Application of BCL2 in resisting hepatitis B virus

Abstract

The invention discloses an application of BCL2 in resisting hepatitis B virus. Researches find that expression of HBsAg can be remarkably reduced by overexpressing BCL2 in liver cancer cells; the invention reports the effect of the BCL2 in resisting hepatitis B virus and the action mechanism of the BCL2 in inhibiting HBsAg for the first time, a new drug development target is provided, the BCL2 can be used as a new HBV host limiting factor, and a foundation is laid for the development of novel antiviral drugs.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to the application of BCL2 in anti-hepatitis B virus. Background Art

[0002] Hepatitis B virus (HBV) infection is prevalent worldwide. HBV infection may also lead to related diseases such as liver failure, cirrhosis or hepatocellular carcinoma (HCC). After HBV infection, a variety of different viral particles are produced; among them, subviral particles (SVP), also known as hepatitis B surface antigen (HBsAg) particles, are extremely over-secreted compared to infectious hepatitis B virus particles, which can exceed the former by more than 10,000 times. SVP is considered to be a decoy for the immune system, which can deplete B and T cell responses, thereby contributing to the persistence of viral infection.

[0003] Covalently closed circular DNA (cccDNA) is the source of HBV replication and the cause of chronic infection. After cccDNA is formed, it will exist in the form of free chromosome-like viral minichromosomes and be modified by host histones (such as H3 and H4 histones) and non-histone proteins (such as viral HBx, core protein and host epigenetic related proteins). Currently, the most widely used antiviral drugs in clinical practice are nucleoside analogs, which can effectively prevent the production of infectious viruses, but have little effect on cccDNA and hepatitis B virus surface antigen, and have limited effect on the development of hepatocellular carcinoma. Another type of drug, interferon, has serious side effects in treatment, and very few people can achieve clinical cure (or functional cure) within a limited course of treatment.

[0004] Clinically, the disappearance of HBsAg and the appearance of anti-HBs antibodies indicate durable immune control or functional cure of HBV infection. Therefore, the elimination of HBsAg through treatment is considered to be the key to restoring the host antiviral immune response and achieving functional cure of chronic hepatitis B. In order to overcome the limitations of nucleoside analogs and interferons and achieve functional cure of chronic hepatitis B, we need to find new therapeutic strategies to continuously inhibit viral replication and loss of HBsAg and ultimately achieve functional cure.

[0005] B-cell lymphoma-2 (BCL2) is an oncogene that has a significant inhibitory effect on cell apoptosis, and some studies in recent years have begun to reveal the mechanism of this effect. Overexpression of BCL2 has been widely described in different types of malignant tumors and is associated with tumor formation, progression, treatment resistance and poor overall survival. It is worth noting that although negative expression of BCL2 in breast cancer is considered a sign of good chemotherapy response in patients, studies have shown that overexpression of BCL2 is a good prognostic factor in patients with other types of colorectal cancer, renal cancer and advanced non-small cell lung cancer. Therefore, under the premise of different diseases, different stages of the disease and different treatment methods, the relationship between the expression of BCL2 and prognosis is still a question worth exploring. At present, there are no reports on the relationship between BCL2 and hepatitis B virus. Summary of the invention

[0006] The purpose of the present invention is to provide the application of BCL2 in anti-hepatitis B virus in view of the above problems.

[0007] In order to achieve its purpose, the present invention adopts the following technical solution:

[0008] The first aspect of the present invention provides the use of BCL2 in any of the following:

[0009] (1) Application of BCL2 as a drug target in screening or preparing drugs against hepatitis B virus or inhibiting hepatitis B surface antigen;

[0010] (2) Application of BCL2 as a drug target in screening or preparing drugs for treating diseases associated with hepatitis B virus infection;

[0011] (3) Use of BCL2 in the preparation of drugs for resisting hepatitis B virus or inhibiting hepatitis B surface antigen or treating diseases related to hepatitis B virus infection;

[0012] (4) Application of BCL2 as a host restriction factor for hepatitis B virus;

[0013] The diseases associated with hepatitis B virus infection include hepatitis B, fatty liver, cirrhosis and liver cancer.

[0014] The drug is selected from one of the following: a drug using BCL2 protein, or its encoding gene, or a biological material containing its encoding gene as an active ingredient; a drug used to overexpress intrahepatic BCL2 or increase the expression level of intrahepatic BCL2.

[0015] The biological material includes a recombinant vector containing the BCL2 gene and a recombinant cell line.

