Application of hsacircRNA101231 in diagnosis, treatment and prognosis of rectal cancer

Abstract

The invention provides application of hsacircRNA101231 in diagnosis, treatment and prognosis of rectal cancer, belongs to the technical field of oncomolecular biology, discovers circular RNA hsacircRNA101231 closely related to the colorectal cancer, and discovers that the expression level of the molecule is remarkably related to the prognosis of a patient with the colorectal cancer. It is proved that knock-down of the molecule can inhibit growth, invasion and migration of colorectal cancer cells. Therefore, the circular RNA molecule can be used as a marker for colorectal cancer diagnosis and prognosis evaluation and a target spot for colorectal cancer treatment, and the diagnosis and treatment means of colorectal cancer are enriched.

Description

Technical Field

[0001] The present invention belongs to the technical field of tumor molecular biology, and specifically relates to the application of hsa_circRNA_101231 in the diagnosis, treatment and prognosis of rectal cancer. Background Art

[0002] Colorectal cancer is a common malignant tumor of the lower digestive tract. Its incidence rate ranks third among malignant tumors worldwide, and its mortality rate ranks second. The malignant growth and invasion and metastasis of tumor cells are the main causes of death in patients with colorectal cancer. The treatment effect of colorectal cancer is closely related to the time of its diagnosis. The earlier the colorectal cancer patient is diagnosed and receives intervention treatment, the better the cure effect. The 5-year survival rate of early colorectal cancer can reach more than 90%, while the 5-year survival rate of patients with advanced colorectal cancer is less than 20%. Therefore, early detection of colorectal cancer is particularly important. In addition, the treatment and prognosis evaluation of colorectal cancer are also crucial for patients with colorectal cancer. However, traditional chemotherapy and targeted therapy are not ideal for the treatment of mid- and late-stage colorectal cancer. Therefore, it is crucial to study new therapeutic targets and diagnostic molecular markers for the treatment of colorectal cancer.

[0003] Circular RNA (circRNA) is a type of non-coding RNA that is different from traditional linear RNA. It is a type of non-coding RNA molecule that is formed by reverse splicing of precursor mRNA and does not have a 5' end cap and a 3' end poly (A) tail and forms a closed circular structure in the form of a covalent bond. It is precisely because circular RNA does not have a 5' end cap and a 3' end poly (A) tail that it can prevent degradation by RNA exonucleases, and therefore has the characteristics of strong stability, high conservation, long half-life, and high content, and can be used as an ideal biomarker.

[0004] The formation process of circRNA can be divided into two categories, namely exon circularization and intron circularization. Jeck et al. proposed that exon-derived circRNA (exonic circRNA, ecircRNA) can be divided into two formation modes: lariat-driven circularization and intron-pairing-driven circularization. Lariat-driven circularization is that the 3' end of the exon acts as a splice donor (slicedonor) to attack the 5' end splice receptor (splicereceptor), and the Alu region is covalently bound to form a lariat structure. The lariat structure undergoes internal splicing and then excises the intron to form a circRNA; intron pairing-driven circularization is that after two intron bases complement each other to form a circular structure, the intron is excised to form a circRNA. In fact, introns themselves can also be circularized to form intron-derived circRNA (circular intronic RNA, ciRNA). In recent years, circRNAs have been found to be widely present in mammalian cells and even in some plants. Studies have shown that circRNAs play an important role in various physiological and pathological processes such as cell growth, cell differentiation, cell aging and epigenetic regulation, and are closely related to various diseases including tumors. Discovering more new circRNAs as biomarkers for tumor diagnosis and prognosis and their applications, and obtaining good protection in the patent field as soon as possible, can significantly enhance my country's international competitiveness in this technology field. Summary of the invention

[0005] The technical problem solved by the present invention is to overcome the defects and shortcomings of the prior art. The present invention detects a circular RNA hsa_circRNA_101231 with a length of 412nt, and proposes the application of hsa_circRNA_101231 in the diagnosis, treatment and prognosis of rectal cancer.

[0006] Experiments have shown that the expression of this circular RNA is significantly increased in the peripheral blood plasma of patients with colorectal cancer; and the expression of this circular RNA in paraffin tissue samples of colorectal cancer is significantly correlated with the prognosis of patients; at the same time, knocking down this circular RNA can also inhibit the growth, invasion and metastasis of colorectal cancer, and it may serve as a marker molecule and treatment target for the diagnosis and prognosis evaluation of nasopharyngeal carcinoma.

[0007] The technical solution adopted by the present invention is:

[0008] In a first aspect, the present invention provides a reagent for detecting the expression of hsa_circRNA_101231 for use in the preparation of a colorectal cancer diagnostic product.

[0009] In a second aspect, the present invention also protects the use of a reagent for detecting the expression of hsa_circRNA_101231 in the preparation of a colorectal cancer prognosis assessment product.

[0010] In a third aspect, the present invention also protects a kit for diagnosing and evaluating the prognosis of colorectal cancer.

