Primer group for detecting spinal muscular atrophy related genes, kit and use method of kit

Abstract

The invention discloses a primer group and a kit for detecting spinal muscular atrophy related genes and a kit using method, the primer group comprises an amplification primer group and an extension primer group, primer nucleotide sequences in the amplification primer group are as shown in SEQ ID NO: 1-14, and primer nucleotide sequences in the extension primer group are as shown in SEQ ID NO: 15-26. The kit provided by the invention comprises the primer group, a PCR reaction reagent, an SAP reaction reagent and an extension reaction reagent, and can simultaneously detect SMN1 and SMN2 gene copy numbers, 7 hotspot mutations in people and c.* 3 + 80Tgt closely related to silent carriers in one reaction; the qualitative detection of the G site has a wider detection range for spinal muscular atrophy. Meanwhile, the amount of sample templates required by nucleic acid detection of the kit is small, the detection limit of the nucleic acid templates can be as low as 1 ng / mu L, and the kit has good sensitivity, specificity, stability and accuracy and can meet the current needs of screening patients with spinal muscular atrophy and silent carriers and prenatal diagnosis of infants.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to a primer set, a kit and a method for using the kit for detecting spinal muscular atrophy related genes. Background Art

[0002] Spinal muscular atrophy (SMA) is an autosomal recessive neurodegenerative disease caused by mutations in the survival motor neuron 1 (SMN1) gene. It is considered the second most common genetic cause of infant mortality, with about 1 / 35 to 1 / 50 carriers in the population and an incidence of about 1:10,000. SMN1 mainly produces the full-length SMN protein that is essential for motor neurons. There is a homologous gene of SMN1 in the human genome, namely SMN2, which is located in the inverted repeat region on chromosome 5q13. This gene differs from the SMN1 gene by only a few nucleotides, especially a C to T conversion in exon 7. This base change causes most SMN2 mRNAs to skip exon 7 during splicing, producing truncated unstable proteins (SMNΔ7), which produce about 10% of the full-length functional SMN protein of SMN1. Therefore, SMN1 is generally regarded as the pathogenic gene of SMA, while SMN2 is its modifier gene, which is usually associated with the severity of the disease. In the 5q13 region, the neuronal apoptosis inhibitory protein (NAIP) gene, the gene encoding the basic transcription factor IIH subunit 2 polypeptide (GTF2H2) gene, and the human 4F5 (H4F5) gene are associated with the clinical phenotype of SMA.

[0003] The cause of SMA is clear, 95% is caused by homozygous deletion of SMN1 biallelic genes, and 5% is caused by compound heterozygous mutation of SMN1, that is, a point mutation occurs in one allele and the other allele is missing. However, current research focuses on the detection of homozygous deletion of exons 7 and 8 or homozygous deletion of exon 7, while there are relatively few studies on the detection of pathogenic point mutations of SMN1. At present, there are 7 pathogenic minor variants confirmed by the pathogenicity assessment of the American College of Medical Genetics and Genomics (ACMG): c.22dupA, c.683T>A, c.689C>T, c.863G>T, c.400G>A, c.463_464delAA, c.835-5T>G. A very low percentage of normal people in the population have 2 copies of SMN1 on one chromosome and 0 copies on the other chromosome. The genotype of such "normal people" is [2+0], which is called a silent carrier. Currently, there is no practical way to distinguish whether the SMN1 genotype is [2+0] or [1+1]. However, studies have found that c.*3+80T>G is more common in chromosomes with two cis copies of SMN1, that is, c.*3+80T>G is closely related to silent carriers.

[0004] At present, the gold standard for SMA gene detection is through multiplex ligation probe amplification (MLPA), but it is time-consuming and expensive. There is also fluorescent quantitative PCR, but this method focuses on the detection of SMN1 gene deletion, and there are few studies on the detection of SMN1 point mutations. In addition, some patents report the use of mass spectrometry for SMA nucleic acid detection, which can simultaneously quantitatively analyze exons 7 and 8 of SMN1 and SMN2, and can also be used for SMA carrier screening and genetic diagnosis. However, the existing nucleic acid mass spectrometry technology for detecting SMA-related gene point mutations does not cover the c.*3+80T>G site that is closely related to silent carriers. Summary of the invention

[0005] The purpose of the present invention is to provide a primer set and a kit for detecting spinal muscular atrophy related genes, which can not only detect the copy number of spinal muscular atrophy genes SMN1 and SMN2, but also detect common point mutations, and realize silent carrier screening at the same time.