[0016] The second aspect of the present invention provides the use of a substance targeting BCL2 in the preparation of a drug for resisting hepatitis B virus or inhibiting hepatitis B surface antigen or treating diseases related to hepatitis B virus infection.

[0017] In any of the above application technical solutions, the drug inhibits HBsAg by inhibiting HBV transcription. In any of the above application technical solutions, the drug promotes the expression of BCL2.

[0018] The third aspect of the present invention provides a drug inhibitor for inhibiting hepatitis B surface antigen or hepatitis B virus, wherein the active ingredient of the drug inhibitor comprises BCL2 protein, or its encoding gene, or its encoding gene mutant, or a biological material containing its encoding gene or its encoding gene mutant.

[0019] The drug inhibitor, wherein the biological material is selected from one of the following: a recombinant plasmid expressing BCL2, an adeno-associated virus expressing BCL2, and a lentivirus expressing BCL2.

[0020] The drug inhibitor, the BCL2 is human BCL2, and its coding sequence is shown in SEQ ID NO.19.

[0021] The drug inhibitor, preferably, the encoding gene mutant is BCL2 with a BH4 region deletion, and its encoding sequence is shown in SEQ ID NO.20.

[0022] The beneficial effects of the present invention are:

[0023] The present invention has found that overexpression of BCL2 in liver cancer cells can significantly reduce the expression of HBsAg; the present invention is the first to report the role of BCL2 in anti-hepatitis B virus and its mechanism of action in inhibiting HBsAg, providing a new drug development target. BCL2 can be used as a new HBV host restriction factor, laying the foundation for the development of new antiviral drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The results are shown in Figure 2. HBsAg expression was detected after overexpression of BCL2 in HepG2 cells.

[0025] Figure 2 The results are shown in Figure 2. HBsAg expression was detected after overexpression of BCL2 in Huh7 cells.

[0026] Figure 3 It is the detection of HBsAg expression after liver cancer cells are transfected with recombinant plasmids with different domain deletions or mutations of BCL2.

[0027] Figure 4This is the result of detecting the effects of BCL2 and BCL2-ΔBH4 on HBs RNA. DETAILED DESCRIPTION

[0028] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0029] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0030] The sources of the main reagent materials used in the examples of the present invention are as follows:

[0031] 2× PrimeSTARMax Premix: Takara, Japan;

[0032] Gel recovery kit, plasmid mini-extraction kit: Magen, China;

[0033] HiBiT Lytic Detection System: Promega, USA;

[0034] BsmBI, Tango buffer, DTT: Thermo scientific company, USA;

[0035] ATP, T7 ligase: New England Biolabs, USA;

[0036] III1st Strand cDNA Synthesis SuperMix: Yisheng Biotechnology Co., Ltd., China;

[0037] ChamQ Universal SYBR qPCR Master Mix: Nanjing Novozymes Biotech Co., Ltd., China;

[0038] HBV surface antigen and E antigen detection kits: Shanghai Kehua Bioengineering Co., Ltd., China;

[0039] DH5α: Solarbio, China;

[0040] Lipo8000 transfection reagent: Biotech, China;

[0041] Trypsin, DMEM medium, PBS, Opti-MEM, penicillin-streptomycin: Gibco, USA;

[0042] Fetal bovine serum: Lonsera, Uruguay;

[0043] Plasmid template: pCH9 / 3091 preserved in our laboratory is a plasmid containing the HBV1.1 ploid genome driven by the CMV promoter, which was constructed by the Nassal laboratory of the University of Freiburg, Germany.

[0044] S-HiBiT plasmid: A simple and effective HBsAg characterization model that our research team has successfully constructed in the early stage (see Chinese patent application CN202311448773.1, publication number CN 117503772A, invention name: Compounds that inhibit hepatitis B surface antigen and their applications).