[0011] In a fourth aspect, the present invention also protects the use of a substance for knocking down the expression of hsa_circRNA_101231 in the preparation of a drug for the treatment of colorectal cancer.

[0012] In a fifth aspect, the present invention also includes a drug for treating colorectal cancer.

[0013] In a sixth aspect, the present invention also protects an hsa_circRNA_101231 inhibitor.

[0014] The sequence of hsa_circRNA_101231 in the above is shown in SEQ ID NO: 1.

[0015] SEQ ID NO: 1:

[0016] TACACGAGCAAGAAGCCATTAACTCTGACCCAGAGTTGTCTAATTGTGAAAATTTTCAGAAGACTGATGTGAAAGATGATCTGTCTGATCCTCCTGTTGCAAGCAGTTGTATTTCTGAGAAGTCTCCACGTAGTCCACAACTTTCAGATTTTGGACTTGAGCGGTACATCGTATCCCAAGTTCTACCAAACCCTCCACAGGCAGTG AACAACTATAAGGAAGAGCCCGTAATTGTAACCCCACCTACCAAACAATCACTAGTAAAAGTACTAAAAACTCCAAAATGTGCACTAAAATGGATGATTTTGAGTGTGTAACTCCTAAATTAGAACACTTTGGTATCTCTGAATATACTATGTGTTTAAATGAAGATTACACAATGGGACTTAAAAATGCGAGGAATAATAAAAG

[0017] The present invention analyzes the expression of hsa_circRNA_101231 in the peripheral blood plasma of healthy adults and patients with rectal cancer and finds that the expression of hsa_circRNA_101231 in patients with colorectal cancer is significantly increased. The present invention detects the expression of hsa_circRNA_101231 in paraffin tissue samples of patients with colorectal cancer by in situ hybridization, and finds that the expression level of hsa_circRNA_101231 is significantly negatively correlated with the prognosis of patients with colorectal cancer, and the progression-free survival rate and overall survival rate of patients with high expression of hsa_circRNA_101231 are significantly lower than those of patients with low expression of hsa_circRNA_101231; the present invention confirms the stability of hsa_circRNA_101231 by RNase R digestion experiment and actinomycin D treatment experiment; the above results show that hsa_circRNA_101231 can be used as a marker for diagnosis and prognosis evaluation of colorectal cancer. siRNA that knocks down hsa_circRNA_101231 can be used as a small molecule drug for the treatment of colorectal cancer.

[0018] Therefore, the present invention applies to protect the following applications of the circRNA marker hsa_circRNA_101231 shown in SEQ ID NO: 1:

[0019] Application of reagents for detecting hsa_circRNA_101231 expression in the preparation of colorectal cancer diagnosis / prognosis evaluation products.

[0020] As an implementation scheme, the reagents for detecting the expression of hsa_circRNA_101231 are specific primers and probes for hsa_circRNA_101231.

[0021] Preferably, the specific primers include an upstream primer as shown in SEQ ID NO: 2, a downstream primer as shown in SEQ ID NO: 3, and a Taqman probe as shown in SEQ ID NO: 4, as well as an external reference upstream primer as shown in SEQ ID NO: 5, an external reference downstream primer as shown in SEQ ID NO: 6, and an external reference Taqman probe as shown in SEQ ID NO: 7.

[0022] Further, as an implementation scheme, the reagent for detecting the expression of hsa_circRNA_101231 also includes PCR amplification enzyme Taqpfu, 10×Buffer, Mg2 + and enzyme-free water.

[0023] The system of the kit for detecting the sample to be tested is: Taqpfu enzyme 2μL, 10×Buffer 5μL, Mg2 +1.5μL, upstream primer 1.5μL, downstream primer 1.5μL, Taqman probe 1μL, external reference upstream primer 1.5μL, external reference downstream primer 1.5μL, external reference Taqman probe 1μL, enzyme-free water 31.5μL, cDNA 2μL, a total of 50μL.

[0024] Preferably, the qPCR reaction procedure of the kit for detecting the sample to be tested is: 95°C for 5 min; 95°C for 15 sec; 60°C for 45 sec; repeat the cycle 45 times; and store at 4°C.

[0025] The present invention confirms that knocking down hsa_circRNA_101231 can significantly inhibit the growth of colorectal cancer through plate cloning experiments, CCK8 experiments and nude mouse subcutaneous tumor formation experiments, and proves that knocking down hsa_circRNA_101231 can significantly inhibit the invasion and metastasis of colorectal cancer through scratch healing experiments, transwell chamber experiments and nude mouse tail vein lung metastasis model experiments. It shows that hsa_circRNA_101231 is a therapeutic target for colorectal cancer. Therefore, the present invention applies to protect the application of hsa_circRNA_101231 expression in the treatment of colorectal cancer.

[0026] Based on this, the present invention provides a drug for treating colorectal cancer, which includes an hsa_circRNA_101231 expression inhibitor.

[0027] As an implementation scheme, the hsa_circRNA_101231 expression inhibitor is si-hsa_circRNA_101231, and the sequence of the si-hsa_circRNA_101231 is shown in SEQ ID NO: 8.

