Anxiety disorder drug target and application thereof

Abstract

The invention belongs to the technical field of biological medicine, and particularly provides application of EAAT2 as a drug target to screening of drugs for improving anxiety disorder. The drug target EAAT2 is mainly expressed on astrocytes, the research finds that the expression level of the EAAT2 is closely related to the anxiety state, and the anxiety disorder can be improved by regulating and controlling the target through a specific compound and a specific adenovirus vector. A brand-new drug target and a new treatment means and thought are provided for treatment of anxiety disorder and drug research and development.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and in particular relates to an anxiety drug target and application thereof. Background Art

[0002] Anxiety disorders are the most common and highest incidence of mental illness. According to the China Mental Health Survey, as of 2019, the lifetime incidence of mental illness in China is 16.6%, among which anxiety disorders have the highest lifetime incidence, about 7.6%. Currently, effective drugs for the treatment of anxiety disorders are compounds related to the pathogenesis, including commonly used 5-HT drugs, benzodiazepines, These anti-anxiety drugs have certain addictiveness and tolerance, and many unpredictable side effects, such as sexual dysfunction, systemic metabolic diseases, and persistent hypertension. Therefore, it is an inevitable trend to find and develop new drug targets. The pathogenesis of anxiety disorders is currently focused on the study of brain neurons, and drug targets are all targeted at neurons. Many studies have shown that astrocytes in the brain are also involved in the occurrence and development of anxiety disorders. Therefore, it is very necessary to develop new drug targets targeting astrocytes. Summary of the invention

[0003] The purpose of the present invention is to provide an application of a new drug target in improving anxiety.

[0004] To this end, the present invention provides the use of EAAT2 (excitatory amino acid transporter 2) as a drug target in screening drugs for improving anxiety.

[0005] The present invention also provides a drug for improving anxiety, wherein the drug targets, knocks out, intervenes and / or inhibits the expression of the EAAT2 gene.

[0006] Specifically, the above-mentioned drug is selected from dihydrokainic acid or AAV-GFAABC1D-EAAT2 shRNA-mCherry vector.

[0007] Specifically, the preparation method of the above-mentioned AAV-GFAABC1D-EAAT2 shRNA-mCherry vector is:

[0008] (1) Design of EAAT2 shRNA interference vector;

[0009] (2) Construction of rAAV-GfaABC1D-mCherry-5'miR-30a-shRNA (mEaat2)-3'miR-30a-WPREs plasmid;

[0010] (3) using SalI / / EcoRI / restriction endonuclease digestion to obtain a linearized backbone vector fragment;

[0011] (4) Design primers for shRNA (mEaat2 fragment and perform PCR amplification for different target fragments;

[0012] (5) homologously recombine the linearized vector and the target fragment, and transform the recombinant vector;

[0013] (6) The plasmid in step (5) is digested with PacI enzyme, and the digested adenovirus expression vector is transfected into 293T cells to amplify the viral plasmid.

[0014] Specifically, the above-mentioned EAAT2 shRNA interference sequence is GCAACCAACTCTGTCGTA ATATTCAAGAGATATTACGACAGAGTTGTGTGC.

[0015] Specifically, the primers for the shRNA (mEaat2 fragment) in the above step (4) are:

[0016] F1 ctgttgacagtgagcgagcacacaactctgtcgtaatatagtgaagccacagatgta

[0017] F2 tagtgaagccacagatgtatattacgacagagttgtgtgcgtgcctactgcctcg

[0018] miR-HF:taacccaacagaaggctcgagaaggtatattgctgttgacagtgagcga

[0019] miR-HR:ctaaagtagccccttgaattccgaggcagtaggcac.

[0020] Specifically, the above step (5) is specifically as follows: the linearized vector and the target fragment are mixed in proportion, the fragment is connected to the backbone vector by homologous recombination under the action of homologous recombinase Exnase, Escherichia coli Stbl3 is transformed, and cultured at 37°C overnight; a single clone is picked, and positive clones are identified by PCR detection and enzyme digestion, and the successful construction of the vector is confirmed based on the sequencing results.

[0021] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0022] The drug target EAAT2 provided by the present invention is mainly expressed on astrocytes. Studies have shown that the expression level of EAAT2 is closely related to the anxiety state. Regulating this target through specific compounds and specific adenovirus vectors can improve anxiety disorder. This provides a new drug target, new treatment methods and ideas for the treatment and drug development of anxiety disorder.