[0045] The sequences of the amplification primers used in the examples of the present invention are shown in Table 1 below:

[0046] Table 1. Primer sequences used in the examples of the present invention

[0047] Primer Name Primer Sequence (5’-3’) SEQ ID NO F amp TGCGTCCGTCTCCTTCGTTCCACTGAGCGTCAGA SEQ ID NO.1 R amp GCTGACCGTCTCTCGAAAACTCACGTTAAGGGAT SEQ ID NO.2 F delHA ACGTCTCTGGAATTCCACCACACTGGAAA SEQ ID NO.3 R HA-VECT TCGTCTCTATGGTGGCCTCGAGTCTAGAG SEQ ID NO.4 R BCLdBH4 TCGTCTCTCATCGTACCCTGTTCTCCCAGCGTG SEQ ID NO.5 F BCLdBH4 ACGTCTCTGATGCGGGAGATGTGGGCGCC SEQ ID NO.6 R BCLdTM TCGTCTCTATCAAACAGAGGCCGCATGCT SEQ ID NO.7 F BCLdTM ACGTCTCTTGATGCCTATCTGGGCCACAAGT SEQ ID NO.8 F BCLdBH3 TCGTCTCTTACCGCCGCGACTTCGCCGAG SEQ ID NO.9 R BCLdBH3 ACGTCTCTGGTACACAGGTGGCACCGGGCTGAG SEQ ID NO.10 F BCLdBH1 TCGTCTCTGTCATGTGTGTGGAGAGCGTC SEQ ID NO.11 R BCLdBH1 ACGTCTCTTGACCTCCACCACCGTGGCAAAGCG SEQ ID NO.12 F BCLdBH2 TCGTCTCTCGGCCCCAGCATGCGGCCTCT SEQ ID NO.13 R BCLdBH2 ACGTCTCTGCCGTGCAGGTGCCGGTTCAGGTA SEQ ID NO.14 F BCLG101V ACGTCTCTCCGTCGACGACTTCTCCCGCCG SEQ ID NO.15 R BCLG101V TCGTCTCTACGGCCTGGCGGAGGGTCAGGT SEQ ID NO.16 FBCL2 TCGTCTCTGGGTGCGCACGCTGGGAGAACAGGG SEQ ID NO.17 RBCL2 TCGTCTCTCTTACTTGTGGCCCAGATAGGCACC SEQ ID NO.18

[0048] Example 1

[0049] 1 Experimental methods

[0050] 1.1 Cell culture and transfection methods

[0051] HepG2 and Huh7 cell lines were cultured in DMEM medium containing 10% fetal bovine serum in an incubator containing 5% CO2 and 37°C. TM Transfection is performed according to the instructions of the transfection reagent.

[0052] 1.2 Construction of BCL2-related plasmids

[0053] The BCL2 gene sequence is as follows (SEQ ID NO.19):

[0054] .

[0055] Plasmid BCL2 and expression plasmids of BCL2 sequences with different domain deletions or mutations were constructed and used to transfect liver cancer cells to study the key domains of BCL2 inhibiting HBsAg. The constructed plasmids are as follows:

[0056] (1) Construction of plasmid BCL2:

[0057] Using the Pch9 / 3091 plasmid as a template, primers Famp+R HA-VECT were used to amplify fragment 1, primers Ramp+F delHA were used to amplify fragment 2, and HepG2 cell cDNA was used as a template, primers FBCL2+RBCL2 were used to amplify fragment 3. Fragments 1, 2, and 3 were digested and connected using the Golden Gate cloning method, and the resulting plasmid was named plasmid BCL2.

[0058] (2) Construction of plasmid BCL2-ΔBH4:

[0059] Using plasmid BCL2 as a template, Famp+R BCLdBH4 was used to amplify fragment 4, and Ramp+F BCLdBH4 was used to amplify fragment 5. Fragments 4 and 5 were digested and ligated using the Golden Gate cloning method to obtain plasmid BCL2-ΔBH4.

[0060] The sequence of the BCL2 gene after deleting the BH4 region (BCL2-ΔBH4 gene) is as follows (SEQ ID NO.20):

[0061] (3) Construction of plasmid BCL2-ΔTM:

[0062] Using plasmid BCL2 as a template, Famp+R BCLdTM was used to amplify fragment 6, and Ramp+F BCLdTM was used to amplify fragment 7. Fragments 6 and 7 were digested and connected using the Golden Gate cloning method to obtain plasmid BCL2-ΔTM.

[0063] (4) Construction of plasmid BCL2-ΔBH4-ΔTM:

[0064] Using BCL2-ΔBH4 as a template, Famp+R BCLdTM was used to amplify fragment 8, and Ramp+F BCLdTM was used to amplify fragment 9. Fragments 8 and 9 were digested and ligated using the Golden Gate cloning method to obtain the plasmid BCL2-ΔBH4-ΔTM. (5) Construction of BCL2-ΔBH4-ΔBH3:

[0065] Using BCL2-ΔBH4 as a template, Famp+R BCLdBH3 was used to amplify fragment 10, and Ramp+F BCLdBH3 was used to amplify fragment 11. Fragments 10 and 11 were digested and ligated using the Golden Gate cloning method to obtain the plasmid BCL2-ΔBH4-ΔBH3.

