Nanoparticles of targeted bone tissue macrophages as well as preparation method and application of nanoparticles

Abstract

The invention discloses a nanoparticle targeting bone tissue macrophages as well as a preparation method and application thereof, and belongs to the technical field of biological medicines. According to the invention, a dual targeting mechanism is adopted, and the surface of the nanoparticle is modified with a bone-like small peptide sequence and a mannose modified ligand, so that the nanoparticle can specifically recognize macrophages in a bone tissue environment. According to the bone tissue macrophage targeting nanoparticle system prepared by the invention, the targeting efficiency, the anti-inflammatory effect and the tissue repair effect can be remarkably improved, systematic side effects are reduced, a new treatment means is provided for bone injury repair, and the bone tissue macrophage targeting nanoparticle system has a good clinical application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to nanoparticles targeting bone tissue macrophages and a preparation method and application thereof. Background Art

[0002] Inflammation regulation during bone tissue repair and regeneration plays an important role in promoting bone healing and recovery. Macrophages play a key role in the healing process of bone injuries, especially in the early stages of bone tissue inflammation, by releasing a variety of pro-inflammatory or anti-inflammatory cytokines to regulate the tissue microenvironment. However, the distribution and activity of macrophages in bone tissue are not easy to directly regulate, which poses a challenge to the targeted regulation of their functions. Therefore, in recent years, nano drug delivery systems targeting macrophages have become a research hotspot. These systems achieve effective control of inflammation and promote bone regeneration by targeting anti-inflammatory drugs, genes or other active molecules to macrophages. However, in existing nano delivery systems, there are still few nano structures that can accurately target bone tissue macrophages and have efficient release of active ingredients, which limits the possibility of their clinical transformation.

[0003] Existing macrophage-targeted nanoparticle systems usually modify specific ligands (such as mannose or small molecule antibodies) on the particle surface to recognize macrophage receptors and release drugs or gene payloads into macrophages. However, these targeting systems still have the following defects:

[0004] (1) Insufficient targeting: Although current macrophage-targeted nanoparticles can partially identify macrophages, it is difficult to effectively distinguish macrophages in bone tissue from macrophages in other tissues. Therefore, after systemic administration, nanoparticles are often non-specifically distributed in macrophages throughout the body, resulting in limited therapeutic effects and even possible systemic side effects.

[0005] (2) Low targeting efficiency: Most existing nanoparticles only have a single targeting mechanism, which relies on the interaction with macrophage surface receptors (such as CD206 mannose receptor), but due to the lack of dual targeting mechanism, their enrichment effect in bone tissue is poor.

[0006] (3) Lack of multifunctionality: Most of the targeted nanoparticles in the existing technology are single drug delivery systems, lacking the multifunctional loading and synergistic release of genes and drugs, which limits the multidimensional regulatory potential of macrophage function. In addition, the existing system is also insufficient in improving the stability of bone tissue and local sustained release. Summary of the invention

[0007] The present invention provides a method for preparing nanoparticles targeting bone tissue macrophages, the preparation method comprising the following steps:

[0008] (1) Synthesis of core nanoparticles

[0009] ① Dissolve PLGA in an organic solvent to a final concentration of 8-12 mg / mL;

[0010] ② miR-142-3p was dissolved in a buffer solution at a concentration of 1.5-2.5 μg / mL, and then added to the PLGA organic phase, with a molar ratio of PLGA to miR-142-3p of 0.5-1.5:95-105; the miR-142-3p sequence is shown in SEQ ID NO.1;

[0011] ③ Add the above solution dropwise into the aqueous phase containing the surfactant while stirring to form colostrum;

[0012] ④Further emulsification through ultrasound to form a uniform nanoemulsion;

[0013] ⑤Remove the organic solvent until solidified nanoparticles are formed;

[0014] ⑥ Removal of unencapsulated miR-142-3p in the solidified nanoparticles;

[0015] (2) Modification of targeting ligands

[0016] A. Osteopeptide modification:

[0017] ①Active groups modified on the surface of PLGA particles:

[0018] HMDI treatment: PLGA particles are suspended in an organic solvent at a concentration of 8-12 mg / mL, HMDI is added to a final concentration of 8-12 mM, the reaction temperature is 28-32°C, and the reaction is carried out for 3-5 hours to finally obtain PLGA particles containing amino groups on the surface;

[0019] Or HSP treatment: suspend PLGA particles in an organic solvent at a concentration of 8-12 mg / mL, add HSP to a final concentration of 14-16 mM, react at a temperature of 24-26°C, react for 5-7 hours, and finally obtain PLGA particles containing carboxyl groups on the surface;

[0020] ② Binding reaction of OPG simulation sequence:

[0021] The OPG simulation sequence is dissolved in a buffer solution to a final concentration of 0.8-1.2 mg / mL, and EDC and NHS are added to a final concentration of 8-12 mM and 4-6 mM, respectively, and activated for 10-20 minutes; the OPG simulation sequence is shown in SEQ ID NO.2;

[0022] The activated OPG analog sequence solution was mixed with PLGA particles, the final concentration of PLGA particles was 8-12 mg / mL, reacted at room temperature for 5-7 hours, and the modified particles were collected after centrifugation;

[0023] B. Mannose modified ligands:

[0024] ① PLGA particle surface modification with amino or carboxyl groups:

[0025] ② Chemical cross-linking method of mannose modification:

[0026] The concentration of mannose solution is 4-6 mg / mL;

[0027] The amount of PLGA particles added was 8-12 mg / mL;

[0028] Amount of cross-linking agent used: the molar ratio of EDC to NHS is 0.8-1.2:1.5-2.5, and the molar ratio of mannose to the sum of the cross-linking agent EDC and NHS is 0.5-1.5:1-2;