[0023] The present invention will be further described in detail below with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 It is the result of the chronic stress induction mouse detection in the embodiment of the present invention; wherein, A, chronic stress induction flow chart; B, total distance in the open field detection; C, number of times entering the central area in the open field detection; D, total time staying in the central area in the open field detection; E, open arm residence time in the cross elevated maze detection; F, number of open arm entries in the cross elevated maze detection; G, bright box residence time in the black-and-white shuttle box detection; H, crawling distance in the bright box in the black-and-white shuttle box detection; I, number of conversions in the black-and-white shuttle box detection.

[0025] Figure 2 It is the expression level of EAAT2 in the basolateral amygdala brain region of anxious mice in the embodiment of the present invention; wherein, A, western blot detection band results; B, EAAT2 / GAPDH statistics in normal mice and anxious mice; C, EAAT2 overall mRNA expression level; D, EAAT2 mRNA expression level in neurons, astrocytes and microglia.

[0026] Figure 3 This is the result of DHK inhibiting EAAT2 function to improve anxiety in anxious mice in an embodiment of the present invention; wherein, A, experimental process; B, number of entries into the central area in the open field test; C, total time spent in the central area in the open field test; D, number of entries into the open arm in the cross elevated maze test; E, time spent in the open arm in the cross elevated maze test.

[0027] Figure 4 The results of knocking down EAAT2 expression to improve anxiety in anxious mice in an embodiment of the present invention; wherein, A, experimental process; B, immunohistochemical staining diagram, astrocyte-specific marker S100b and mCherry virus co-labeling; C, statistical results showing a co-labeling rate of up to 94%; D, western blot detection band results; E, EAAT2 / GAPDH statistical results of each group; F, total time spent in the central area in the open field test; G, open arm stay time in the cross elevated maze test.

[0028] Figure 5Schematic diagram of the EAAT2 shRNA interference vector in the embodiment of the present invention.

[0029] Figure 6 This is the rAAV-GfaABC1D-mCherry-5'miR-30a-shRNA(mEaat2)-3'miR-30a-WPREs vector map in the embodiment of the present invention.

[0030] Figure 7 This is the rAAV-GfaABC1D-mCherry-5'miR-30a-shRNA (sc ramble)-3'miR-30a-WPREs vector map in the embodiment of the present invention. DETAILED DESCRIPTION

[0031] The technical scheme in the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Although the representative embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and changes can be made to the present invention without departing from the scope of the present invention. Therefore, the scope of the present invention should not be limited to the embodiments, but should be limited by the attached claims and their equivalents.

[0032] The present invention provides a new anxiety drug target EAAT2 (excitatory amino acid transporter 2), and anxiety can be improved by knocking out or inhibiting EAAT2.

[0033] The present invention also provides a drug for improving anxiety, wherein the drug can target, knock out, intervene and / or inhibit the expression of the EAAT2 gene.

[0034] In some embodiments, the drug is selected from dihydrokainic acid (DHK) or AAV-GFAABC1D-EAAT2 shRNA-mCherry vector.

[0035] The effects of the drug targets of the present invention are studied below through specific examples.

[0036] Embodiment 1:

[0037] 1. Construction of anxiety mouse model

[0038] 1. Experimental Materials

[0039] The mice used in this example were from: Beijing Weitonglihua Experimental Animal Technology Co., Ltd.

[0040] 2. Experimental methods

[0041] Six-week-old male mice were selected for 28-day chronic stress modeling. There are five stressors: one is wet bedding overnight, sprinkle water on the bedding to ensure it is moist; the second is restraint, drill a few small holes in a 50mL centrifuge tube, and then stuff the mouse into the centrifuge tube to ensure that it can breathe smoothly, for 2 hours; the third is crowding, multiple mice are squeezed into a box, and the duration is also 2 hours; the fourth is the cage tilted 45°; the fifth is the reversal of the mouse's circadian rhythm, that is, turning on the light at night.

[0042] After 28 days, the anxiety-like behavior of normal mice and anxious mice was tested using open field, cross elevated maze, and black-and-white shuttle box. The results are as follows: Figure 1 As shown, all indicators of the model mice were significantly weaker than those of normal mice, indicating that the model was successfully established.

[0043] 2. EAAT2 gene and protein expression levels

[0044] The basolateral amygdala brain regions of normal mice and anxious mice were dissected and single-nucleus RNA sequencing was performed to confirm the expression level of the EAAT2 gene; the expression of the EAAT2 protein level was confirmed by western blot. The results are as follows Figure 2 As shown in Figure 3, the expression of EAAT2 in the basolateral amygdala of anxious mice increased significantly, and EAAT2 was mainly expressed in astrocytes.