[0006] Another object of the present invention is to provide a method for using the above kit.

[0007] To achieve its purpose, the present invention adopts the following technical solution:

[0008] The present invention claims protection for a set of amplification primers for detecting spinal muscular atrophy related genes, wherein the spinal muscular atrophy related genes include gene sites c.22dupA, c.400G>A, c.463_464delAA, c.683T>A, c.689C>T, c.835-5T>G, c.840C>T, c.863G>T, c.*3+80T>G and *c.239G>A, as well as internal reference gene 1 and internal reference gene 2; the nucleotide sequences of the primers in the primer set are shown in SEQ ID NOs: 1-14.

[0009] Specifically, the amplification primers for c.22dupA are shown in SEQ ID NOs: 1-2; the amplification primers for c.400G>A and c.463_464delAA are shown in SEQ ID NOs: 3-4; the amplification primers for c.683T>A and c.689C>T are shown in SEQ ID NOs: 5-6; the amplification primers for c.835-5T>G, c.840C>T, c.863G>T and c.*3+80T>G are shown in SEQ ID NOs: 7-8; the amplification primers for c.*239G>A are shown in SEQ ID NOs: 9-10; the amplification primers for internal reference gene 1 are shown in SEQ ID NOs: 11-12; the amplification primers for internal reference gene 2 are shown in SEQ ID NOs: 13-14.

[0010] The present invention claims protection for a set of single-base extension primers for detecting spinal muscular atrophy-related genes, wherein the spinal muscular atrophy-related genes include gene sites c.22dupA, c.400G>A, c.463_464delAA, c.683T>A, c.689C>T, c.835-5T>G, c.840C>T, c.863G>T, c.*3+80T>G and *c.239G>A, as well as internal reference gene 1 and internal reference gene 2; the nucleotide sequences of the primers in the primer set are shown in SEQ ID NOs: 15-26.

[0011] Specifically, the extension primer for c.22dupA is shown in SEQ ID NO: 15; the extension primer for c.400G>A is shown in SEQ ID NO: 16; the extension primer for c.463_464delAA is shown in SEQ ID NO: 17; the extension primer for c.683T>A is shown in SEQ ID NO: 18; the extension primer for c.689C>T is shown in SEQ ID NO: 19; the extension primer for c.835-5T>G is shown in SEQ ID NO: 20; the extension primer for c.840C>T is shown in SEQ ID NO: 21; the extension primer for c.863G>T is shown in SEQ ID NO: 22; the extension primer for c.*3+80T>G is shown in SEQ ID NO: 23; the extension primer for c.*239G>A is shown in SEQ ID NO: 24; the extension primer for internal reference gene 1 is shown in SEQ ID NO: 25; the extension primer for internal reference gene 2 is shown in SEQ ID NO: 26.

[0012] The present invention also claims to protect the use of the above-mentioned amplification primer set and / or single-base extension primer set in the preparation of a kit for detecting spinal muscular atrophy-related genes.

[0013] The kit can simultaneously realize quantitative detection of SMN1 and SMN2 gene copy numbers and qualitative detection of SMN1-related point mutations in the same reaction. The SMN1-related point mutations cover 7 hot spot mutations in the population and the c.*3+80T>G site that is closely related to silent carriers.

[0014] The present invention further claims protection for a kit for detecting genes associated with spinal muscular atrophy, wherein the kit contains the above-mentioned amplification primer set and / or single-base extension primer set.

[0015] Preferably, the kit further comprises one or more of a PCR reaction reagent, a SAP reaction reagent and a single base extension reaction reagent.

[0016] More preferably, the PCR reaction reagents include one or both of PCR enzyme and PCR buffer; the SAP reaction reagents include one or both of SAP enzyme and SAP buffer; the single base extension reaction reagents include one or more of extension enzyme, extension buffer and extension stop solution.

[0017] The method for using the above-mentioned kit for detecting spinal muscular atrophy-related genes claimed in the present invention comprises the following steps:

[0018] (1) Sample preparation: Take a whole blood sample from a human and extract the sample DNA using a nucleic acid kit;

[0019] (2) Multiplex PCR reaction: Using the sample DNA in step (1) as a template, add PCR reaction reagents

[0020] A multiplex PCR reaction system is configured, and a PCR amplification reaction is performed using an amplification primer set to obtain a PCR product;

[0021] (3) SAP reaction: adding SAP reaction reagent to the PCR product of step (2) to perform a dephosphorylation reaction to eliminate the remaining primers and dNTPs in the reaction system to obtain a dephosphorylated PCR product;

[0022] (4) single base extension reaction: adding a single base extension reaction reagent, a single base extension primer set and ddNTP to the dephosphorylated PCR product in step (3) to perform a single base extension reaction to obtain an extension product;

[0023] (5) After the extension product is purified by resin, it is spotted on a chip and analyzed by time-of-flight mass spectrometry.