[0029] Reaction conditions: pH 6-7, reaction temperature 24-26°C, time 3-5 hours;

[0030] (3) Construction of the outer protective shell

[0031] A. Synthesis of Hyaluronic Acid Derivatives:

[0032] ① Dissolve hyaluronic acid in a pH 4-6 buffer to prepare a hyaluronic acid solution with a w / v of 0.8-1.2%;

[0033] ② Add EDC and NHS, the molar ratio of EDC to NHS is 0.5-1.5:1.5-2.5, and the molar ratio of EDC to hyaluronic acid is 0.8-1.2:0.8-1.2;

[0034] ③ Adding ratio: HDA·HCl is added to obtain HDA-modified hyaluronic acid, and the molar ratio of hyaluronic acid monosaccharide unit to hexamethylenediamine hydrochloride is 10:1-20:1 to control the degree of modification;

[0035] ④React at room temperature for 3-5 hours;

[0036] B. Outer coating:

[0037] ①Concentration of HDA modified hyaluronic acid solution:

[0038] Prepare 0.8-1.2 mg / mL HA-HDA solution, wherein the molecular weight of the hyaluronic acid is 10-50 kDa;

[0039] ②Requirements for the amount of addition:

[0040] The amount of HDA-modified hyaluronic acid added is 10%-20% of the total volume of the PLGA nanoparticle solution; the concentration of the PLGA nanoparticle solution is 8-12 mg / mL;

[0041] ③Coating method:

[0042] a. Slowly add the HA-HDA solution to the PLGA nanoparticle aqueous phase while stirring;

[0043] b. Self-assembly conditions: react at room temperature for 0.5-1.5 hours to form a stable coating layer.

[0044] Preferably, in step (1), PLGA is dissolved in an organic solvent to a final concentration of 10 mg / mL.

[0045] More preferably, in step (1), the molar ratio of PLGA to miR-142-3p is 1:100.

[0046] More preferably, when HMDI or HSP is used for treatment in step (2), the concentration of the PLGA particles after being suspended in the organic solvent is 10 mg / mL.

[0047] More preferably, in step (2), HMDI is added to a final concentration of 10 mM, and HSP is added to a final concentration of 15 mM.

[0048] More preferably, in step (2), the OPG mimic sequence is dissolved in a buffer solution to a final concentration of 1 mg / mL, and EDC and NHS are added to final concentrations of 10 mM and 5 mM, respectively.

[0049] More preferably, in step (2), the concentration of mannose solution is 5 mg / mL; the amount of PLGA particles added is 10 mg / mL; the amount of crosslinking agent used: the molar ratio of EDC to NHS is 1:2, and the molar ratio of mannose to the sum of the crosslinking agents EDC and NHS is 1:1.5.

[0050] More preferably, in step (3), the molar ratio of EDC to NHS is 1:2, and the molar ratio of EDC to hyaluronic acid is 1:1.

[0051] The present invention also provides nanoparticles targeting bone tissue macrophages prepared by the above preparation method.

[0052] The present invention also provides the use of the nanoparticles in preparing bone damage repair products.

[0053] Compared with the prior art, the present invention has the following beneficial effects:

[0054] (1) Enhanced targeting and delivery efficiency of bone tissue

[0055] The present invention adopts a dual targeting mechanism, by modifying the surface of the nanoparticles with an osteoid peptide sequence and a mannose modified ligand, so that the nanoparticles can specifically recognize macrophages in the bone tissue environment. The osteoid peptide (OPG simulation sequence) can specifically bind to the RANKL molecule in the bone tissue, while the mannose ligand targets the CD206 mannose receptor on the surface of the macrophage. This dual targeting mechanism significantly improves the enrichment effect of the particles on macrophages in the bone tissue and reduces nonspecific adsorption in the systemic distribution. According to experimental data, the macrophage aggregation concentration of the dual-targeted modified nanoparticles in the bone tissue is increased by about 40% or more than that of the single-targeted nanoparticles, which effectively improves the delivery efficiency of drugs or genes.

[0056] (2) Improve the multi-dimensional regulatory effects of anti-inflammatory and repair

[0057] The present invention loads miR-142-3p in nanoparticles. This specific miRNA plays a significant role in regulating the function of macrophages, especially inhibiting excessive pro-inflammatory responses and regulating the phenotypic conversion of macrophages, thereby achieving effective regulation of the inflammatory microenvironment. Genetic regulation of macrophages through miR-142-3p loading can more accurately intervene in the inflammatory response of bone tissue and further promote angiogenesis and tissue repair. This multifunctional loading design has significant advantages over a single drug delivery system, allowing macrophages to be reprogrammed to a pro-healing phenotype in a short period of time, effectively reducing the persistence of inflammation and related side effects.

[0058] (3) Prolong the retention time of nanoparticles in bone tissue and improve stability

[0059] By coating the outer layer of the nanoparticles with hyaluronic acid-hexamethylenediamine derivatives (HA-HDA), the present invention improves the biocompatibility and stability of the particles. HA-HDA not only enhances the retention time of the nanoparticles in bone tissue, but also significantly improves its stability in the circulatory system and prolongs the half-life of the nanoparticles in the body. According to preliminary in vivo experimental data, the retention time of nanoparticles coated with HA-HDA derivatives in bone tissue is increased by about 2-3 times compared with unmodified particles, effectively reducing drug waste caused by rapid clearance and reducing the need for multiple dosing.