[0045] 3. Inhibition of EAAT2 expression

[0046] Cannulas were implanted bilaterally in the basolateral amygdala of anxious mice, and DHK (S-DHK) or saline (S-saline) was delivered to the basolateral amygdala through the cannulas, with an injection volume of 300 nL and a DHK concentration of 300 μM. At the same time, normal mice injected with saline (N-saline) were used as blank controls.

[0047] The open field test was performed 10 minutes after the injection, and the cross elevated maze test was performed the next day after the injection. Figure 3 shown.

[0048] Figure 3 B-3E showed that the anxiety symptoms of anxious mice were significantly improved after injection of DHK, indicating that using DHK compounds to inhibit EAAT2 in the basolateral amygdala brain region of anxious mice can improve the anxiety disorder of anxious mice.

[0049] 4. Knockout of EAAT2

[0050] 1. Construction of specific adenoviral vector

[0051] AAV-GFAABC1D-EAAT2 shRNA-mCherry:

[0052] (1) First, design the EAAT2 shRNA interference vector, such as Figure 5 shown.

[0053] According to the screening results, the EAAT2 shRNA interference sequence was determined to be GCAACCAACTCTGTCGTAATATTCAAGAGATATTACGACAGAGTTGTG TGC.

[0054] (2) Construction of plasmid: rAAV-GfaABC1D-mCherry-5'miR-30a-shRNA(mEaat2)-3'miR-30a-WPREs(5670bp)

[0055] Vector map Figure 6 shown.

[0056] Vector linearization: Use SalI / / EcoRI / restriction endonuclease to obtain linearized backbone vector fragments, and perform electrophoresis-gel recovery-concentration measurement for standby use.

[0057] Obtaining the target fragment: Designing shRNA (mEaat2 fragment primers, as follows:

[0058] F1 ctgttgacagtgagcgagcacacaactctgtcgtaatatagtgaagccacagatgta

[0059] F2 tagtgaagccacagatgtatattacgacagagttgtgtgcgtgcctactgcctcg

[0060] miR-HF:taacccaacagaaggctcgagaaggtatattgctgttgacagtgagcga

[0061] miR-HR:ctaaagtagccccttgaattccgaggcagtaggcac

[0062] Based on the above primers, high-fidelity DNA polymerase is used to perform PCR amplification on different target fragments. The corresponding 1420 bp homologous fragments exist between the fragments to ensure the efficiency of homologous recombination. The PCR results are subjected to electrophoresis, and the gel is cut and recovered for concentration measurement before use.

[0063] Homologous recombination: The above-mentioned spare linearized vector and the fragment were mixed in proportion, and homologous recombination connection between the fragment and the backbone vector was achieved under the action of homologous recombinase Exnase, and Escherichia coli Stbl3 was transformed and cultured at 37°C overnight.

[0064] Vector identification: Transform E. coli Stbl3, pick single clones, and identify positive clones through PCR detection and restriction digestion. Confirm the success of vector construction based on sequencing results.

[0065] (3) The packaging and purification of adenovirus can be done by referring to the preparation methods in the field, which can be simplified as follows: 1) Digest the previously identified and purified plasmid with PacI enzyme. 2) Transfect 293T cells with the digested adenovirus expression vector, and harvest the cells to prepare a crude virus extract. 3) Infect 293T cells with the crude virus extract to amplify the virus. 4) Aliquot and store at -80°C.

[0066] AAV-GFAABC1D-EAAT2 scramble-mCherry:

[0067] Construction plasmid: rAAV-GfaABC1D-mCherry-5'miR-30a-shRNA (scramble)-3'mi R-30a-WPREs

[0068] Vector map Figure 7 shown.

[0069] Vector linearization: Use SalI / Eco72I / EcoRI / BamHI restriction endonuclease digestion to obtain linearized backbone vector fragments, and perform electrophoresis-gel recovery-concentration measurement for standby use.

[0070] Obtaining the target fragment: Design the shRNA (scramble) fragment primers as follows:

[0071] F ACGACTCACTATAGGGTCGACGGATCCGCCACCATGGTGAGC

[0072] R CTCGGTCCGCACGTGTTTAAAAAAACCTCCCACATCTC

[0073] Based on the above primers, high-fidelity DNA polymerase is used to perform PCR amplification on different target fragments. Corresponding 14-20 bp homologous fragments exist between the fragments to ensure the efficiency of homologous recombination. The PCR results are subjected to electrophoresis, gel recovery, and concentration measurement for later use.