[0024] Preferably, in step (2), the PCR amplification reaction conditions are: pre-denaturation at 95°C for 2 min; reaction at 95°C for 30 s, reaction at 56°C for 30 s, reaction at 72°C for 60 s, and amplification for 45 cycles; then incubation at 72°C for 5 min and storage at 4°C.

[0025] Preferably, in step (3), the SAP dephosphorylation reaction conditions are: reaction at 37°C for 40 min; reaction at 85°C for 5 min, and storage at 4°C.

[0026] Preferably, in step (4), the single base extension reaction conditions are: pre-denaturation at 95°C for 30s; [reaction at 95°C for 5s, (reaction at 52°C for 5s, reaction at 80°C for 5s, 5 cycles), 40 cycles]; reaction at 72°C for 3min, and storage at 4°C.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] 1. The present invention provides a primer set and a kit for detecting genes related to spinal muscular atrophy, which can simultaneously realize the quantitative detection of the copy number of SMN1 and SMN2 genes and the qualitative detection of SMN1-related point mutations in one reaction. The SMN1-related point mutations cover 7 hot spot mutations in the population and the c.*3+80T>G site closely related to silent carriers, and have a wider detection range for spinal muscular atrophy.

[0029] 2. The amplification primers and single-base extension primers used in the present invention have good specificity, ensuring the accuracy and repeatability of multiple reactions. The kit requires a small amount of sample template for nucleic acid detection, and the nucleic acid template detection limit can be as low as 1ng / μL. It has good sensitivity, specificity, stability and accuracy, and can meet the current needs of screening spinal muscular atrophy patients and silent carriers and prenatal diagnosis of infants. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 It is the mass spectrometry detection result of the detection kit of the present invention on the nucleic acid sample to be detected. DETAILED DESCRIPTION

[0031] The present invention is described in detail below by specific examples. The examples are used to better understand the present invention, but are not intended to limit the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements fall within the scope of protection of the present invention. The experimental raw materials, reagents and detection kits used in the following examples, unless otherwise specified, can all be obtained through commercial channels.

[0032] Example 1 Establishment of a Spinal Muscular Atrophy-Related Gene Detection System

[0033] Amplification primers and single-base extension primers were designed for exon 7 fragments of SMN1 and SMN2 genes, exon 8 fragments of SMN1 and SMN2 genes, and point mutation sites, respectively. In the multiplex PCR system, the pairing and competition between primers will affect the amplification effect. Therefore, the applicant optimized the conditions such as PCR primer concentration (1, 5, 10 pmol / μL, respectively), extension primer concentration (10, 15, 20, 25 pmol / μL, respectively), PCR annealing temperature (56°C, 58°C, 60°C, respectively), PCR reaction cycle number (40, 45 and 50 cycles) and extension reaction cycle number (35, 40 and 45 cycles) by screening amplification primers and single-base extension primers. According to the peak height value of the mass spectrometry, the applicant finally determined that the PCR annealing temperature of 56°C, the PCR reaction cycle number of 40 and the extension reaction cycle number of 40 were the optimal reaction conditions of the system. The primer sets and primer sequences are shown in Tables 1 and 2, all of which were synthesized by Shanghai Shenggong Biotechnology Co., Ltd. The mass spectrometry peak height values ​​of some primers before and after optimization are shown in Table 3.

