10 Knockout of the PHF8 gene inhibits the size and number of spheres of glioma stem cells

[0226] The number and size of spheres are important indicators for measuring the stemness of cancer stem cells. The ability of cancer stem cells to form spheres reflects their potential for self-renewal and differentiation, which is a key manifestation of stem cell characteristics. The number of spheres refers to the total number of spheres that cancer stem cells can form under certain conditions, while the size of spheres refers to the volume or diameter of these spheres. These two parameters are usually used to evaluate the stemness of cancer stem cells, that is, the extent to which they maintain an undifferentiated state and regenerative capacity.

[0227] In this example, cells in the GSC1 and GSC2 control groups and the PHF8 knockout experimental group cultured in NBM medium were imaged using a microscope, and statistics and difference analysis were performed on the size and number of spheres.

[0228] Here are the steps:

[0229] 1) Treat GSCs with Accutase enzyme, count the single cells after digestion, and inoculate the cell suspension into a six-well culture plate, with 1000 cells in each well.

[0230] 2) Place the six-well plate under standard cell culture conditions, such as in a constant temperature incubator at 37° C. and 5% CO 2 .

[0231] 3) Observe the cells in the culture plate under a microscope and judge whether the cells have successfully formed tumor spheres based on the diameter of the tumor spheres. Generally, cell clusters with a diameter greater than a certain threshold (such as 50 μm) can be considered successful tumor spheres.

[0232] 4) Randomly select at least three fields of view under the microscope and count the number of spheres in each field of view. Perform statistical analysis on the collected data and calculate the sphere formation rate.

[0233] The results are as follows Fig.10 As shown in .

[0234] like Fig.10 a is a representative microscope image selected, and the number of spheres ( Fig.10 b) and size ( Fig.10 c) Statistics, where the counts of the control group were normalized to 1, show that knocking out PHF8 significantly inhibited the size and number of GSC spheres.

[0235] Example 11 Knockout of the PHF8 gene inhibits the sphere formation frequency of glioma stem cells

[0236] In the in vitro limiting dilution experiment, GSCs from different groups were collected, digested, and added to each well of a low-adsorption 96-well plate according to a specified gradient (1, 10, 20, 40, 60, and 80 cells / well). Each gradient was repeated 10 times. Seven days after cell plating, tumor spheroids with a diameter greater than 50 μm were recorded and counted. The results are shown in Fig.11 a and Fig.11 b. In addition, the frequency of tumor stem cells forming spheres in each treatment group is shown in Fig.11 c and Fig.11 d.

[0237] pass Fig.11The statistics of tumor spheroids with a diameter greater than 50 μm and the frequency of spheroid formation show that with the knockout of PHF8, the spheroid formation frequency of GSCs is significantly reduced, which supports the role of PHF8 in promoting the self-renewal ability of GSCs.

[0238] Example 12 Knockout of the PHF8 gene inhibits the migration and invasion ability of glioma stem cells

[0239] 1. Invasion assay:

[0240] 1) First, mix Matrigel and NBM (neural matrix membrane) culture medium at a ratio of 1:39. Spread 70 μL of the diluted Matrigel solution on the bottom of an 8 μm Transwell chamber and place it in a 37°C incubator for 30 minutes to allow Matrigel to completely solidify.

[0241] 2) After solidification is complete, add 680 μL of complete culture medium to the corresponding well of each Transwell chamber, and place the chamber above the culture well.

[0242] 3) Next, the cells in the experimental and control groups were digested into single cells using Accutase enzyme, centrifuged at 1000 rpm for 5 min, and the supernatant was discarded. The cells were resuspended in serum-free medium, and 2 × 10 4 Cells were inoculated into the upper chamber of the Transwell gel-coated well and cultured in a cell box for 48 h.

[0243] 4) After 48 hours, remove the upper chamber and discard the culture medium in the upper chamber, and rinse twice with PBS.

[0244] 5) Place the upper chamber into 4% paraformaldehyde for fixation for 30 minutes.