[0060] (4) Reduce systemic side effects and reduce the impact on non-target tissues

[0061] Compared with traditional nanoparticle systems, the dual-targeting design of the present invention and the application of the hyaluronic acid derivative protective shell enable the nanoparticles to significantly reduce the absorption and accumulation in non-targeted tissues, thereby reducing the risk of systemic side effects. Experimental results show that compared with traditional non-specifically distributed nanoparticles, the absorption of the nanoparticles of the present invention in non-bone tissue macrophages is reduced by about 60%, which improves the specificity of the drug and reduces the risk of unnecessary toxic side effects.

[0062] (5) Improving clinical translation potential

[0063] The present invention overcomes the bottleneck problems of insufficient targeting, low delivery efficiency, and non-specific distribution of traditional nanoparticle systems in bone tissue through innovative design. The nanoparticle system based on the dual targeting mechanism not only has good biocompatibility and low toxicity, but also has efficient inflammation regulation and tissue repair functions, which meets the current clinical application requirements for safety and effectiveness. In addition, the polypeptide ligands, miRNA and hyaluronic acid derivatives used in the present invention are all components with good biocompatibility, further improving the possibility of its clinical application.

[0064] In summary, the present invention provides an efficient and specific bone tissue macrophage targeting nanoparticle system, which can significantly improve the targeting efficiency, anti-inflammatory effect and tissue repair effect, reduce systemic side effects, provide a new treatment for bone damage repair, and has good clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] Figure 1 This is an electron micrograph of the bone tissue-targeted nanoparticles in Example 2.

[0066] Figure 2 The Dir-labeled nanoparticles in Example 3 are targeted to bone tissue.

[0067] Figure 3 This is the analysis result of the tube in Example 4.

[0068] Figure 4 This is the immunofluorescence result in Example 5. DETAILED DESCRIPTION

[0069] Example 1 Specific synthesis process and steps of nanoparticles

[0070] 1. Material Preparation

[0071] Core material: polylactic acid-glycolic acid copolymer (PLGA), PLGA (lactic acid: glycolic acid = 85:15) with high biocompatibility and good degradability is selected as the core material to ensure its sustained release characteristics in the body. This material has good degradability and can be gradually degraded into lactic acid and glycolic acid in the body, and finally excreted from the body through metabolism.

[0072] Targeting ligands (the following targeting ligands are covalently linked to the surface of PLGA nanoparticles):

[0073] (1) Osteopeptide (OPG analog sequence SEQ ID NO. 2: KYQGIYKSMS). The OPG analog sequence that specifically recognizes bone tissue can be selected to enhance the targeting of particles in bone tissue.

[0074] (2) Macrophage targeting ligand: Mannose-modified ligand, by covalently binding mannose molecules on the surface of nanoparticles, the ligand can specifically bind to glycoprotein receptors (such as Mannose Receptor, MR) on macrophages, thereby selectively targeting macrophages in bone tissue, targeting the CD206 receptor.

[0075] (3) Drug or gene loading: anti-inflammatory and pro-angiogenic small molecules (miR-142-3p sequence SEQ ID NO.1: UGUAGUGUUUCCUACUUUAUGGA), which can regulate the functional state of macrophages, promote angiogenesis, effectively reduce the inflammatory response in bone tissue, and promote tissue repair.

[0076] (4) Outer protective shell: hyaluronic acid-hexamethylenediamine covalent derivative (HDA-modified hyaluronic acid), which further enhances targeting and biocompatibility, prolongs blood circulation time, and prevents rapid clearance in the circulatory system.

[0077] 2. Synthesis of Core Nanoparticles

[0078] (1) PLGA (85:15) was dissolved in the organic solvent ethyl acetate at a concentration of 10 mg / mL.

[0079] (2) miR-142-3p was dissolved in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) at a concentration of 2 μg / mL and then added to the PLGA organic phase to ensure that the drug loading ratio (miR-142-3p) was 1:100 (molar ratio of PLGA to miR-142-3p) to ensure an optimal balance between loading amount and release rate.

[0080] (3) The above solution was added dropwise at a rate of 1 mL / min into 10 mL of surfactant (polyethylene glycol-modified polyvinyl alcohol (PEG-PVA), concentration of 1% (w / v)) aqueous phase (pre-cooled to 4°C to increase particle uniformity) while stirring at 1000 rpm to form colostrum.

[0081] (4) The product was further emulsified by ultrasonic probe (20 kHz, 60 W power, 10 s intermittent ultrasound, lasting for 2 min) to form a uniform nanoemulsion.

[0082] (5) The emulsion was placed on a rotary evaporator at 300 rpm and 25° C. to evaporate the organic solvent until solidified nanoparticles were formed.

[0083] (6) After nanoparticle preparation, unencapsulated miR-142-3p was removed by ultracentrifugation (30,000 g, 4°C, 20 min), and the particles were washed three times with sterile PBS.

[0084] Packaging steps and precautions:

[0085] ① Evenly mix the miR-142-3p solution and the PLGA organic solution, and then encapsulate according to the emulsion method operation steps.

[0086] ② Maintain low temperature (4°C) in the aqueous phase to avoid miR degradation, and use nitrogen to protect the environment during the evaporation of organic solvents to reduce the risk of miR oxidation.

[0087] 3. Modification of targeting ligands

[0088] (1) Osteopeptide modification:

[0089] On the surface of PLGA particles, the OPG analog sequence is covalently bound through a chemical reaction (such as a cross-linking reaction). The specific process is as follows:

[0090] ①Active groups modified on the surface of PLGA particles:

[0091] Amino groups (–NH2) or carboxyl groups (–COOH) are introduced on the surface of PLGA particles as active sites, usually using hydroxypropanesulfonic acid (HSP) or 1,6-hexanediol diisocyanate (HMDI) for surface activation.

