Rapid detection method for common pathogenic bacteria and drug resistance thereof

Abstract

The invention discloses a rapid detection method for common pathogenic bacteria and drug resistance thereof, and relates to the technical field of biological detection. The specific process comprises the following steps: respectively culturing bacteria to be detected in an antibiotic-containing liquid culture medium and an antibiotic-free liquid culture medium for 4-6 hours, and detecting characteristic genes of pathogenic bacteria before and after culture by adopting conventional qPCR (quantitative polymerase chain reaction) so as to identify the strain and the drug resistance of the bacteria to be detected. According to the invention, a phenotype detection method and a molecular detection method are combined, so that the types and drug resistance of pathogenic bacteria in a sample can be rapidly detected, the problems that phenotype detection time is long and molecular detection results cannot accurately correspond to phenotypes are solved, and a simple, rapid, high-specificity and high-sensitivity detection method is established; and a new choice is brought to clinical diagnosis.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and specifically relates to a method for rapid detection of common pathogenic bacteria and their drug resistance. Background Art

[0002] In recent years, with the overuse of antibiotics worldwide, more and more pathogens have developed resistance to currently used antibiotics, and the detection rate of resistant bacteria in clinical isolates has increased. The main mechanism for bacteria to acquire resistance is to produce enzymes that can decompose antibiotics. In addition, some bacteria can also acquire resistance through other non-specific mechanisms such as the deletion or mutation of genes encoding porins (such as OprD), overexpression of efflux pump genes, or decreased binding of penicillin-binding proteins (PBPs), and formation of biofilms. Infections caused by resistant bacteria are more difficult to treat and have a higher mortality rate, posing a serious threat to public health safety and clinical treatment.

[0003] The spread of drug-resistant bacteria seriously threatens human life, health and safety, and it is urgent to establish a fast and accurate detection method to effectively detect it. At present, the detection methods of drug-resistant bacteria are mainly divided into two categories: phenotypic detection and molecular detection. The phenotypic detection method is simple to operate, low cost, and does not require superb technical level and large equipment, but the detection takes a long time. Molecular detection has extremely high specificity and sensitivity and can complete the detection in a short time, but it can only detect specific genes, and cannot detect other genes and newly emerging genes, and the molecular detection results may not be consistent with the phenotypic detection results. In summary, phenotypic detection and molecular detection have more or less shortcomings in clinical diagnosis.

[0004] Real-time fluorescence quantitative PCR technology (Quantitative Real-time PCR) is a method that uses fluorescent chemicals to detect the total amount of products after each polymerase chain reaction (PCR) cycle in a DNA amplification reaction. Based on its advantages such as high sensitivity, repeatability and accuracy, qPCR technology has been widely used in the field of genetic testing and is known as the "gold standard" for nucleic acid molecule detection.

[0005] The present invention establishes a detection method combining a phenotypic detection method and a molecular detection method, which uses antibiotics to detect the drug resistance of pathogenic bacteria, and can detect all drug resistance mechanisms of drug-resistant bacteria. At the same time, combined with qPCR technology, the specific species of pathogenic bacteria can be determined. Combining phenotypic detection with molecular detection not only makes up for the shortcoming that most phenotypic detection methods can only detect the drug resistance mechanism of producing antibiotic degrading enzymes, but also can quickly determine the specific species of pathogenic bacteria to be tested, bringing new options for the clinical diagnosis of drug-resistant pathogens. However, there are currently no relevant reports in this regard. Summary of the invention

[0006] The technical problem solved by the present invention is to provide a rapid detection method for common pathogenic bacteria and their drug resistance. This method aims at the deficiencies of existing phenotypic detection methods and molecular detection methods for drug-resistant bacteria, and establishes a detection method that combines phenotypic detection methods and molecular detection methods, which can quickly determine whether the pathogenic bacteria to be tested are resistant to the antibiotics used and their specific strains. It not only makes up for the shortcomings of phenotypic detection taking too long and can only detect the resistance mechanism of producing antibiotic degrading enzymes, but also combines the "gold standard" of molecular detection-PCR technology to detect the specific strains of the bacteria to be tested. Therefore, the present invention successfully establishes a method for detecting pathogenic bacteria that is simple to operate, low in price, and has high detection specificity and sensitivity.