[0028] Beneficial effects of the present invention:

[0029] The research results of the present invention show that the expression level of the circRNA marker hsa_circRNA_101231 is significantly negatively correlated with the prognosis of colorectal cancer patients, and the expression of hsa_circRNA_101231 in the plasma of colorectal cancer patients is significantly higher than that of healthy normal people; the present invention also verifies the stability of hsa_circRNA_101231, and proves that knocking down hsa_circRNA_101231 can significantly inhibit the growth and invasion and metastasis of colorectal cancer. The above results show that hsa_circRNA_101231 can be used as a marker for the diagnosis and prognosis of colorectal cancer, as well as a target for the treatment of colorectal cancer. The discovery of this molecule provides a new theoretical basis and new direction for further studying the pathogenesis of colorectal cancer and exploring the treatment of colorectal cancer, and can be used to prepare a kit for the diagnosis / prognosis of colorectal cancer, enriching the diagnosis and treatment of colorectal cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0031] Figure 1 Schematic diagram of the structure of hsa_circRNA_101231. A. Agarose gel electrophoresis was used to detect the amplification of hsa_circRNA_101231; B. Schematic diagram of the structure of hsa_circRNA_101231.

[0032] Figure 2 The results of RNase R and actinomycin D on hsa_circRNA_101231. A. RNase R assay to detect the stability of hsa_circRNA_101231; B. Actinomycin D assay to detect the stability of hsa_circRNA_101231.

[0033] Figure 3 The expression of hsa_circRNA_101231 in peripheral blood plasma of healthy people and colorectal cancer patients.

[0034] Figure 4 Figure 2. The expression of hsa_circRNA_101231 in colorectal cancer tissue samples. A. Tissue in situ hybridization experiments confirmed that hsa_circRNA_101231 was highly expressed in colorectal cancer tissues; B. Statistics of hsa_circRNA_101231 expression in Figure A.

[0035] Figure 5 The expression of hsa_circRNA_101231 in colorectal cancer samples and patient prognosis.

[0036] Figure 6 The effect of knocking down hsa_circRNA_101231 on the growth of colorectal cancer cells in vitro. A. qRT-PCR was used to detect the expression of hsa_circRNA_101231 and the hsa_circRNA_101231; B. CCK8 assay was used to detect the effect of knocking down hsa_circRNA_101231 on the growth of SW480 and HCT116 cells; C and D. Plate clone formation assay was used to detect the effect of knocking down hsa_circRNA_101231 on the clone formation ability of SW480 and HCT116 cells.

[0037] Figure 7 The effect of knocking down hsa_circRNA_101231 on the growth of colorectal cancer in vivo. A. Schematic diagram of tumor size after knocking down hsa_circRNA_101231 in vivo; B. The effect of knocking down hsa_circRNA_101231 on colorectal cancer tumor growth in vivo; C. The effect of knocking down hsa_circRNA_101231 on tumor weight in vivo.

[0038] Figure 8 The effect of knocking down hsa_circRNA_101231 on the invasion of colorectal cancer cells in vitro. A. Scratch healing assay to detect the effect of knocking down hsa_circRNA_101231 on the migration ability of SW480 and HCT116 cells; B. Transwell chamber assay to detect the effect of knocking down hsa_circRNA_101231 on the invasion ability of SW480 and HCT116 cells.

[0039] Fig. 9 The effect of knocking down hsa_circRNA_101231 on the invasion and metastasis of colorectal cancer cells in vivo. A. In vivo, the metastasis results of colorectal cancer after knocking down hsa_circRNA_101231; B. The statistical results of metastatic nodules in Figure A; CH&E staining detected the effect of knocking down hsa_circRNA_101231 on colorectal cancer lung metastasis. DETAILED DESCRIPTION

[0040] To make the purpose, technical solution and advantages of the embodiments of the present invention more clear, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention.

[0041] Unless otherwise specified, the test materials used in the following examples were purchased from conventional biochemical reagent stores.

[0042] The SW480 and HCT116 cells used in the present invention are colorectal cancer cell lines maintained by the Central Laboratory of Hunan Cancer Hospital. The cell culture conditions are: DMEM liquid culture medium containing 10% fetal bovine serum (FBS) and 1% double antibiotics (penicillin and streptomycin), placed in a constant temperature incubator at 37°C, 95% humidity, and 5% CO2 concentration.

[0043] Source of plasma samples: With the approval of the Ethics Committee of Hunan Cancer Hospital and the informed consent of the patients, plasma samples were collected from healthy persons and patients with colorectal cancer, including plasma samples from 30 normal persons and 51 plasma samples from patients with colorectal cancer.