[0092] HMDI treatment: PLGA particles were suspended in anhydrous dichloromethane (DCM) at a concentration of 10 mg / mL, HMDI (final concentration of 10 mM) was added, the reaction temperature was 30°C, and the reaction lasted for 4 hours. Then, the particles were washed three times with anhydrous ether to remove the unreacted products, and finally PLGA particles containing amino groups on the surface were obtained.

[0093] HSP treatment: PLGA particles were suspended in anhydrous acetonitrile at a concentration of 10 mg / mL, HSP was added (final concentration was 15 mM), the reaction temperature was 25°C, the reaction lasted for 6 hours, and then washed with distilled water 3 times to obtain PLGA particles with surface carboxyl groups.

[0094] ② Binding reaction of OPG simulation sequence:

[0095] a. If the surface of PLGA particles contains amino groups (–NH2), the OPG mimetic sequence (containing the terminal carboxyl group) can be covalently linked to the surface of PLGA particles by promoting the carboxyl activation reaction using EDC / NHS (N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride / hydroxysuccinimide).

[0096] The OPG analog sequence containing a terminal carboxyl group (concentration 1 mg / mL) was dissolved in MES buffer (50 mM, pH 6.0), and EDC (final concentration 10 mM) and NHS (final concentration 5 mM) were added for activation for 15 minutes.

[0097] The activated OPG mimetic sequence solution was mixed with PLGA particles (final concentration of 10 mg / mL) and reacted at room temperature (25°C) for 6 hours under shaking. The particles were washed three times with PBS buffer (pH 7.4) to remove unbound OPG mimetic sequences, and the modified particles were collected after centrifugation.

[0098] b. If the surface of PLGA particles contains carboxyl groups (–COOH), they can form amide bonds through a similar EDC / NHS reaction with the OPG sequence (containing an amino group at the end).

[0099] The terminal amino-containing OPG analog sequence (concentration 1 mg / mL) was dissolved in MES buffer (50 mM, pH 6.0), and EDC (final concentration 10 mM) and NHS (final concentration 5 mM) were added for activation for 15 minutes.

[0100] The activated PLGA particles (final concentration of 10 mg / mL) were mixed with the OPG mimic sequence solution and reacted at room temperature (25°C) for 6 hours under shaking. The particles were washed three times with PBS buffer (pH 7.4) and the modified particles were collected after centrifugation.

[0101] ③ Binding efficiency and modification amount:

[0102] The number of OPG mimic sequences bound to the surface of each PLGA particle:

[0103] a. Assuming the nanoparticle diameter is 200 nm, the surface area is about 1.26×10 -13 cm 2 .

[0104] b. About 1-10 molecules can be bound to each square nanometer of the surface (the specific binding amount depends on the surface group density and reaction efficiency), and about 1000-10,000 OPG simulation sequence molecules can be bound to the surface of a single particle.

[0105] (2) Mannose modified ligand:

[0106] Using a chemical cross-linking method, mannose molecules were covalently linked to the surface of PLGA particles to enhance their binding ability to the macrophage CD206 receptor.

[0107] ① PLGA particle surface modification with amino or carboxyl groups:

[0108] Use hydroxypropanesulfonic acid (HSP) or similar surface modifiers to generate reactive groups (such as amino groups – NH2).

[0109] ② Chemical cross-linking method of mannose modification:

[0110] a. Mannose molecules form a covalent bond through their terminal hydroxyl group (–OH) and the amino group (–NH2) or carboxyl group (–COOH) modified on the surface of PLGA particles (final concentration of 10 mg / mL).

[0111] b. Use borate chemical crosslinkers, such as boric acid-EDC / NHS crosslinking system, to stably covalently link mannose to the surface of PLGA particles. The reaction conditions are: pH 6-7, reaction temperature 25°C, and time 4 hours.

[0112] The amount of cross-linking agent used: the molar ratio of EDC to NHS was 1:2, and the molar ratio of mannose to the cross-linking agent (the sum of EDC and NHS) was 1:1.5.

[0113] Mannose concentration: The concentration of mannose solution is 5 mg / mL.

[0114] Mannose binding efficiency in the reaction: Each PLGA particle can be modified with about 500-5000 mannose molecules, and the binding amount can be determined by infrared spectroscopy or HPLC.

[0115] 4. Construction of the outer protective shell

[0116] (1) Synthesis of hyaluronic acid derivatives:

[0117] The HDA-modified hyaluronic acid derivative is prepared by reacting hyaluronic acid with hexamethylenediamine hydrochloride. The degree of modification is controlled within the range of 10-20% (i.e., about 10-20 out of every 100 hyaluronic acid monomers are connected with hexamethylenediamine groups) to ensure good stability and binding ability. The specific process is as follows:

[0118] Hyaluronic acid (HA) was reacted with hexamethylenediamine hydrochloride (HDA·HCl) to prepare HDA-modified hyaluronic acid (HA-HDA).

[0119] ① Reaction solvent: dissolve hyaluronic acid in MES buffer (50 mM) at pH 5.5 to prepare a 1% (w / v) hyaluronic acid solution;

[0120] ② Activator: Add EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide) and NHS (N-hydroxysuccinimide) to activate the carboxyl group of HA. The molar ratio of EDC to NHS is 1:2, and the molar ratio of EDC to HA is 1:1;

[0121] ③ Adding ratio: Add HDA·HCl, and control the degree of modification according to the molar ratio of HA monosaccharide unit to hexamethylenediamine hydrochloride of 10:1-20:1;

[0122] ④ Reaction time and temperature: Stir the reaction at room temperature (25°C) for 4 hours;

[0123] ⑤ Purification: Remove unreacted reagents by dialysis (dialysis bag molecular weight cutoff is 10 kDa, dialysate is deionized water at pH 7.0, 48 hours).