[0007] The present invention adopts the following technical solution to solve the above technical problems: a rapid detection method for common pathogenic bacteria and their drug resistance, which combines the phenotypic detection method with the molecular detection method, and its specific steps are:

[0008] Step S1: Perform phenotypic detection by placing the bacteria to be tested in a culture medium with antibiotics and a culture medium without antibiotics for culture;

[0009] Step S2: extracting the genomic DNA of the bacteria to be tested from the culture solution respectively;

[0010] Step S3: Perform molecular detection by performing qPCR detection on the genomic DNA of the bacteria to be tested;

[0011] Step S4: Analyze the detection data and use the following determination method to determine the specific strain of the bacteria to be detected and whether it is resistant to the antibiotics added to the culture medium: if only the CT value detected for the bacteria to be detected in the culture medium without antibiotics is <35, and the CT value detected for the bacteria to be detected in the culture medium with antibiotics is ≥35 or no CT value can be detected, it means that a specific pathogenic bacteria is detected and the specific pathogenic bacteria has no resistance to the corresponding antibiotics in the culture medium; if the CT values ​​detected for the bacteria to be detected in the culture medium with antibiotics and the culture medium without antibiotics are both <35, it means that a specific pathogenic bacteria is detected and the specific pathogenic bacteria is resistant to the corresponding antibiotics in the culture medium; if the CT values ​​detected for the bacteria to be detected in the culture medium with antibiotics and the culture medium without antibiotics are both ≥35 or no CT value can be detected, it means that no specific pathogenic bacteria is detected.

[0012] Preferably, the specific process of the phenotypic detection in step S1 is: the bacteria to be tested are placed in a liquid culture medium with antibiotics and a liquid culture medium without antibiotics, respectively, and after culturing at 37°C and 180rpm for 2-3h, a small amount of bacterial liquid is transferred to a new culture medium of the same culture medium and then cultured at 37°C and 180rpm for 2-3h. The purpose of transferring the bacteria to be tested to a new culture medium after culturing for 2-3h is to perform a secondary screening of whether the bacteria to be tested are resistant to drugs, so as to avoid the generation of false positives; antibiotics can be used to screen whether the bacteria to be tested are resistant to drugs, and the resistant bacteria to be tested can grow in both the antibiotic liquid culture medium and the antibiotic-free liquid culture medium, while the non-resistant bacteria to be tested can only grow in the antibiotic-free liquid culture medium.

[0013] Preferably, the concentration of the antibiotic in the antibiotic liquid culture medium in step S1 is the minimum inhibitory concentration thereof.

[0014] Preferably, the method for extracting the genomic DNA of the bacteria to be tested in step S2 adopts the boiling method, and the specific process is: take 1 mL of the cultured bacterial solution and centrifuge it at 9000 rpm for 1 min, then pour out the supernatant, add 100 μL TE buffer and boil it at 100°C for 10 min, then quickly put it in a -20°C refrigerator and freeze it for 10 min, centrifuge it at 12000 rpm for 5 min, and the supernatant is the desired genomic DNA of the bacteria to be tested.

[0015] Preferably, the bacteria to be detected in step S1 are one or more of Klebsiella pneumoniae (KP), Pseudomonas aeruginosa (PA), Acinetobacter baumannii (AB), Enterobacter cloacae (ECL) or Escherichia coli (EC); the primers used for qPCR detection are as follows: SEQ ID NO: 1-2 are primer pair sequences for detecting Klebsiella pneumoniae; SEQ ID NO: 3-4 are primer pair sequences for detecting Pseudomonas aeruginosa; SEQ ID NO: 5-6 are primer pair sequences for detecting Acinetobacter baumannii; SEQ ID NO: 7-8 are primer pair sequences for detecting Enterobacter cloacae; SEQ ID NO: 9-10 are primer pair sequences for detecting Escherichia coli.