[0044] The design of the detection primer of circular RNA in the present invention is different from that of the linear RNA primer. It is designed based on both sides of the splicing site and is designed online using the Primer3.0 website. The Taqman probe used for detection is designed at the splicing site. At the same time, the circRNA hsa_circRNA_101231 knockdown sequence is also designed at the splicing site so that the expression of its linear parent gene SKA3 is not affected while knocking down circRNAhsa_circRNA_101231. The final synthesis of primers and probes was commissioned to Shanghai Shenggong Bioengineering Co., Ltd., and the siRNA of circRNAhsa_circRNA_101231 was synthesized by Guangzhou Ruibo Biotechnology Co., Ltd.

[0045] The primers, probes and sequences used in the PCR reactions in the following examples are shown in the table below:

[0046] Table 1 Primer sequences

[0047]

[0048]

[0049] Example 1: Sanger sequencing confirmed the structure of hsa_circRNA_101231

[0050] 1. Extraction of total RNA from cells

[0051] Preparation: Sterilized RNase-free water, 75% ethanol (RNase-free preparation), chloroform, isopropanol, 1×PBS, enzyme-free tips and EP tubes, high-speed low-temperature centrifuge precooled to 4°C, wipe the laboratory table and pipette with 75% alcohol before the experiment begins.

[0052] 1) Take the cells to be extracted RNA and wash them twice with 1×PBS or D-hanks;

[0053] 2) Add 500 μL Trizol lysis buffer to each well of a 12-well plate, lyse at room temperature for 1-2 minutes, gently blow off the cells with a pipette, gently invert up and down 10 times, and let stand at room temperature for 5 minutes;

[0054] 3) Add 100 μL of chloroform (1 mL Trizol: 0.2 mL chloroform: 0.5 mL isopropanol), shake vigorously for 15-30 seconds, and place on ice for 5 minutes;

[0055] 4) 4°C, 12000 rpm / 20 min;

[0056] 5) Take the upper aqueous phase and place it in a pre-cooled tube, add 250 μL of isopropanol, and mix well using a vortex mixer or pipette.

[0057] (-20℃>1h);

[0058] 6) 4°C, 12000 rpm / 30 min, discard the supernatant;

[0059] 7) Add 1 mL of 75% ethanol (precooled) and mix well;

[0060] 8) 4°C, 7600 rpm / 5 min; discard the supernatant and repeat steps 8 and 9;

[0061] 9) Flash for 10 seconds, aspirate as much supernatant as possible, and invert to dry for 10 minutes;

[0062] 10) Add 20-30 μL DEPC and measure RNA concentration and OD value.

[0063] 2. circRNA reverse transcription PCR reaction

[0064] (According to the experimental instruction manual of abm's 5×All-In-OneRTMasterMix(withAccuRTGenomicDNARemovalKit)(#G492))

[0065] Configure the following reaction system:

[0066]

[0067]

[0068] The reverse transcription PCR reaction procedure is as follows:

[0069] 25℃ 10min,

[0070] 42℃ 15min,

[0071] 85℃ 5min.

[0072] After the reaction was completed, the product was stored at -20°C for later use.

[0073] 3. Fluorescence quantitative PCR reaction

[0074] First, dilute the reverse transcription reaction product 5 times, and then follow the abm company's EvaGreen qPCR MasterMix (MasterMix-R) experimental manual to configure the following reaction system:

[0075]

[0076] The reaction program on the real-time fluorescence quantitative PCR machine is as follows: (Cycle×39)

[0077]

[0078] After the above reaction is completed using the Bio-Rad IQ5 real-time fluorescence quantitative PCR instrument, the melting curve of the amplified product is analyzed using the PCR instrument's built-in software to confirm the amplification specificity and collect the PCR amplification product.

[0079] 4. Agarose gel electrophoresis and Sanger sequencing

[0080] The PCR products amplified in step 3 were subjected to agarose gel electrophoresis to further confirm the single product. The remaining PCR products were sent for Sanger sequencing and compared with the circbase database to confirm the structure of circRNAhsa_circRNA_101231 ( Figure 1 A and Figure 1 B).

[0081] Example 2: Detection of hsa_circRNA_101231 characteristics

[0082] 1. RNase R digestion experiment

[0083] 1) Reaction system

[0084] RNase R digestion reaction system

[0085]

[0086] 2) Reaction conditions:

[0087] 37℃, 10-30min.

[0088] Note: 1) The digestion time can be extended appropriately as the amount of RNA increases. Generally, most linear RNAs can be digested in 10-30 minutes, and the abundance of linear RNA detected by PCR is reduced by several hundred times. Digestion for more than 1 hour is not necessary, because a small number of circRNAs with weak tolerance may be digested if the time is too long. 2) After incubation, the cells can be purified and recovered first, or the enzyme can be inactivated at 70℃ for 10 minutes and then the downstream experiment can be carried out directly.

[0089] 3) Purification and recovery:

[0090] 1. The digested RNA can be extracted with phenol: chloroform: isoamyl alcohol (25:24:1, V:V) solution and then recovered by ethanol precipitation; or purified and recovered using RNA purification columns and magnetic beads. qRT-PCR detection of hsa_circRNA_101231 and linear mRNA SKA3 (see Figure 2 A).