[0066] (6) Construction of BCL2-ΔBH4-ΔBH1

[0067] Using BCL2-ΔBH4 as a template, Famp+R BCLdBH1 was used to amplify fragment 12, and Ramp+F BCLdBH1 was used to amplify fragment 13. Fragments 12 and 13 were digested and ligated using the Golden Gate cloning method to obtain the plasmid BCL2-ΔBH4-ΔBH1.

[0068] (7) Construction of BCL2-ΔBH4-ΔBH2

[0069] Using BCL2-ΔBH4 as a template, Famp+R BCLdBH2 was used to amplify fragment 14, and Ramp+F BCLdBH2 was used to amplify fragment 15. Fragments 14 and 15 were digested and ligated using the Golden Gate cloning method to obtain the plasmid BCL2-ΔBH4-ΔBH2.

[0070] (8) Construction of BCL2-ΔBH4-ΔBH1-ΔBH2

[0071] Using BCL2-ΔBH4-ΔBH1 as a template, Famp+R BCLdBH2 was used to amplify fragment 16, and Ramp+F BCLdBH2 was used to amplify fragment 17. Fragments 16 and 17 were digested and ligated using the Golden Gate cloning method to obtain the plasmid BCL2-ΔBH4-ΔBH1-ΔBH2.

[0072] (9) Construction of BCL2-TM

[0073] Using BCL2-ΔBH4-ΔBH1-ΔBH2 as a template, Famp+R BCLdBH3 was used to amplify fragment 18, and Ramp+FBCLdBH3 was used to amplify fragment 19. Fragments 18 and 19 were digested and connected using the Golden Gate cloning method to obtain plasmid BCL2-TM.

[0074] (10) Construction of BCL2-G101V

[0075] Using BCL2 as a template, Famp+R BCLG101V was used to amplify fragment 20, and Ramp+F BCLG101V was used to amplify fragment 21. Fragments 20 and 21 were digested and connected using the Golden Gate cloning method to obtain plasmid BCL2-G101V.

[0076] The PCR reaction system was as follows: 10 ng of plasmid as template, 0.4 μl of primers F (10 μM) / R (10 μM), 10 μl of 2× PrimeSTAR Max Premix, and sterile ultrapure water to make up the volume to 20 μl. Reaction conditions: 98°C pre-denaturation for 2 min; 98°C for 10 s, 55°C for 5 s, 72°C for 30 s, 35 cycles. The amplified fragment was recovered using a gel recovery kit and the concentration was measured.

[0077] The reaction system of Golden gate ligation reaction is: Tango buffer 1μl, DTT 1μl, ATP 1μl, BsmBI enzyme 0.75μl, T7 DNAligase 0.25μl, each fragment to be connected. The amount of each fragment to be added is calculated according to the concentration (ng / μl) recovered by Kb*20 / Gel, and sterilized ultrapure water is added to 10μl. Reaction conditions: 37℃5min, 20℃5min, 25 cycles, 80℃20min inactivation reaction. The Golden gate ligation product is transformed into DH5α competent bacteria, plated, and a single colony is picked for culture. The bacterial solution is sequenced and identified, and the bacterial solution with correct sequencing is selected for extraction to obtain the target plasmid.

[0078] 1.3 Detection of HBsAg and HBeAg

[0079] The protein levels of HBsAg and HBeAg in the cell culture supernatant were detected according to the operating instructions of the enzyme-linked immunosorbent assay kit (Kehua).

[0080] 1.4 Detection of HiBiT luciferase

[0081] according to The fluorescence value in the cell lysate was detected according to the operating instructions of HiBiT Lytic Detection System (Promega, USA).

[0082] 1.5 CCK8 assay for cytotoxicity

[0083] The effect of overexpression of BCL2 on cell activity was detected according to the CCK-8 kit operating instructions.

[0084] 1.6 Western blot detection

[0085] 72 hours after cell transfection, wash twice with PBS, add 50ul RIPA lysis buffer and protease inhibitor to each well (taking 24-well plate cells as an example), lyse on ice for 30 minutes, extract total cell protein, and determine protein concentration by BCA method. Take an equal amount of total cell protein and denature at 100℃ for 10 minutes. Separate the protein in 12.5% ​​SDS-PAGE, transfer to the membrane, block with skim milk for 1 hour, then replace with primary antibody, and incubate overnight at 4℃ shaker. Wash 3 times with TBS-T the next day, 10 minutes each time. Then add secondary antibody, incubate at room temperature on a shaker for 1 hour, wash 3 times with TBS-T, and then develop with ECL.