[0074] Homologous recombination: The above-mentioned spare linearized vector and the fragment were mixed in proportion, and homologous recombination connection between the fragment and the backbone vector was achieved under the action of homologous recombinase Exnase, and Escherichia coli Stbl3 was transformed and cultured at 37°C overnight.

[0075] Vector identification: Transform E. coli Stbl3, pick single clones, and identify positive clones through PCR detection and restriction digestion. Confirm the success of vector construction based on sequencing results.

[0076] (2) The packaging and purification of adenovirus can be done by referring to the preparation methods in the field, which can be simplified as follows: 1) Digest the previously identified and purified plasmid with PacI enzyme. 2) Transfect 293T cells with the digested adenovirus expression vector, and harvest the cells to prepare a crude virus extract. 3) Infect 293T cells with the crude virus extract to amplify the virus. 4) Aliquot and store at -80°C.

[0077] 2. After 2 weeks of chronic stress, the 12 The two specific adenoviral vectors were injected into the basolateral amygdala of anxious mice at a concentration of 200 nL. N-ctrl is normal mouse + AAV-GFAABC1D-EAAT2scramble-mCherry, S-ctrl is anxious mouse + AAV-GFAABC1D-EAAT2scramble-mCherry, and S-sh is anxious mouse + AAV-GFAABC1D-EAAT2shRNA-mCherry.

[0078] After the model was established, the behavioral results of the mice were tested using open field and cross elevated maze. Figure 4 E-4G. The expression of EAAT2 protein level was confirmed by western blot. Figure 4 As shown in D, EAAT2 has been knocked down. By immunohistochemical staining ( Figure 4 B), Astrocyte-specific marker S100b and mCherry virus were co-labeled, and the statistical results showed that the co-labeling rate was as high as 94%.

[0079] Depend on Figure 4 It can be seen that AAV-GFAABC1D-EAAT2 shRNA-mCherry vector can significantly knock down the expression of EAAT2 in astrocytes and improve anxiety in anxious mice.

[0080] The above examples are merely illustrative of the present invention and do not constitute a limitation on the protection scope of the present invention. All designs that are the same or similar to the present invention fall within the protection scope of the present invention.

Claims

1. Application of EAAT2 as a drug target in screening drugs to improve anxiety disorders.

2. A drug for improving anxiety, characterized in that: The drug targets, knocks out, intervenes in and / or inhibits the expression of the EAAT2 gene.

3. The drug for improving anxiety according to claim 2, characterized in that: The drug is selected from dihydrokainic acid or AAV-GFAABC1D-EAAT2 shRNA-mCherry vector.

4. The drug for improving anxiety according to claim 3, characterized in that: The preparation method of the AAV-GFAABC1D-EAAT2shRNA-mCherry vector is as follows: (1) Design of EAAT2 shRNA interference vector; (2) Construction of rAAV-GfaABC1D-mCherry-5'miR-30a-shRNA (mEaat2)-3'miR-30a-WPREs plasmid; (3) using SalI / / EcoRI / restriction endonuclease digestion to obtain a linearized backbone vector fragment; (4) Design primers for shRNA (mEaat2 fragment and perform PCR amplification for different target fragments; (5) homologously recombine the linearized vector and the target fragment, and transform the recombinant vector; (6) The plasmid in step (5) is digested with PacI enzyme, and the digested adenovirus expression vector is transfected into 293T cells to amplify the viral plasmid.

5. The drug for improving anxiety according to claim 4, characterized in that: The EAAT2 shRNA interference sequence is GCAACCAACTCTGTCGTAATATTCAAGAGATATTAC GACAGAGTTGTGTGC.

6. The drug for improving anxiety according to claim 4, characterized in that: In step (4), the primers for the shRNA (mEaat2 fragment) are: F1 ctgttgacagtgagcgagcacacaactctgtcgtaatatagtgaagccacagatgta F2 tagtgaagccacagatgtatattacgacagagttgtgtgcgtgcctactgcctcg miR-HF:taacccaacagaaggctcgagaaggtatattgctgttgacagtgagcga miR-HR:ctaaagtagccccttgaattccgaggcagtaggcac.

7. The drug for improving anxiety according to claim 4, characterized in that: The step (5) is specifically as follows: the linearized vector and the target fragment are mixed in proportion, the fragment is connected to the backbone vector by homologous recombination under the action of homologous recombinase Exnase, Escherichia coli Stbl3 is transformed, and cultured at 37° C. overnight; a single clone is picked, and positive clones are identified by PCR detection and enzyme digestion, and the successful construction of the vector is confirmed based on the sequencing results.

Images