[0034] Table 1 Amplification primer sets and primer sequences

[0035]

[0036]

[0037] Table 2 Single base extension primer sets and primer sequences

[0038] name Sequence (5'→3') SEQ ID c.22dupA TGAGCAGCGGCGGCA 15 c.400G>A CTGGATATGGAAATAGA 16 c.463_464delAA GTATCCTTACCTCTTGAGCATT 17 c.683T>A CACCACCACCCCACT 18 c.689C>T ATGGAGGCAGCCAGCAT 19 c.835-5T>G TTAACTTCCTTTATTTTCCT 20 c.840C>T TCCTTCTTTTTGATTTTGTCT 21 c.863G>T TAATTTAAGGAATGTGAGCAC 22 c.*3+80T>G AAACAAATGTTTTTGAACA 23 c.*239G>A TGCTGGCCTCCCACCCCCACC 24 5C (Internal Reference 1) TTAAGGAAAAGAAACAGG 25 RP(Internal Reference 2) AAGCTTGTGGAATCT 26

[0039] Table 3 Comparison of peak heights before and after reaction system optimization

[0040]

[0041]

[0042] Example 2 Preparation of a Spinal Muscular Atrophy Related Gene Detection Kit

[0043] The present invention provides a spinal muscular atrophy-related gene detection kit, which includes a multiplex PCR reaction reagent, a SAP reaction reagent and a single base extension reaction reagent. The specific components are shown in Table 4:

[0044] Table 4 Main components of the kit

[0045] name Components Multiplex PCR Reagents PCR enzyme, PCR buffer, PCR amplification primer set SAP reaction reagent SAP enzyme, SAP buffer Extension Reagents Extension enzyme, extension buffer, extension stop solution, single base extension primer set

[0046] Preferably, the PCR buffer comprises dNTPs, magnesium ions, and a reaction buffer.

[0047] Preferably, the SAP enzyme is a dephosphatase.

[0048] Preferably, the extendase is a single-base extendase.

[0049] Preferably, the kit further comprises ddNTPs.

[0050] Preferably, in the amplification primer set, the concentration of the sequences shown in SEQ ID NOs: 1-6 and 9-12 is 1 pmol / μL, and the concentration of the sequences shown in SEQ ID NOs: 7-8 and 13-14 is 5 pmol / μL; in the extension primer set, the concentration of the sequences shown in SEQ ID NOs: 15-16, SEQ ID NOs: 18-19, SEQ ID NOs: 22-23, and SEQ ID NOs: 25-26 is 10 pmol / μL, the concentration of the sequences shown in SEQ ID NOs: 17 and 24 is 20 pmol / μL, and the concentration of the sequences shown in SEQ ID NOs: 20-21 is 80 pmol / μL.

[0051] Example 3 Method of using the spinal muscular atrophy-related gene detection kit

[0052] 1. Extraction of Nucleic Acids

[0053] Use a nucleic acid extraction kit to extract the whole blood genomic DNA of the sample to be tested. For specific extraction steps, please refer to the instructions of the nucleic acid extraction kit.

[0054] 2. PCR amplification reaction

[0055] Take out each component in the detection kit of the present invention, completely reconstitute at room temperature, oscillate and mix well before use; configure the PCR reaction system according to Table 4, mix well to form a PCR reaction mixture, centrifuge instantly and then use.

[0056] Table 5 PCR amplification reaction system configuration

[0057] Components Reaction volume 1×(μL) Autoclaved purified water 0.9 PCR Buffer 2 PCR enzymes 0.1 PCR amplification primer set (SEQ ID NO: 1-14) 1 Genomic DNA (1-50ng is appropriate) 1 Total volume 5

[0058] The PCR amplification reaction system program is: pre-denaturation at 95°C for 2 minutes; reaction at 95°C for 30 seconds, reaction at 56°C for 30 seconds, reaction at 72°C for 60 seconds, and amplification for 45 cycles; then incubation at 72°C for 5 minutes and storage at 4°C.

[0059] 3. PCR product SAP dephosphorylation reaction

[0060] Prepare the SAP reaction system according to Table 6, mix thoroughly, centrifuge briefly and set aside.

[0061] Table 6 SAP reaction system configuration

[0062] Components Reaction volume 1×(μL) Autoclaved purified water 1.5 SAP Buffer 0.2 SAP enzyme 0.3 Total amount of reaction system 2

[0063] Add the 2 μL SAP reaction solution to the PCR reaction solution in the previous step.

[0064] The SAP dephosphorylation reaction procedure of the PCR product was as follows: reaction at 37°C for 40 min; reaction at 85°C for 5 min, and storage at 4°C.

[0065] 4. Single base extension reaction at the target site

[0066] Configure the extension reaction system according to Table 7, mix thoroughly, centrifuge briefly and set aside.

[0067] Table 7 Extension reaction system configuration

[0068]

[0069]

[0070] Add 2 μL of extension reaction solution to each well into the SAP reaction solution in the previous step, vortex and centrifuge clockwise.