[0016] Preferably, the qPCR detection system in step S3 is composed of: 0.4 μL of 10 μM forward primer, 0.4 μL of 10 μM reverse primer, 7.2 μL of ddH2O, 10 μL of 2×UltraSYBR Mixture (Kangwei Century) and 2 μL of bacterial genomic DNA to be tested; the qPCR reaction program is: 95°C, 600s, 1 cycle; 95°C, 10s, 60°C, 30s, 72°C, 32s to collect fluorescence signals, and cycle 40 times.

[0017] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0018] 1. The present invention establishes a detection method combining a phenotypic detection method and a molecular detection method, using antibiotics to screen whether pathogenic bacteria are resistant, and can detect all drug resistance mechanisms of drug-resistant bacteria, making up for the shortcoming that most phenotypic detection methods can only detect the drug resistance mechanism of producing antibiotic degrading enzymes. The use of qPCR technology in molecular detection can determine the specific strains of pathogenic bacteria. Combining the phenotypic detection method with the molecular detection method, a new detection method with short detection cycle, strong specificity, high sensitivity and simple operation is established.

[0019] 2. In phenotypic testing, the test bacteria are transferred to a new culture medium 2-3 hours after shaking the bacteria. The purpose is to use antibiotics to perform a secondary screening to determine whether the test bacteria are resistant to antibiotics and avoid the occurrence of false positives for drug resistance.

[0020] 3. The boiling method is used to extract the genomic DNA of the bacteria to be tested, which simplifies the operation steps and greatly saves the time and cost of detection.

[0021] 4. In molecular detection, by optimizing primers, primer concentrations, reaction procedures, reaction systems, etc., a qPCR detection method with strong specificity, high sensitivity and good repeatability is established. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 It is a detection flow chart of the present invention.

[0023] Figure 2 The qPCR amplification results of genomic DNA of KP and CRKP after culturing in medium with and without IPM for 0 h and 6 h, respectively.

[0024] Figure 3 qPCR amplification results of genomic DNA of KP, PA, AB, ECL, and EC after culturing in medium with and without IPM for 6 h.

[0025] Figure 4 qPCR amplification results of genomic DNA of CRKP, CRPA, CRAB, ECL, and EC after 6 h of culture in medium with and without IPM.

[0026] Figure 5 It is the result of specific amplification detection.

[0027] Figure 6 This is the sensitivity test result. DETAILED DESCRIPTION

[0028] The above contents of the present invention are further described in detail below through examples, but this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples, and all technologies implemented based on the above contents of the present invention belong to the scope of the present invention.

[0029] Example 1

[0030] Specific primer screening for pathogenic bacteria:

[0031] The characteristic gene sequences of KP, PA, AB, ECL and EC were compared and analyzed to obtain their respective specific gene sequences, and detection primers were designed for the specific gene sequences. Three pairs of primers were designed for each pathogen, and the primer with the highest amplification efficiency was selected from the three pairs of primers for subsequent qPCR detection.

[0032] The specific nucleic acid sequences of the designed primers are shown in the following table:

[0033] Table 1 Detection primer sequences of various pathogens

[0034]

[0035]

[0036] The designed primers are used to detect the corresponding pathogenic bacteria genomic DNA and the amplification efficiency of each pair of primers is calculated, and the primers with the highest amplification efficiency are selected for subsequent amplification.

[0037] Table 2 Amplification efficiency of each primer pair

[0038] Pathogens <![CDATA[F1R1 amplification efficiency %]]> <![CDATA[F2R2 amplification efficiency %]]> <![CDATA[F3R3 amplification efficiency %]]> KP 93 89.88 89.04 PA 96.12 97.09 94.32 AB - 96.69 96.06 ECL - 98.16 105.88 EC 99.16 109.42 -

[0039] Table 3 Select the primers with the highest amplification efficiency for subsequent testing

[0040]

[0041] Example 2

[0042] Establishment of pathogenic bacteria detection method:

[0043] 1. Phenotypic Detection and Culture Methods

[0044] Imipenem (IPM) is a common carbapenem antibiotic. IPM is used to analyze whether the test bacteria are resistant to carbapenem antibiotics. 100 μL of the test bacterial solution was placed in a beef extract peptone liquid culture medium without IPM and a beef extract peptone liquid culture medium containing IPM, respectively. After culturing for 3 hours at 37°C and 180rpm, 100 μL of the culture solution was transferred to a new culture medium of the same type and then cultured for 3 hours. The culture medium containing and not containing IPM can be used to conduct a preliminary phenotypic test on whether the test bacteria are resistant to carbapenem antibiotics. Pathogenic bacteria resistant to carbapenem antibiotics can grow in a culture medium containing IPM. After three hours of culture, the culture medium is transferred to a new culture medium to conduct a secondary screening on whether the test bacteria are resistant to carbapenem antibiotics to prevent the generation of false positives.

[0045] 2. Bacterial genomic DNA extraction method

[0046] Centrifuge 1 mL of culture solution at 9000 rpm for 1 min, discard the supernatant, add 100 μL TE buffer, boil at 100°C for 10 min, and quickly freeze in a -20°C refrigerator. After 10 min, centrifuge at 12000 rpm for 5 min. The supernatant is the bacterial genomic DNA. Aspirate the supernatant and store it in a 4°C refrigerator.

[0047] 3.qPCR detection method

[0048] The extracted bacterial genomic DNA was subjected to qPCR detection, and the amplification system and procedure are shown in the following table.

[0049] Table 4 qPCR amplification system composition

[0050] Reagents Dosage (20μL) 2×UltraSYBR Mixture (Kangwei Century) 10 Forward Primer (10 μM) 0.4 Reverse Primer (10 μM) 0.4 DNA template 2 ddH2O 7.2

[0051] Table 5 qPCR amplification program

[0052]

[0053] qPCR detection can be used to determine the strain of bacteria to be tested and whether it is resistant to drugs.

[0054] Example 3

[0055] For the detection of a single bacterial species (KP):

[0056] 1. Phenotypic Detection

[0057] 100 μL of KP and carbapenem-resistant Klebsiella pneumoniae (CRKP) were placed in beef extract peptone liquid culture medium without IPM and beef extract peptone liquid culture medium with IPM respectively, and cultured at 37°C and 180 rpm for 3 hours. After that, 100 μL of the culture solution was transferred to the same new culture medium as before and then cultured at 37°C and 180 rpm for 3 hours.

[0058] 2. Bacterial Genomic DNA Extraction

[0059] During the 0-6 hours of culture, 1 mL of the culture solution was aspirated every hour and stored in a 4°C refrigerator. After 6 hours of culture, 1 mL of the culture solution was centrifuged at 9000 rpm for 1 min, the supernatant was discarded, 100 μL of TE buffer was added, and the solution was boiled at 100°C for 10 minutes and quickly frozen in a -20°C refrigerator. After 10 minutes, the solution was centrifuged at 12000 rpm for 5 minutes. The supernatant was the bacterial genomic DNA. The supernatant was aspirated and stored in a 4°C refrigerator.

[0060] 3.qPCR detection

[0061] The extracted bacterial genomic DNA was subjected to qPCR detection using primers of SEQ ID NO: 1-2. The detection results were as follows: Figure 2 As shown. After 6 hours of culture, KP only had an amplification curve in the genomic DNA in the medium without IPM, and the Ct value was <35; while CRKP had an amplification curve in the genomic DNA in both the medium with IPM and the medium without IPM, and the Ct value was <35. This shows that the detection method established by the present invention can identify KP and successfully distinguish whether it is resistant to carbapenem antibiotics.

[0062] Example 4

[0063] For the detection of multiple bacterial species (KP, PA, AB, ECL and EC):

[0064] 1. Phenotypic Detection

[0065] A mixed bacterial solution consisting of 100 μL each of KP, PA, AB, ECL and EC and a mixed bacterial solution consisting of 100 μL each of CRKP, carbapenem-resistant Pseudomonas aeruginosa (CRPA), carbapenem-resistant Acinetobacter baumannii (CRAB), ECL and EC were placed in beef extract peptone liquid culture medium containing IPM and beef extract peptone liquid culture medium without IPM, respectively, and cultured at 37°C and 180 rpm for 3 h. After that, 100 μL of the bacterial solution was aspirated and transferred to the same new culture medium as before and cultured for another 3 h.