[0086] 1.7 RNA extraction and real-time fluorescence quantitative PCR

[0087] Taking 12-well plate cells as an example, wash the cells twice with PBS, add 1 ml Trizol lysis buffer, lyse at room temperature for 10 minutes, add 200 μl chloroform, shake thoroughly and mix, carefully pipette the supernatant into a new EP tube, add an equal volume of isopropanol, shake thoroughly and mix, centrifuge at 4°C, 13,000 g for 10 minutes, discard the supernatant, add 500 μl 75% ethanol to wash the precipitate, centrifuge at 4°C, 13,000 g for 10 minutes, discard the supernatant and dry the RNA precipitate, add 20 μl water to dissolve, measure the concentration and use Yisheng Company Ⅲ1st Strand cDNA Synthesis SuperMix reverse transcribed RNA to synthesize cDNA. The next step was QPCR reaction, using 2 -ΔΔCt Methods The relative expression levels were calculated.

[0088] 2 Experimental results

[0089] 2.1 Overexpression of BCL2 in HepG2 and Huh7 cells can inhibit HBsAg

[0090] First, in order to verify the effect of BCL2 on HBsAg, we co-transfected HepG2 cells with BCL2 plasmid and S-HiBiT plasmid. The control group was co-transfected with empty vector and S-HiBiT plasmid. After 48 hours, the cell supernatant was collected to detect the level of HiBiT in the cell culture supernatant. After 72 hours, the total protein in the cells was extracted for Western blot to detect the level of HBsAg protein in the cells. The luciferase results showed that BCL2 could reduce the activity of HiBiT in a concentration gradient-dependent manner. When the concentration of BCL2 plasmid was 300 ng, the activity of HiBiT could be inhibited to 4.7%. Western blot results showed that BCL2 significantly inhibited the expression of HBsAg protein ( Figure 1A, C). To further confirm the inhibitory effect of BCL2 on HBsAg, we co-transfected the BCL2 plasmid with the HBV1.3 plasmid in HepG2 cells. The control group was co-transfected with the empty vector and HBV1.3. After 48 hours, the cell supernatant was collected and HBsAg and HBeAg were determined by ELISA. After 72 hours, the total intracellular protein was extracted for Western blot to detect the intracellular HBsAg protein level. The results showed that BCL2 also significantly inhibited the levels of HBsAg and HBeAg proteins, and the effect was dose-dependent. Western blot results showed that when the BCL2 plasmid concentration was 300 ng, the expression of HBsAg protein was almost completely inhibited ( Figure 1 B and C). In order to detect whether the transfection of plasmid BCL2 produces cytotoxicity, we detected cell viability by CCK8 method. The results showed that compared with the empty vector, transfection of different concentrations of BCL2 had almost no effect on cell viability ( Figure 1 D). The above results indicate that overexpression of BCL2 in HepG2 cells and Huh7 cells can inhibit HBsAg protein.

[0091] To further confirm the inhibitory effect of BCL2 on HBsAg, we conducted a validation study in liver cancer cells Huh7 from different sources. Figure 2 ) showed that with the increase of BCL2 concentration, HiBiT activity, HBsAg and HBeAg levels in cell culture supernatant and HBsAg protein level in cell lysate were significantly inhibited, and the effect was dose-dependent.

[0092] 2.2TM region is the key domain of BCL2 in inhibiting HBsAg

[0093] To clarify the functional domain of BCL2, primers were designed based on the BCL2 gene sequence in the NCBI gene library. Using molecular cloning technology, BCL2 sequences with different domain deletions or mutations were cloned into the downstream of the CMV-IE promoter using the PCH9 / 3091 plasmid ( Figure 3 A). These plasmids and empty vector were co-transfected with S-HiBiT into HepG2 cells, and the cell supernatant was collected 48 hours later to detect the HiBiT level in the cell culture supernatant. The results showed that the removal of the TM region of BCL2 partially inhibited the effect of BCL2, while the removal of the BH4 region could enhance the effect of BCL-2, and the inhibition rate of HiBiT activity was as high as 99% ( Figure 3B, C). Then, BCL2 and BCL2-ΔBH4 were co-transfected with HBV1.3 in HepG2 cells, and the control group was co-transfected with empty vector and HBV1.3. After 48 hours, the cell supernatant was collected, and the levels of HBsAg and HBeAg were detected by ELISA. After 72 hours, the total protein in the cells was extracted for Western blot to detect the level of HBsAg protein. The results showed that BCL2-ΔBH4 was better than BCL2 in inhibiting HBsAg, HBeAg in the cell supernatant and HBsAg protein in the cells. Figure 3 D, E, F), it was concluded that the TM region was the key structural domain of BCL2 in inhibiting HBsAg, and the removal of the BH4 region could enhance the effect of BCL2.