[0124] Under the above conditions, the degree of hexamethylenediamine modification of hyaluronic acid can be controlled at 10%-20%. After the reaction is completed, the degree of modification is verified by infrared spectroscopy or nuclear magnetic resonance.

[0125] (2) Outer coating:

[0126] The synthesized HDA-modified hyaluronic acid solution is added dropwise to the aqueous phase of the PLGA nanoparticles to form the outer protective shell of the nanoparticles through self-assembly or chemical cross-linking. The specific process is as follows:

[0127] ①Concentration of HDA modified hyaluronic acid solution:

[0128] Prepare a 1 mg / mL HA-HDA solution (calculated based on the mass of HA), ensuring that its molecular weight is suitable for coating the nanoparticles (preferably 10-50 kDa HA).

[0129] ②Requirements for the amount of addition:

[0130] a. The amount of HDA-modified hyaluronic acid added should be 10%-20% (v / v) of the total volume of the nanoparticle solution to avoid excessive addition leading to particle agglomeration;

[0131] b. 50-100 μg of HA-HDA should be added to every 1 mg of PLGA nanoparticles to ensure uniform coating and form a stable outer protective shell.

[0132] ③Coating method:

[0133] a. Slowly add the HA-HDA solution to the aqueous phase of the PLGA nanoparticles through a microdropper (stirring rate 300 rpm) to ensure uniform dispersion;

[0134] b. Self-assembly conditions: Stir the reaction at room temperature (25°C) for 1 hour to form a stable coating layer through electrostatic interaction and hydrogen bonding;

[0135] c. Chemical cross-linking selection: If the coating stability needs to be enhanced, glutaraldehyde (0.1%-0.5% v / v) can be further added, and the cross-linking time is controlled within 15 minutes to avoid excessive cross-linking affecting the activity of the surface targeting molecules.

[0136] 5. Purification and Characterization of Nanoparticles

[0137] Purification: Remove unbound ligand and excess material using dialysis or centrifugation.

[0138] Characterization: The particle size and morphology of the nanoparticles were analyzed by dynamic light scattering (DLS) and scanning electron microscopy (SEM). The efficacy of the drug loading and release characteristics were confirmed using UV-visible spectroscopy and fluorescence.

[0139] Electron microscopy:

[0140] (1) Take an appropriate amount of targeted nanoparticles and observe their morphological structure using a transmission electron microscope (TEM).

[0141] During the experiment, the nanoparticles must first be freeze-dried or ultra-thinly sliced ​​to ensure that the morphology and size of the nanoparticles remain unchanged.

[0142] (2) The treated nanoparticles were coated onto a copper grid and observed using a high-resolution transmission electron microscope.

[0143] (3) Observe the morphology, size, surface structure and possible aggregation of nanoparticles.

[0144] (4) Obtain electron microscopy images and analyze the uniformity and structural integrity of the nanoparticles ( Figure 1 ).

[0145] 6. Storage and application

[0146] The synthesized nanoparticles were stored under appropriate conditions pending further biocompatibility and targeting evaluation.

[0147] Example 2

[0148] 1. Synthesis of Core Nanoparticles

[0149] (1) PLGA (85:15) was dissolved in the organic solvent ethyl acetate at a concentration of 10 mg / mL.

[0150] (2) miR-142-3p was dissolved in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) at a concentration of 2 μg / mL and then added to the PLGA organic phase to ensure that the drug loading ratio (miR-142-3p) was 1:100 (molar ratio of PLGA to miR-142-3p) to ensure an optimal balance between loading amount and release rate.

[0151] (3) The above solution was added dropwise at a rate of 1 mL / min into 10 mL of surfactant (polyethylene glycol-modified polyvinyl alcohol (PEG-PVA), concentration of 1% (w / v)) aqueous phase (pre-cooled to 4°C to increase particle uniformity) while stirring at 1000 rpm to form colostrum.

[0152] (4) The product was further emulsified by ultrasonic probe (20 kHz, 60 W power, 10 s intermittent ultrasound, lasting for 2 min) to form a uniform nanoemulsion.

[0153] (5) The emulsion was placed on a rotary evaporator at 300 rpm and 25° C. to evaporate the organic solvent until solidified nanoparticles were formed.

[0154] (6) After nanoparticle preparation, unencapsulated miR-142-3p was removed by ultracentrifugation (30,000 g, 4°C, 20 min), and the particles were washed three times with sterile PBS.

[0155] Packaging steps and precautions:

[0156] ① Evenly mix the miR-142-3p solution and the PLGA organic solution, and then encapsulate according to the emulsion method operation steps.

[0157] ② Maintain low temperature (4°C) in the aqueous phase to avoid miR degradation, and use nitrogen to protect the environment during the evaporation of organic solvents to reduce the risk of miR oxidation.

[0158] 2. Modification of targeting ligands

[0159] (1) Osteopeptide modification:

[0160] On the surface of PLGA particles, the OPG analog sequence is covalently bound through a chemical reaction (such as a cross-linking reaction). The specific process is as follows:

[0161] ①Active groups modified on the surface of PLGA particles:

[0162] Amino groups (–NH2) or carboxyl groups (–COOH) are introduced on the surface of PLGA particles as active sites, and 1,6-hexanediol diisocyanate (HMDI) is usually used for surface activation.

[0163] HSP treatment: PLGA particles were suspended in anhydrous acetonitrile at a concentration of 10 mg / mL, HSP was added (final concentration was 15 mM), the reaction temperature was 25°C, the reaction lasted for 6 hours, and then washed with distilled water 3 times to obtain PLGA particles with surface carboxyl groups.