[0091] 2. Note: The phenol:chloroform:isoamyl alcohol (25:24:1, V:V) solution is best prepared and used immediately. If the reagent is not available, Trizol Reagent can be used instead.

[0092] 2. Actinomycin D experiment

[0093] In order to detect the stability of circRNA and linear RNA, nasopharyngeal carcinoma cells were seeded into 12-well plates at a density of about 50%. After the cells adhered to the wall, actinomycin D was added at a final concentration of 1 μg / mL for 0, 8, 16, and 24 hours, respectively. The RNA of the cells was extracted and reverse transcribed into cDNA. The expression of hsa_circRNA_101231 and its parent gene SKA3 was detected by qRT-PCR, with 18S rRNA as the internal reference (see Figure 2 B).

[0094] Example 3: Expression of hsa_circRNA_101231 in peripheral blood plasma

[0095] By extracting RNA from the peripheral blood plasma of healthy people and colorectal cancer patients, the expression of hsa_circRNA_101231 in plasma was detected by fluorescence quantitative PCR after reverse transcription. It was found that the expression of hsa_circRNA_101231 in the plasma of colorectal cancer patients was significantly higher than that of normal people (see Figure 3 ).

[0096] 3.1 Plasma RNA extraction

[0097] 1. Centrifuge the peripheral blood at 500 rpm for 10 minutes and wait for the blood to separate.

[0098] 2. Take 250 μL of plasma and transfer it to a 1.5 mL RNase-free centrifuge tube, and add 1 ng of exogenous plasmid DNA as a subsequent external reference. [Note]: If the volume is less than 250 μL, it needs to be supplemented with PBS or saline.

[0099] 3. Add 750 μL of lysis buffer LB, pipette repeatedly, shake vigorously to mix, and let stand at room temperature for 5 minutes.

[0100] 4. Add 200 μL chloroform (self-prepared), shake vigorously for 15 seconds to mix, and let stand at room temperature for 2 minutes.

[0101] 5. Centrifuge at 12,000rpm for 10min at 4℃ to separate the samples. Transfer the upper aqueous phase to a 1.5mL RNase-free centrifuge tube. [Note]: The sample will be divided into three layers, the lower layer is the organic phase, the middle layer and the upper colorless aqueous phase, and RNA is present in the upper aqueous phase. [Note]: The upper layer volume is about 70% of the total amount of lysis buffer LB added. If 750μL of lysis buffer LB is added, the upper aqueous phase is about 525μL. It is recommended to aspirate 500μL to prevent DNA contamination caused by aspirating the middle layer.

[0102] 6. Add 0.5 times the volume of anhydrous ethanol (self-prepared) and mix thoroughly by inversion. [Note]: Precipitation is a normal phenomenon.

[0103] 7. Place RNA adsorption column B3 into a 2 mL collection tube and set aside.

[0104] 8. Add the above pre-treatment mixture to RNA adsorption column B3, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid.

[0105] 9. Add 500 μL of deproteinized solution PL, centrifuge at 12,000 rpm for 30 seconds, and discard the waste liquid.

[0106] 10. Place RNA adsorption column B3 back into the collection tube, add 500 μL of rinse solution W*, centrifuge at 12,000 rpm for 30 seconds at room temperature, and discard the waste solution. [Note]: Make sure that anhydrous ethanol has been added to the rinse solution W*.

[0107] 11. Repeat step 10.

[0108] 12. Place RNA adsorption column B3 back into the collection tube and centrifuge the empty column at 12,000 rpm at room temperature for 2 min to remove the residual rinsing solution W*.

[0109] 13. Place RNA adsorption column B3 in a new 1.5 mL RNase-free centrifuge tube, add 30-50 μL RNase-free H2O to the center of RNA adsorption column B3, and place at room temperature for 2 minutes. Then centrifuge at 12,000 rpm for 1 minute. Collect the filtrate, which is the RNA solution.

[0110] Reverse transcription reaction

[0111] The extracted RNA was reverse transcribed into cDNA using the Thermo Fisher RevertAid First Strand cDNA Synthesis Kit. The reaction system is as follows:

[0112]

[0113]

[0114] Mix thoroughly, incubate at 42°C for 60 min for reverse transcription, incubate at 70°C for 5 min to inactivate reverse transcriptase, then quickly place in an ice bath and store the sample at -20°C.

[0115] Real-time quantitative PCR

[0116] This experiment detects the relative expression of the target gene in cells. The specific configuration of the reaction system is as follows:

[0117]

[0118] qRT-PCR was performed using Roche 480 Real-Time PCR Detection System PCR instrument. The specific reaction conditions are as follows:

[0119]

[0120] Exogenous genes were used as external references for standardization, and 2 -△△CT The relative expression of genes was expressed as values, and the differential expression of genes was analyzed using t-test.