[0066] 2. Bacterial Genomic DNA Extraction

[0067] The operation method is the same as above.

[0068] 3.qPCR detection

[0069] The extracted bacterial genomic DNA was subjected to qPCR detection using primers of SEQ ID NO: 1-10. The detection results were as follows: Figure 3-4 As shown. After 6 hours of culture, KP, PA, AB, ECL and EC only had amplification curves in genomic DNA extracted from culture medium without IPM, and the Ct value was <35; while CRKP, CRPA and CRAB had amplification curves in genomic DNA extracted from culture medium containing IPM and culture medium without IPM, and the Ct value was <35. The gray dotted line in the figure is the amplification curve of the negative control (NTC). It can be seen from the figure that NTC has no specific amplification. The above results indicate that the detection method established by the present invention can identify the species of pathogenic bacteria in complex samples containing multiple pathogenic bacteria and successfully distinguish whether they are resistant to carbapenem antibiotics.

[0070] Example 5

[0071] Specificity test:

[0072] The genomic DNA mixture of five common pathogenic bacteria, Enterococcus faecalis, Enterococcus faecium, Citrobacter freundii, Staphylococcus aureus, and Proteus mirabilis, was used as a negative reference. The established detection system was used to perform qPCR detection on the genomic DNA of KP, PA, AB, ECL, EC, CRKP, CRPA, and CRAB together with the negative reference. The test results are shown in Figure 2. Figure 5 As shown in the figure, it can be seen that the detection method established by the present invention only amplifies the target bacteria, and the negative reference products have no amplification, which shows that the detection method established by the present invention has good specificity.

[0073] Example 6

[0074] Sensitivity test:

[0075] For 10 1 -10 8 CFU / mL of KP, PA, AB, ECL, EC, CRKP, CRPA, and CRAB were cultured for phenotypic detection, genomic DNA was extracted, and qPCR was performed. The results were as follows Figure 6 As shown in the figure, when the bacterial solution dilution concentration is ≥1×10 CFU / mL, PA, AB, ECL, EC, CRPA and CRAB can collect fluorescence signals with a Ct value of <35; when the bacterial solution dilution concentration is ≥1×10 2 CFU / mL, KP and CRPK can collect fluorescence signals, and the Ct value is <35, indicating that the detection method established by the present invention has high sensitivity.

[0076] It can be seen from the above examples that the detection method provided by the present invention is simple to operate and rapid in detection, and has high sensitivity and good specificity.

[0077] The above embodiments describe the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only for illustrating the principles of the present invention. Without departing from the scope of the principles of the present invention, the present invention may have various changes and improvements, and these changes and improvements all fall within the scope of protection of the present invention.

[0078]

[0079]

[0080]

[0081]

[0082]

[0083] <211> 20

[0084] <212> DNA

[0085] <213> Artificial sequence <400> 29TCAGCTGTTTGTCCGGGTTT 20 <210> 30

[0086] <211> 20

[0087] <212> DNA

[0088] <213> Artificial sequence <400> 30ATCATCCAGCTGCGCGAATA 20 <210> 31

[0089] <211> 20

[0090] <212> DNA

[0091] <213> Artificial sequence <400> 31TTCCAGCAGACCGAAAACCA 20 <210> 32

[0092] <211> 20

[0093] <212> DNA

[0094] <213> Artificial sequence <400> 32AGCAACGTCTTCGATTGGGT 20 <210> 33

[0095] <211> 20

[0096] <212> DNA

[0097] <213> Artificial sequence <400> 33ATCAACGACTGGGCAAGCAT 20 <210> 34

[0098] <211> 20

[0099] <212> DNA

[0100] <213> Artificial sequence <400> 34GAGAAGCCGTAGTCGCTGTT 20 <210> 35

[0101]