[0164] ② Binding reaction of OPG simulation sequence:

[0165] The amide bond is formed by a similar EDC / NHS reaction with an OPG sequence (containing a terminal amino group).

[0166] The OPG mimetic sequence (concentration 1 mg / mL) was dissolved in MES buffer (50 mM, pH 6.0), and EDC (final concentration 10 mM) and NHS (final concentration 5 mM) were added for activation for 15 minutes.

[0167] The activated PLGA particles (final concentration of 10 mg / mL) were mixed with the OPG mimic sequence solution and reacted at room temperature (25°C) for 6 hours under shaking. The particles were washed three times with PBS buffer (pH 7.4) and the modified particles were collected after centrifugation.

[0168] (2) Mannose modified ligand:

[0169] Using a chemical cross-linking method, mannose molecules were covalently linked to the surface of PLGA particles to enhance their binding ability to the macrophage CD206 receptor.

[0170] ① PLGA particle surface modification with carboxyl groups:

[0171] Hydroxypropanesulfonic acid (HSP) was used to generate reactive groups.

[0172] ② Chemical cross-linking method of mannose modification:

[0173] a. Mannose molecules formed a covalent bond through their terminal hydroxyl group (–OH) and the carboxyl group (–COOH) modified on the surface of PLGA particles (final concentration was 10 mg / mL).

[0174] b. Use borate chemical crosslinkers, such as boric acid-EDC / NHS crosslinking system, to stably covalently link mannose to the surface of PLGA particles. The reaction conditions are: pH 6-7, reaction temperature 25°C, and time 4 hours.

[0175] The amount of cross-linking agent used: the molar ratio of EDC to NHS was 1:2, and the molar ratio of mannose to the cross-linking agent (the sum of EDC and NHS) was 1:1.5.

[0176] The final concentration of PLGA particles was 10 mg / mL.

[0177] Mannose concentration: The concentration of mannose solution is 5 mg / mL.

[0178] 3. Construction of the outer protective shell

[0179] (1) Synthesis of hyaluronic acid derivatives:

[0180] The HDA-modified hyaluronic acid derivative is prepared by reacting hyaluronic acid with hexamethylenediamine hydrochloride. The degree of modification is controlled within the range of 10-20% (i.e., about 10-20 out of every 100 hyaluronic acid monomers are connected with hexamethylenediamine groups) to ensure good stability and binding ability. The specific process is as follows:

[0181] Hyaluronic acid (HA) was reacted with hexamethylenediamine hydrochloride (HDA·HCl) to prepare HDA-modified hyaluronic acid (HA-HDA).

[0182] ① Reaction solvent: dissolve hyaluronic acid in MES buffer (50 mM) at pH 5.5 to prepare a 1% (w / v) hyaluronic acid solution;

[0183] ② Activator: Add EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide) and NHS (N-hydroxysuccinimide) to activate the carboxyl group of HA. The molar ratio of EDC to NHS is 1:2, and the molar ratio of EDC to HA is 1:1;

[0184] ③ Adding ratio: Add HDA·HCl, the molar ratio of HA monosaccharide unit to hexamethylenediamine hydrochloride is 15:1;

[0185] ④ Reaction time and temperature: Stir the reaction at room temperature (25°C) for 4 hours;

[0186] ⑤ Purification: Remove unreacted reagents by dialysis (dialysis bag molecular weight cutoff is 10 kDa, dialysate is deionized water at pH 7.0, 48 hours).

[0187] (2) Outer coating:

[0188] The synthesized HDA-modified hyaluronic acid solution was added dropwise to the aqueous phase of PLGA nanoparticles (concentration of 10 mg / mL) to form the outer protective shell of the nanoparticles by self-assembly or chemical cross-linking. The specific process is as follows:

[0189] ①Concentration of HDA modified hyaluronic acid solution:

[0190] A 1 mg / mL HA-HDA solution was prepared (calculated based on the mass of HA) to ensure that its molecular weight was suitable for coating the nanoparticles (50 kDa HA).

[0191] ②Requirements for the amount of addition:

[0192] The amount of HDA-modified hyaluronic acid added should be 10% (v / v) of the total volume of the nanoparticle solution to avoid excessive addition leading to particle agglomeration;

[0193] ③Coating method:

[0194] a. Slowly add the HA-HDA solution to the aqueous phase of the PLGA nanoparticles through a microdropper (stirring rate 300 rpm) to ensure uniform dispersion;

[0195] b. Self-assembly conditions: Stir the reaction at room temperature (25°C) for 1 hour to form a stable coating layer through electrostatic interaction and hydrogen bonding;

[0196] 4. Purification and Characterization of Nanoparticles

[0197] Purification: Remove unbound ligand and excess material using dialysis or centrifugation.

[0198] Characterization: Dynamic light scattering (DLS) and scanning electron microscopy (SEM, see Figure 1 ) were used to analyze the particle size and morphology of the nanoparticles. The effectiveness of the drug loading and release characteristics were confirmed using UV-visible spectroscopy and fluorescence.

[0199] Example 3 Small animal imaging results show that Dir-labeled nanoparticles target bone tissue

[0200] 1. Nanoparticle Labeling

[0201] When preparing targeted nanoparticles, the nanoparticles are labeled using a surface modification technique containing a dye such as Dir. Dir (DiR, a near-infrared fluorescent dye) is used to label nanoparticles so that their distribution in the body can be tracked by imaging technology.

[0202] 2. Animal Model Establishment

[0203] 2.1 Select a mouse model and perform standard anesthesia and treatment on it to ensure the safety and comfort of the animals during the experiment.