[0121] Example 4: Expression of hsa_circRNA_101231 in colorectal cancer tissue samples

[0122] The expression of hsa_circRNA_101231 in paraffin-embedded colorectal cancer tissue samples and adjacent normal tissue samples was detected to analyze the expression of hsa_circRNA_101231 in normal tissues and colorectal cancer tissues. The expression of hsa_circRNA_101231 in paraffin-embedded NPC tissues and adjacent normal tissue samples was detected using an in situ hybridization kit (BOSTER, Wuhan, China). The probe sequence was designed to span the splicing site of hsa_circRNA_101231 (~30 nt). The staining density and depth were evaluated using a semiquantitative scoring standard. The double-blind scoring was performed by two experienced pathologists. (1) Staining intensity: 0, no staining; 1, light brown; 2, brown without background or dark brown with light brown background (moderate positive); 3, dark brown without nonspecific background (strong positive). (2) Fractional positive signal based on the ratio of total cell number: 0, no positive cells; 1, 0–25%; 2, 25–50% positive rate; 3, 50–70% positive rate; 4, 70–100% positive rate.

[0123] In situ hybridization experiments

[0124] 1) Baking: Place the slices in a 65°C thermostat for 2 h to melt the paraffin.

[0125] 2) Dewaxing: Rapidly dewax the sections in xylene twice for 20 min each time to allow xylene to fully dissolve the paraffin in the tissue, then hydrate the sections according to the following process: 100% ethanol I for 2 min, 100% ethanol II for 2 min, 95% ethanol I for 2 min, 85% ethanol for 2 min, 75% ethanol for 2 min, 50% ethanol for 2 min, and wash once with enzyme-free water.

[0126] 3) Block endogenous peroxidase: 3% H2O2 for 15 min, wash with 1×PBS for 5 min twice.

[0127] 4) Digestion: 3% citric acid diluted pepsin was used for 20 min at room temperature, digestion was terminated with 0.1 M glycine, washed with 1× PBS for 5 min 3 times, and washed once with enzyme-free water.

[0128] 5) Prehybridization: shake off excess water, add prehybridization solution, and incubate at 37°C for 3 hours.

[0129] 6) Hybridization: Shake off the pre-hybridization solution, add diluted probe, and incubate at 37°C overnight.

[0130] 7) Post-hybridization washing: Wash as follows: 2×SSC solution for 10 min 3 times at room temperature; 0.5×SSC solution for 15 min at room temperature; 0.2×SSC solution for 15 min at room temperature (repeat once if necessary).

[0131] 8) Blocking: Add blocking solution at 37℃ for 30 min. Shake off excess liquid and do not wash.

[0132] 9) Add biotinylated mouse anti-digoxigenin: 37°C for 60 min, wash with 0.5M PBS for 5 min 4 times.

[0133] 10) Add SABC: 30 min at room temperature. Wash with 0.5 M PBS for 5 min 3 times.

[0134] 11) Add biotinylated peroxidase: at room temperature for 30 min. Wash with 0.5 M PBS for 5 min 4 times.

[0135] 12) DAB color development: prepare the color development working solution according to the instructions of the DAB kit, mix well and add it dropwise to the specimen, observe and control the color development under a microscope, and wash away the floating color with distilled water.

[0136] 13) Hematoxylin nuclear staining: add hematoxylin to the slices, stain at room temperature for 1-2 minutes, differentiate with 0.5% hydrochloric acid alcohol for 1-2 seconds, return to blue in running water for 30 minutes, and observe the nuclear staining under a microscope.

[0137] 14) Dehydration: Dehydrate the sections in 50%, 70%, 80%, 95% and 100% alcohol in sequence and air-dry in a fume hood for 30 minutes.

[0138] 15) Sealing: Add appropriate amount of neutral gum to the slices for sealing, dry naturally in a fume hood, observe under a microscope and take pictures.

[0139] The depth and range of staining were used to score hsa_circRNA_101231, confirming that hsa_circRNA_101231 was highly expressed in colorectal cancer tissues ( Figure 4 ).

[0140] Example 5: Correlation between the expression of hsa_circRNA_101231 and patient prognosis in colorectal cancer

[0141] Colorectal cancer patients were grouped according to the expression of hsa_circRNA_101231 in paraffin sample tissues, and the expression of hsa_circRNA_101231 and the prognosis of patients were analyzed. It was found that patients with high expression of hsa_circRNA_101231 had relatively poor progression-free survival and overall survival, while patients with low expression of hsa_circRNA_101231 had relatively good progression-free survival and overall survival ( Figure 5 ).

[0142] Example 6: Knockdown of hsa_circRNA_101231 inhibits the growth of colorectal cancer cells in vitro

[0143] In this example, siNC and si-hsa_circRNA_101231 were first transfected into SW480 and HCT116 cells using Hiperfect. After 24 hours of culture, the expression of the parent gene SKA3 and circular RNA has_circRNA_101231 was detected by qRT-PCR, and the cell growth was detected by plate colony formation assay and CCK8 assay. The results showed that knocking down hsa_circRNA_101231 could significantly inhibit the growth of SW480 and HCT116 cells in vitro ( Figure 6 ).

[0144] Plate colony formation assay

[0145] 1) Digest the cells used for the experiment and count the cells. Inoculate 1500 cells / well into a 6-well plate and change the medium every two days.