[0071] The PCR extension reaction conditions were as follows: pre-denaturation at 95°C for 30 s; [reaction at 95°C for 5 s, (reaction at 52°C for 5 s, reaction at 80°C for 5 s, 5 cycles), 40 cycles]; reaction at 72°C for 3 min, and storage at 4°C.

[0072] 5. Pre-processing

[0073] After the single-base extension reaction is completed, centrifuge instantly, add 30 μL of high-pressure sterilized purified water to each well with a sample in the 96-well PCR plate, shake and centrifuge, and transfer to the nucleic acid analysis system for experiment.

[0074] 6. On-machine testing

[0075] Set up the ASSAY according to the instructions of the nucleic acid analysis system, transfer the chip and PCR plate to the sample chip position, perform time-of-flight mass spectrometry experiment, mass spectrum analysis, and mass spectrometry peak detection. Figure 1 .

[0076] 7. Results Analysis

[0077] (1) Qualitative detection of point mutations

[0078] Determine the genotype of the target site based on the extension primer and the molecular weight after primer extension, and perform typing of the mutation site according to the table below.

[0079] Table 8 List of extended molecular weight and genotypes of each mutation site

[0080] Mutation site wild type Molecular weight Homozygous mutation Molecular weight Heterozygous mutation c.22dupA G 4930.3 A 4914.3 GA c.400G>A G 5569.7 A 5553.7 GA c.463_464delAA T / C 6978.5 / 6898.6 G / A 6938.6 / 6922.6 TG / CA c.683T>A T 4714 A 4658.1 TA c.689C>T G 5531.68 A 5515.58 GA c.835-5T>G T 6301.1 G 6261.2 TG c.863G>T C 6740.52 A 6764.52 CA c.*3+80T>G T 6146 G 6106.1 TG c.840C>T G 6612.36 A 6596.36 GA c.*239G>A C 6471.28 T 6551.18 CT

[0081] (2) Copy number detection

[0082] Taking the copy numbers of SMN1 and SMN2 as the research objects, two double-copy reference genes were introduced for detection simultaneously (reference gene 1 is a gene without CNV variation in the adjacent sequence of the target gene, and reference gene 2 is human ribonuclease gene), and with reference to 2-3 normal control samples (both SMN1 and SMN2 have 2 copies), the SMN gene was quantified using the copy number calculation mode standardized by the average peak height of the two reference genes. The calculation was performed according to the following formula:

[0083]

[0084] In the formula, SMN1(U) represents the SMN1 gene of the sample to be tested, SMN2(U) represents the SMN2 gene of the sample to be tested, SMN(U) represents the SMN gene of the sample to be tested, SMN(C) represents the SMN gene of the reference sample, REF(U) represents the reference gene of the sample to be tested, and REF(C) represents the reference gene of the reference sample.

[0085] Both of the two reference genes were calculated according to the above formula, and the average value of the two results was taken as the copy number detection result of the target gene. The criteria for judging the detection results are shown in Table 9.

[0086] Table 9 Criteria for judging copy number results

[0087] Copy number detection results Determine the copy number results Result judgment <0.4 0 The target gene is not present in the sample tested 0.6～1.5 1 There is a deletion of 1 target gene in the tested sample 1.6～2.5 2 No target gene is missing in the sample tested 2.6～3.5 3 There are multiple copies of the target gene in the sample being tested (3 copies) >3.6 ≥4 There are multiple copies of the target gene in the sample being tested (≥4 copies)

[0088] Example 4 Detection of genes related to spinal muscular atrophy clinical samples

[0089] 1. Sample source and type

[0090] Three EDTA anticoagulated whole blood samples (numbered S1, S2, S3) taken from Xiangya Hospital of Central South University were selected. The genomic DNA was extracted using the magnetic bead method blood DNA rapid extraction kit of Foshan Aowei (product number: DNB611). The DNA concentration range was 10-50 ng / μL, 1.65 < OD260 / 280 < 2, and it was diluted to 1 ng / μL with sterile water for standby.

[0091] 2. Sample detection

[0092] The method of Example 3 was used for sample detection.

[0093] 3. Experimental results

[0094] Taking the copy number of exon 7 of SMN1 and SMN2 genes as an example, the copy number of the sample to be tested was calculated according to the peak area in the test results, and the statistical results are shown in Table 10. Similarly, the copy number of exon 8 of SMN1 and SMN2 genes can be calculated. At the same time, the mass spectrometry detection results of the mutation sites of the sample to be tested are consistent with those of the reference sample, and the results are shown in Table 11.