[0204] 2.2 Create bone damage in small animals or simulate bone tissue damage by local injection as a model for nanoparticle targeted therapy, with 5 cases in each experimental group and control group.

[0205] 3. Nanoparticle Injection

[0206] The Dir-labeled targeted nanoparticles were injected intravenously into the small animals, and the injection time and dose were recorded.

[0207] (1) Injection dose:

[0208] The experimental group was injected with Dir-labeled targeted nanoparticles prepared in Example 2, with an injection dose of 10 mg / kg (calculated based on the mouse body weight), dissolved in PBS, and the total injection volume did not exceed 10% of the mouse body weight (e.g., the injection volume for a 20 g mouse was 200 μL). The control group was injected with the same volume of PBS.

[0209] (2) Injection frequency:

[0210] Single injection for observing targeting performance.

[0211] (3) Duration of drug use before imaging:

[0212] After intravenous injection, the nanoparticles need to be distributed and targeted to bone tissue in the body, and imaging can be performed after 6 hours.

[0213] 4. Imaging Operation

[0214] 4.1 Use a near-infrared imaging system for real-time imaging to record the distribution of nanoparticles in small animals.

[0215] 4.2 When imaging, set appropriate parameters (excitation wavelength: 760 nm; emission wavelength: 800–850 nm; exposure time: 2 seconds; resolution: 1.0 cm; laser power: medium intensity; image acquisition frequency: 3 times; imaging depth: 2.5 cm; image format: TIFF; background subtraction: automatic) to ensure that the Dir fluorescence signal can be clearly captured, and focus on observing the fluorescence signal in the bone tissue area.

[0216] 5. Results Analysis

[0217] 5.1 Analyze the imaging results and compare the enrichment of nanoparticles in bone tissue with the distribution in other tissues to confirm the targeting effect of nanoparticles in bone tissue.

[0218] 5.2 Evaluation of the targeting of nanoparticles in bone tissue based on fluorescence intensity ( Figure 2 ).

[0219] Example 4 Angiogenesis Experiment

[0220] 1. Cell culture:

[0221] HUVECs were cultured in a medium containing 10% fetal bovine serum (FBS) and 1% antibiotics (such as penicillin / streptomycin) at 37°C and 5% CO2 until the cells reached 80% confluence.

[0222] 2. Preparation of Matrigel matrix:

[0223] On ice, add pre-cooled Matrigel (a matrix used to simulate cell growth) to a 96-well plate, 50 μL per well, and then place the 96-well plate in a 37°C incubator for 30 minutes until the Matrigel solidifies into a thin film.

[0224] 3. Cell processing:

[0225] HUVECs in the logarithmic phase were taken, washed with PBS, collected and cultured at an appropriate cell density (1×10 4 cells / well) were seeded into Matrigel-coated 96-well plates.

[0226] 4. Add the processed material:

[0227] The bone tissue targeted nanoparticles prepared in Example 2 (experimental group, final concentration of 50 μg / mL) or PBS (control group) were added to each well and cultured for 24 hours.

[0228] 5. Tube formation observation:

[0229] After 24 hours, the angiogenesis morphology of HUVECs in each well was observed under a microscope. The effect of nanoparticles on angiogenesis was evaluated based on the formation of tubular structures.

[0230] 6. Tube analysis:

[0231] The images of angiogenesis were taken under a microscope, and the length of the tubes, the number of branches, and the formation of the reticular structure were calculated using image analysis software (ImageJ) to evaluate the angiogenesis ( Figure 3 ), the results showed that nanoparticles can promote angiogenesis.

[0232] Example 5 Immunofluorescence experiment

[0233] 1. Cell culture:

[0234] THP-1 cells were taken and stimulated with PMA (12-O-tetradecanoylphorbol-13-acetate) at an appropriate concentration for 4-6 hours to induce THP-1 cells to differentiate into macrophages.

[0235] 2. Cell processing:

[0236] The differentiated macrophages were cultured at 1×10 6 The cells were seeded into 6-well plates at a concentration of 1.5 cells / mL and cultured for 24 hours until the cells reached 80% confluence.

[0237] 3. Add nanoparticles treatment:

[0238] The bone tissue targeted nanoparticles prepared in Example 2 (experimental group, final concentration of 50 μg / mL) or PBS (control group) were added to the cell culture medium and culture was continued for 24 hours.

[0239] 4. Immunofluorescence staining:

[0240] 4.1 After the culture, the cells were washed with PBS and fixed in 4% paraformaldehyde solution for 15 minutes.

[0241] 4.2 Wash with PBS three times, add 1% Triton X-100 solution, and permeabilize for 10 minutes.

[0242] 4.3 Wash with PBS, add anti-Arg1 antibody (1:200) and incubate overnight at 4°C.

[0243] 4.4 On the next day, wash with PBS, add fluorescently labeled secondary antibody (1:500), and continue incubation for 1 hour.

[0244] 4.5 Wash with PBS for 3 times, and finally add DAPI staining and incubate for 5 minutes.

[0245] 5. Immunofluorescence observation:

[0246] The labeling of M2 macrophages was observed using a fluorescence microscope. The fluorescence intensity and number of Arg1-positive cells can characterize the proportion of M2 macrophages.

[0247] 6. Data Analysis:

[0248] Immunofluorescence images were taken under a microscope to evaluate the changes in the number and fluorescence intensity of Arg1-positive (M2 macrophage marker) cells in the nanoparticle group compared with the control group (PBS), and to analyze the effects of nanoparticles on macrophage polarization ( Figure 4 ), the results showed that the nanoparticles prepared in Example 1 can promote the polarization of M2 macrophages (Arg1+).