[0146] 2) After 14 days, discard the supernatant, wash the cells with PBS, and fix them with 4% paraformaldehyde at room temperature for 20 minutes;

[0147] 3) Discard paraformaldehyde, wash once with PBS, and stain with crystal violet for 20 min;

[0148] 4) Discard the crystal violet staining solution, wash with PBS several times, and when clear clone morphology can be seen, discard the PBS and let it dry;

[0149] 5) After the PBS is completely dried, use a scanner to scan and take pictures.

[0150] CCK8 experiments

[0151] 1) Digest the cells used for the experiment and count the cells. Inoculate 1500 cells / well into a 96-well plate, with 5 replicate wells for each group of cells.

[0152] 2) After incubation in a cell culture incubator for 12 h, add 10 μl / well CCK8 solution, incubate at 37°C for 1 h, and measure the absorbance of each well with an enzyme-linked immunosorbent assay at a wavelength of 450 nm;

[0153] 3) Repeat adding CCK8 and measuring the absorbance value every 24 hours for a total of 6 times.

[0154] Example 7: In vivo, knockdown of hsa_circRNA_101231 inhibits the growth of colorectal cancer cells

[0155] After knocking down hsa_circRNA_101231 in colorectal cancer cells HCT116, a nude mouse subcutaneous tumor model was constructed and the growth of subcutaneous tumors in nude mice was observed. It was found that knocking down hsa_circRNA_101231 could significantly inhibit the growth of colorectal cells in vivo (see Figure 7 ).

[0156] siRNA transfection

[0157] (1) Cells in the logarithmic growth phase were inoculated into 6-well plates and cultured in a 37°C cell culture incubator. When the cell confluence rate reached 40%-50%, siRNA transfection was performed.

[0158] (2) Prepare the siRNA solution in a clean bench according to the siRNA instructions. Take a sterile 1.5mL EP tube, add 200μl OPTI-MEM serum-free medium, add 2.5μl transfected siRNA (20nM), and finally add 2.5μl Hiperfect transfection reagent, mix well, and leave at room temperature for 10-15 minutes. Next, change the medium in the 6-well plate, add the prepared mixed solution to each 6-well plate, and place it in a 37℃ cell culture incubator for 48h.

[0159] (3) Collect cells, extract RNA, and perform qRT-PCR to identify the knockdown efficiency or extract protein and perform western blot to identify the protein knockdown effect.

[0160] Construction of subcutaneous tumor model in nude mice

[0161] (1) Preparation of nude mice: Ten 4-week-old female BALB / C nude mice were purchased from Hunan Slake Jingda Experimental Animal Co., Ltd. and randomly divided into two groups, with 5 mice in each group. They were housed in the animal room of the Affiliated Tumor Hospital of Xiangya School of Medicine of Central South University (Hunan Tumor Hospital) under specific pathogen-free (SPF) conditions. The experiment was performed one week later.

[0162] (2) Cell preparation: Two types of HCT116 cells in the logarithmic growth phase (cells transfected with pcDNA3.1 control plasmid and pcDNA3.1-hsa_circRNA_101231 overexpression vector) were taken, and the cells were digested from the culture dish using trypsin digestion solution, and the cells were washed, resuspended and counted with normal saline. Finally, the cell concentration was adjusted to 2.5×10 7 Each mouse was injected with 5×10 6 cells (about 200 μl cell suspension).

[0163] (3) Subcutaneous injection: Pinch the neck of the nude mouse with the index finger and thumb of the left hand, and hold the tail of the nude mouse with the little finger, ring finger and fingertips of the left hand to fix the nude mouse. Use an alcohol cotton ball to gently wipe the armpit of the mouse's right upper limb. Use a syringe to absorb the cells and slowly inject them into the subcutaneous tissue of the right upper limb armpit.

[0164] (4) After the subcutaneous injection of cells, the growth of nude mice was observed every day, and the weight changes of nude mice and the size of tumors were recorded every three days.

[0165] (5) Killing of nude mice: After observing that the subcutaneous tumor tissue has grown to an appropriate size, the experiment was terminated and all 10 nude mice were killed by cervical dislocation and dissected. The subcutaneous tumor tissue was removed and photographed.

[0166] Example 8: Knockdown of hsa_circRNA_101231 inhibits invasion and migration of colorectal cancer cells in vitro

[0167] In this example, siNC and si-hsa_circRNA_101231 were first transfected into SW480 and HCT116 cells using Hiperfect. After 24 h of culture, the migration and invasion of cells were detected by wound healing assay and transwell chamber assay. It was found that knocking down hsa_circRNA_101231 could significantly inhibit the invasion and migration of colorectal cancer cells (see Figure 8 ).

[0168] Scratch healing assay

[0169] A 6-well plate was used for the scratch healing experiment. After the cells were transfected, they covered the bottom of the plate for the experiment (approximately 24-36 hours). A 10 μL colorless pipette tip was used to gently scratch the cells. The cells were washed twice with 1×PBS, and complete culture medium containing 2% FBS was added. The scratch width at this time was recorded by taking a picture, which was the width at 0 hours. The cells were then cultured in a cell culture incubator, and the scratch width was photographed at 24 hours and 48 hours. The migration rate of cells in different treatment groups was analyzed based on the pictures obtained.