[0094] 2.3BCL2-ΔBH4 can inhibit HBs RNA levels

[0095] In order to study the mechanism of BCL2 inhibition of HBsAg, we detected the effects of BCL2 and BCL2-ΔBH4 on HBs RNA. RT-QPCR analysis confirmed that BCL2 significantly inhibited HBs RNA levels, and the inhibition rate of BCL2-ΔBH4 on HBs RNA was about 99% ( Figure 4 A). In order to clarify whether BCL2 inhibits HBs RNA by inhibiting transcription or promoting RNA degradation, we detected the effect of BCL2-ΔBH4 on HBV mRNA stability. Actinomycin D can inhibit transcription by specifically inhibiting RNA transcriptase II and is often used to study mRNA stability. BCL2-ΔBH4 was overexpressed in HepG2 cells, and then actinomycin D was added to block transcription. Cells were collected at different time points after actinomycin D treatment, total RNA in the cells was extracted, and changes in HBV mRNA were detected by real-time quantitative PCR. The results showed that compared with the control group, overexpression of BCL2-ΔBH4 did not affect the degradation rate of HBV mRNA ( Figure 4 B). This suggests that BCL2-ΔBH4 may affect HBsAg by affecting the production of HBV RNA.

[0096] Based on the above research results, the present invention provides for the first time the role of BCL2 gene in inhibiting hepatitis B virus, and provides a new potential antiviral drug that inhibits HBsAg by inhibiting HBV transcription, which has broad application prospects.

Claims

1. Application of BCL2 in any of the following: (1) Application of BCL2 as a drug target in screening or preparing drugs against hepatitis B virus or inhibiting hepatitis B surface antigen; (2) Application of BCL2 as a drug target in screening or preparing drugs for treating diseases associated with hepatitis B virus infection; (3) Use of BCL2 in the preparation of drugs for resisting hepatitis B virus or inhibiting hepatitis B surface antigen or treating diseases related to hepatitis B virus infection; (4) Application of BCL2 as a host restriction factor for hepatitis B virus; The diseases associated with hepatitis B virus infection include hepatitis B, fatty liver, cirrhosis and liver cancer.

2. The use according to claim 1, characterized in that: The drug is selected from one of the following: a drug using BCL2 protein, or its encoding gene, or a biological material containing its encoding gene as an active ingredient; a drug used to overexpress intrahepatic BCL2 or increase the expression level of intrahepatic BCL2.

3. The use according to claim 2, characterized in that: The biological material includes a recombinant vector containing the BCL2 gene and a recombinant cell line.

4. Use of substances targeting BCL2 in the preparation of drugs for resisting hepatitis B virus or inhibiting hepatitis B surface antigen or treating diseases related to hepatitis B virus infection.

5. The use according to any one of claims 1 to 4, characterized in that: The drug inhibits HBsAg by inhibiting HBV transcription.

6. The use according to any one of claims 1 to 4, characterized in that: The drug promotes the expression of BCL2.

7. A drug inhibitor for inhibiting hepatitis B surface antigen or hepatitis B virus, characterized in that: The active ingredient of the drug inhibitor comprises BCL2 protein, or its encoding gene, or its encoding gene mutant, or biological material containing its encoding gene or its encoding gene mutant.

8. The drug inhibitor according to claim 7, characterized in that The biological material is selected from one of the following: a recombinant plasmid expressing BCL2, an adeno-associated virus expressing BCL2, and a lentivirus expressing BCL2.

9. The drug inhibitor according to claim 7, characterized in that The BCL2 is human BCL2, and its coding sequence is shown in SEQ ID NO.

19.

10. The drug inhibitor according to claim 7, characterized in that The coding gene mutant is BCL2 with a BH4 region deletion, and its coding sequence is shown in SEQ ID NO.20.

Images