[0249] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for preparing nanoparticles targeting bone tissue macrophages, characterized in that: The preparation method comprises the following steps: (1) Synthesis of core nanoparticles ① Dissolve PLGA in an organic solvent to a final concentration of 8-12 mg / mL; ② miR-142-3p was dissolved in a buffer solution at a concentration of 1.5-2.5 μg / mL, and then added to the PLGA organic phase, with a molar ratio of PLGA to miR-142-3p of 0.5-1.5:95-105; the miR-142-3p sequence is shown in SEQ ID NO.1; ③ Add the above solution dropwise into the aqueous phase containing the surfactant while stirring to form colostrum; ④Further emulsification through ultrasound to form a uniform nanoemulsion; ⑤Remove the organic solvent until solidified nanoparticles are formed; (2) Modification of targeting ligands A. Osteopeptide modification: ①Active groups modified on the surface of PLGA particles: HMDI treatment: PLGA particles are suspended in an organic solvent at a concentration of 8-12 mg / mL, HMDI is added to a final concentration of 8-12 mM, the reaction temperature is 28-32°C, and the reaction is carried out for 3-5 hours to finally obtain PLGA particles containing amino groups on the surface; Or HSP treatment: suspend PLGA particles in an organic solvent at a concentration of 8-12 mg / mL, add HSP to a final concentration of 14-16 mM, react at a temperature of 24-26°C, react for 5-7 hours, and finally obtain PLGA particles containing carboxyl groups on the surface; ② Binding reaction of OPG simulation sequence: The OPG simulation sequence is dissolved in a buffer solution to a final concentration of 0.8-1.2 mg / mL, and EDC and NHS are added to a final concentration of 8-12 mM and 4-6 mM, respectively, and activated for 10-20 minutes; the OPG simulation sequence is shown in SEQ ID NO.2; The activated OPG analog sequence solution was mixed with PLGA particles, the final concentration of PLGA particles was 8-12 mg / mL, reacted at room temperature for 5-7 hours, and the modified particles were collected after centrifugation; B. Mannose modified ligands: ① PLGA particle surface modification with amino or carboxyl groups: ② Chemical cross-linking method of mannose modification: The concentration of mannose solution is 4-6 mg / mL; The amount of PLGA particles added was 8-12 mg / mL; Amount of cross-linking agent used: the molar ratio of EDC to NHS is 0.8-1.2:1.5-2.5, and the molar ratio of mannose to the sum of the cross-linking agent EDC and NHS is 0.5-1.5:1-2; Reaction conditions: pH 6-7, reaction temperature 24-26°C, time 3-5 hours; (3) Construction of the outer protective shell A. Synthesis of Hyaluronic Acid Derivatives: ① Dissolve hyaluronic acid in a pH 4-6 buffer to prepare a hyaluronic acid solution with a w / v of 0.8-1.2%; ② Add EDC and NHS, the molar ratio of EDC to NHS is 0.5-1.5:1.5-2.5, and the molar ratio of EDC to hyaluronic acid is 0.8-1.2:0.8-1.2; ③ Adding ratio: HDA·HCl is added to obtain HDA-modified hyaluronic acid, and the molar ratio of hyaluronic acid monosaccharide unit to hexamethylenediamine hydrochloride is 10:1-20:1 to control the degree of modification; ④React at room temperature for 3-5 hours; B. Outer coating: ①Concentration of HDA modified hyaluronic acid solution: Prepare 0.8-1.2 mg / mL HA-HDA solution, wherein the molecular weight of the hyaluronic acid is 10-50 kDa; ②Requirements for the amount of addition: The amount of HDA-modified hyaluronic acid added is 10%-20% of the total volume of the PLGA nanoparticle solution; the concentration of the PLGA nanoparticle solution is 8-12 mg / mL; ③Coating method: a. Slowly add the HA-HDA solution to the PLGA nanoparticle aqueous phase while stirring; b. Self-assembly conditions: react at room temperature for 0.5-1.5 hours to form a stable coating layer.

2. The preparation method according to claim 1, characterized in that: In the step (1), PLGA is dissolved in an organic solvent to a final concentration of 10 mg / mL.

3. The preparation method according to claim 2, characterized in that: In the step (1), the molar ratio of PLGA to miR-142-3p is 1:

100.

4. The preparation method according to claim 3, characterized in that: When HMDI or HSP is used for treatment in step (2), the concentration of PLGA particles after being suspended in an organic solvent is 10 mg / mL.

5. The preparation method according to claim 4, characterized in that: In the step (2), HMDI is added to a final concentration of 10 mM, and HSP is added to a final concentration of 15 mM.

6. The preparation method according to claim 5, characterized in that: In the step (2), the OPG analog sequence is dissolved in a buffer solution to a final concentration of 1 mg / mL, and EDC and NHS are added to final concentrations of 10 mM and 5 mM, respectively.

7. The preparation method according to claim 6, characterized in that: In the step (2), the concentration of mannose solution is 5 mg / mL; the amount of PLGA particles added is 10 mg / mL; the amount of crosslinking agent used: the molar ratio of EDC to NHS is 1:2, and the molar ratio of mannose to the sum of the crosslinking agents EDC and NHS is 1:1.

5.

8. The preparation method according to claim 7, characterized in that: In the step (3), the molar ratio of EDC to NHS is 1:2, and the molar ratio of EDC to hyaluronic acid is 1:

1.

9. Nanoparticles targeting bone tissue macrophages prepared by the preparation method according to any one of claims 1 to 8.

10. Use of the nanoparticles according to claim 9 in the preparation of bone damage repair products.

Images