[0170] Transwell chamber invasion assay

[0171] Place BD Matrigel gel in a 4°C refrigerator to melt and set aside. Dilute Matrigel gel with serum-free culture medium, with a gel-to-culture medium ratio of 1:14. After fully mixing, take 60 μL and add it to the upper chamber of each Transwell chamber. Incubate it in a 37°C cell culture incubator for 1 hour to solidify it for use. Digest the cells used for the experiment, wash the cells twice with serum-free culture medium, resuspend the cells with serum-free culture medium, and count the cells. Add the cells to the upper chamber of the Transwell chamber at a ratio of 100,000 / well / 200ml, add 800 μL of culture medium containing 20% ​​fetal bovine serum to the lower chamber of the Transwell chamber, and culture the culture plate at 37°C for 48 hours. After taking out the Transwell chamber, wash it three times in normal saline, fix the cells with 4% paraformaldehyde at room temperature for 30 minutes, wash the chamber with normal saline three times, stain with 0.1% crystal violet at room temperature for 10 minutes, wash away the excess crystal violet with normal saline, wipe the Matrigel on the upper surface of the chamber with a cotton swab, observe and photograph under an inverted microscope, and count the number of cells.

[0172] Example 9: In vivo, knockdown of hsa_circRNA_101231 inhibits the invasion and metastasis of colorectal cancer cells

[0173] After knocking down hsa_circRNA_101231 in colorectal cancer cells HCT116, a nude mouse lung metastasis model was constructed to observe the effect of knocking down hsa_circRNA_101231 on invasion and metastasis. It was found that compared with the control group, the number of lung metastatic nodules and tumor metastasis foci in the mice in the hsa_circRNA_101231 knockdown group were significantly reduced, indicating that knocking down hsa_circRNA_101231 can significantly inhibit the invasion and metastasis of colorectal cancer cells (see Fig. 9 ).

[0174] Construction of nude mouse lung metastasis model

[0175] After arriving at the Affiliated Tumor Hospital of Xiangya School of Medicine, Central South University (Hunan Tumor Hospital), nude mice were first adapted to the barrier environment for one week. During this period, colorectal cancer cells for model construction were prepared. HCT116 cells in the logarithmic growth phase (transfected with siNC, si-hsa_circRNA_101231) were digested and washed three times with saline. The cells were resuspended with saline and counted. Finally, the cell concentration was adjusted to 1×10 7 Each nude mouse was injected with 2×10 6 cells (about 200 μL cell suspension). The nude mice were randomly divided into 3 groups, with 5 nude mice in each group. Tumor cells were injected into the nude mice through the tail vein. The body weight of the nude mice was recorded every 3 days. After 60 days, the nude mice were killed and lung tissues were obtained. The tumor formation was observed after fixation.

[0176] The embodiments described above are only preferred specific implementation modes of the present invention, and the protection scope of the present invention is not limited thereto. Any simple changes or equivalent replacements of the technical solutions that can be obviously obtained by any technician familiar with the field within the technical scope disclosed in the present invention belong to the protection scope of the present invention.

Claims

1. Use of a reagent for detecting the expression of hsa_circRNA_101231 in the preparation of a colorectal cancer diagnostic product, wherein the sequence of the circular RNA is shown in SEQ ID NO:

1.

2. Use of a reagent for detecting the expression of hsa_circRNA_101231 in the preparation of a colorectal cancer prognosis assessment product, wherein the sequence of the circular RNA is shown in SEQ ID NO:

1.

3. The use according to claim 1 or 2, characterized in that: The reagents for detecting the expression of hsa_circRNA_101231 are specific primers and probes for detecting circular RNA.

4. The use according to claim 3, characterized in that The specific primers include an upstream primer as shown in SEQ ID NO: 2 and a downstream primer as shown in SEQ ID NO: 3; the probe is shown in SEQ ID NO:

4.

5. A kit for diagnosing and evaluating prognosis of colorectal cancer, characterized in that The kit comprises the specific primers and probes according to claim 4.

6. Use of a substance that knocks down the expression of hsa_circRNA_101231 in the preparation of drugs for the treatment of colorectal cancer.

7. An hsa_circRNA_101231 inhibitor, characterized in that The hsa_circRNA_101231 inhibitor includes substances that knock down the expression of the hsa_circRNA_101231 gene.

8. A drug for treating colorectal cancer, characterized in that: The drug contains a substance that reduces hsa_circRNA_101231 gene expression.

9. The use according to any one of claims 6 to 8, characterized in that: The substance for knocking down the expression of the hsa_circRNA_101231 gene is a siRNA that specifically interferes with the expression of the hsa_circRNA_101231 gene, and the sequence of the siRNA is shown in SEQID NO:8.

Images