[0095] Table 10Copy numbers of exon 7 of SMN1 and SMN2

[0096]

[0097] Table 11 Sample test results

[0098]

[0099] The results showed that the SMN1 gene copy number of the tested sample S1 was 1.85, that is, 2 copies, and the subject S1 was judged to be normal; while the SMN1 gene copy number of the tested samples S2 and S3 was 0, and the subjects S2 and S3 were judged to be SMN1 exon 7 deletion patients.

Claims

1. An amplification primer set for detecting a gene related to spinal muscular atrophy, characterized in that: The spinal muscular atrophy-related genes include gene sites c.22dupA, c.400G>A, c.463_464delAA, c.683T>A, c.689C>T, c.835-5T>G, c.840C>T, c.863G>T, c.*3+80T>G and *c.239G>A, as well as internal reference gene 1 and internal reference gene 2; the nucleotide sequences of the primers in the primer set are shown in SEQ ID NOs: 1-14.

2. A single base extension primer set for detecting a gene associated with spinal muscular atrophy, characterized in that: The spinal muscular atrophy-related genes include gene sites c.22dupA, c.400G>A, c.463_464delAA, c.683T>A, c.689C>T, c.835-5T>G, c.840C>T, c.863G>T, c.*3+80T>G and *c.239G>A, as well as internal reference gene 1 and internal reference gene 2; the nucleotide sequences of the primers in the primer set are shown in SEQ ID NOs: 15-26.

3. Use of the amplification primer set according to claim 1 and / or the single-base extension primer set according to claim 2 in preparing a kit for detecting genes related to spinal muscular atrophy.

4. A kit for detecting genes related to spinal muscular atrophy, characterized in that: Contains the amplification primer set according to claim 1 and / or the single-base extension primer set according to claim 2.

5. A kit for detecting a gene related to spinal muscular atrophy according to claim 4, characterized in that: The kit further comprises one or more of a PCR reaction reagent, a SAP reaction reagent and a single base extension reaction reagent.

6. A kit for detecting a gene related to spinal muscular atrophy according to claim 5, characterized in that: The PCR reaction reagents include one or both of PCR enzyme and PCR buffer; the SAP reaction reagents include one or both of SAP enzyme and SAP buffer; the single base extension reaction reagents include one or more of extension enzyme, extension buffer and extension termination solution.

7. A method for using a kit for detecting a gene associated with spinal muscular atrophy according to any one of claims 4 to 6, characterized in that: The following steps are involved: (1) Sample preparation: Take a whole blood sample from a human and extract the sample DNA using a nucleic acid kit; (2) multiplex PCR reaction: using the sample DNA in step (1) as a template, adding PCR reaction reagents, configuring a multiplex PCR reaction system, and performing PCR amplification reaction using an amplification primer set to obtain PCR products; (3) SAP reaction: adding SAP reaction reagent to the PCR product of step (2) to perform a dephosphorylation reaction to eliminate the remaining primers and dNTPs in the reaction system to obtain a dephosphorylated PCR product; (4) single base extension reaction: adding a single base extension reaction reagent, a single base extension primer set and ddNTP to the dephosphorylated PCR product in step (3) to perform a single base extension reaction to obtain an extension product; (5) After the extension product is purified by resin, it is spotted on a chip and analyzed by time-of-flight mass spectrometry.

8. The method for using the kit for detecting spinal muscular atrophy-related genes according to claim 6, characterized in that: In step (2), the PCR amplification reaction conditions are: pre-denaturation at 95°C for 2 min; reaction at 95°C for 30 s, reaction at 56°C for 30 s, reaction at 72°C for 60 s, and amplification for 45 cycles; then incubation at 72°C for 5 min and storage at 4°C.

9. The method for using the kit for detecting spinal muscular atrophy-related genes according to claim 7, characterized in that: In step (3), the SAP dephosphorylation reaction conditions are: reaction at 37°C for 40 min; reaction at 85°C for 5 min, and storage at 4°C.

10. The method for using the kit for detecting spinal muscular atrophy-related genes according to claim 8, characterized in that: In step (4), the single base extension reaction conditions are: pre-denaturation at 95°C for 30s; [reaction at 95°C for 5s, (reaction at 52°C for 5s, reaction at 80°C for 5s, 5 cycles), 40 cycles]; reaction at 72°C for 3min, and storage at 4°C.

Images