Claims

1. A rapid detection method for common pathogenic bacteria and their drug resistance, characterized in that: Combining phenotypic and molecular testing methods involves the following steps: Step S1: Perform phenotypic detection by placing the bacteria to be tested in a culture medium with antibiotics and a culture medium without antibiotics for culture; Step S2: extracting the genomic DNA of the bacteria to be tested from the culture solution respectively; Step S3: Perform molecular detection by performing qPCR detection on the genomic DNA of the bacteria to be tested; Step S4: Analyze the detection data and use the following determination method to determine the specific strain of the bacteria to be detected and whether it is resistant to the antibiotics added to the culture medium: if only the CT value detected for the bacteria to be detected in the culture medium without antibiotics is <35, and the CT value detected for the bacteria to be detected in the culture medium with antibiotics is ≥35 or no CT value can be detected, it means that a specific pathogenic bacteria is detected and the specific pathogenic bacteria has no resistance to the corresponding antibiotics in the culture medium; if the CT values ​​detected for the bacteria to be detected in the culture medium with antibiotics and the culture medium without antibiotics are both <35, it means that a specific pathogenic bacteria is detected and the specific pathogenic bacteria is resistant to the corresponding antibiotics in the culture medium; if the CT values ​​detected for the bacteria to be detected in the culture medium with antibiotics and the culture medium without antibiotics are both ≥35 or no CT value can be detected, it means that no specific pathogenic bacteria is detected.

2. The method for rapid detection of common pathogenic bacteria and their drug resistance according to claim 1, characterized in that: The specific process of the phenotypic detection in step S1 is: the bacteria to be tested are placed in a liquid culture medium with antibiotics and a liquid culture medium without antibiotics, respectively, and cultured at 37°C and 180rpm for 2-3h, then a small amount of bacterial liquid is transferred to a new culture medium of the same type and then cultured at 37°C and 180rpm for 2-3h.

3. The method for rapid detection of common pathogenic bacteria and their drug resistance according to claim 2, characterized in that: The concentration of the antibiotic in the antibiotic liquid culture medium in step S1 is the minimum inhibitory concentration thereof.

4. The method for rapid detection of common pathogenic bacteria and their drug resistance according to claim 1, characterized in that: The method for extracting the genomic DNA of the bacteria to be tested in step S2 adopts the boiling method, and the specific process is: take 1mL of the cultured bacterial solution after cultivation, centrifuge it at 9000rpm for 1min, pour out the supernatant, add 100μL TE buffer and boil it at 100℃ for 10min, then quickly put it in a -20℃ refrigerator for 10min, centrifuge it at 12000rpm for 5min, and the supernatant is the required genomic DNA of the bacteria to be tested.

5. The method for rapid detection of common pathogenic bacteria and their drug resistance according to claim 1, characterized in that: The bacteria to be detected in step S1 are one or more of Klebsiella pneumoniae, Pseudomonas aeruginosa, Acinetobacter baumannii, Enterobacter cloacae or Escherichia coli; the primers used for qPCR detection are as follows: SEQ ID NO: 1-2 are primer pair sequences for detecting Klebsiella pneumoniae; SEQ ID NO: 3-4 are primer pair sequences for detecting Pseudomonas aeruginosa; SEQ ID NO: 5-6 are primer pair sequences for detecting Acinetobacter baumannii; SEQ ID NO: 7-8 are primer pair sequences for detecting Enterobacter cloacae; SEQ ID NO: 9-10 are primer pair sequences for detecting Escherichia coli.

6. The method for rapid detection of common pathogenic bacteria and their drug resistance according to claim 1, characterized in that: The qPCR detection system in step S3 is composed of: 0.4 μL of 10 μM forward primer, 0.4 μL of 10 μM reverse primer, 7.2 μL of ddH2O, 10 μL of 2×UltraSYBR Mixture and 2 μL of bacterial genomic DNA to be tested; the qPCR reaction program is: 95°C, 600 s, 1 cycle; 95°C, 10 s, 60°C, 30 s, 72°C, 32 s to collect fluorescence signals, and cycle 40 times.

Images