[0245] 6) After fixation, remove the paraformaldehyde in the upper chamber and stain with 0.5% crystal violet for 30 minutes.

[0246] 7) After staining, rinse gently with tap water to remove excess staining solution, and use a cotton swab to gently wipe off the cells in the upper chamber that have not migrated through the membrane. After drying, observe and count the cells that have passed through the membrane under a microscope, and then take photos and record.

[0247] 2. Migration experiment:

[0248] The steps of migration experiment are basically similar to those of invasion experiment, with the only difference being that there is no gel-laying step in the migration experiment.

[0249] Results Fig.12 .

[0250] pass Fig.12The results in the figure show that compared with the control group sgNTC, the number of glioma stem cell migration and invasion was significantly reduced after PHF8 gene knockout, and the difference was statistically significant.

[0251] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0252] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. Use of a reagent for detecting the expression level of PHF8 in the preparation of at least one of the following products: a: Evaluate the malignancy of glioma; b: Differentiation between glioma stem cells and neural progenitor cells; c: Differentiation between glioma stem cells and non-stem glioma cells; d: Evaluation of the content of glioma stem cells in tumor tissues.

2. An in vitro detection product, which is used to determine the malignancy of glioblastoma, or to distinguish glioma stem cells from neural progenitor cells, or to distinguish glioma stem cells from non-stem glioma cells, or to evaluate the content of glioma stem cells in tumor tissue, characterized in that: The in vitro detection product contains a reagent for detecting the expression level of PHF8.

3. The in vitro detection product according to claim 2, characterized in that: The in vitro detection product is a kit or a chip.

4. The in vitro detection product according to claim 2, characterized in that: The PHF8 expression level is the protein expression level or mRNA expression level of PHF8.

5. The in vitro detection product according to claim 2, characterized in that: The reagent for detecting the expression level of PHF8 is an antibody.

6. Use of a PHF8 inhibitor in the preparation of a drug or a pharmaceutical composition, wherein the drug or the pharmaceutical composition has at least one of the following effects: a: Inhibit the stemness of glioma stem cells; b: Inhibit the maintenance and / or proliferation of glioma stem cells; c: inhibiting the sphere size, number, and / or frequency of spheres of glioma stem cells; d: Inhibit the migration and / or invasion ability of glioma stem cells; e: Inhibit the progression of glioblastoma.

7. A drug or a pharmaceutical composition, characterized in that The drug or pharmaceutical composition contains an effective amount of a PHF8 inhibitor; Preferably, the drug or pharmaceutical composition has at least one of the following effects: a: Inhibit the stemness of glioma stem cells; b: Inhibit the maintenance and / or proliferation of glioma stem cells; c: inhibiting the sphere size, number, and / or frequency of spheres of glioma stem cells; d: Inhibit the migration and / or invasion ability of glioma stem cells; e: Inhibit the progression of glioblastoma.

8. The drug or pharmaceutical composition according to claim 7, characterized in that The PHF8 inhibitor comprises at least one of sgRNA, siRNA, dsRNA, miRNA, cDNA, antisense RNA / DNA, low molecular weight compounds, peptides and antibodies; Preferably, the PHF8 inhibitor is sgRNA; Preferably, the nucleotide sequence of the sgRNA is shown in SEQ ID NO.9 or 10.

9. A method for inhibiting glioma stem cells for non-therapeutic purposes, characterized in that: The method includes the step of applying an effective amount of a PHF8 inhibitor to glioma stem cells.

10. A method for distinguishing glioma stem cells, characterized in that: The method comprises the following steps: Detecting the expression level of PHF8 in the cells to be tested; Comparing the PHF8 expression level in the detected cells with the PHF8 expression level in reference cells, wherein the reference cells are neural progenitor cells or non-stem glioma cells; If the expression level of PHF8 in the test cell is higher than that in the reference cell, the test cell is determined to be a glioma stem cell; Preferably, the PHF8 expression level is the PHF8 protein expression level or mRNA expression level.

Images