Application of circular RNA Circ3426 as colorectal cancer diagnostic marker and therapeutic target

Abstract

The invention discloses application of annular RNACirc3426 as a diagnostic marker and a therapeutic target of colorectal cancer. Experiments show that the Circ3426 is highly expressed in colorectal cancer cells and patient serum, and prove that the Circ3426 has good stability, and an ROC curve shows that the Circ3426 has good capacity of diagnosing colorectal cancer. Meanwhile, it is found that the molecule can promote migration and invasion ability of colorectal cancer cells, nude mouse subcutaneous tumor formation experiments prove that knock-down Circ3426 inhibits growth of tumors, and it is indicated that the molecule can serve as a treatment target of colorectal cancer. The invention provides a new diagnostic marker and a treatment target for colorectal cancer, and provides a new thought and direction for CRC diagnosis and treatment.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and specifically to the application of circular RNA Circ3426 as a diagnostic marker and therapeutic target for colorectal cancer. Background Art

[0002] Colorectal cancer (CRC) is one of the common malignant tumors in the world. There are no obvious symptoms in the early stage of colorectal cancer, so its early diagnosis is the difficulty and hotspot of current research. The current clinical diagnosis of CRC mainly relies on imaging, but its early sensitivity is low and it cannot effectively judge the patient's status. In addition, CEA, CA19-9 and other cancer markers are commonly used, but their specificity and sensitivity are not satisfactory. Therefore, there is an urgent need to find new and effective diagnostic biomarkers.

[0003] On the other hand, due to the lack of effective diagnostic markers, most CRC patients have missed the best treatment period and entered the late stage. For advanced colorectal cancer, traditional treatments (surgery, chemotherapy and radiotherapy) are ineffective and prone to recurrence and metastasis. Targeted therapy, especially anti-vascular therapy, has improved the treatment effect to a certain extent, but there are still toxic side effects and drug resistance. It is still necessary to further find new therapeutic targets for colorectal cancer.

[0004] Our previous studies have found that JAG2, a ligand of the NOTCH signaling pathway, is not only an important invasive molecule for colorectal cancer, but also promotes angiogenesis and vascular mimicry in colorectal cancer. Based on this, we designed a JAG2-related gene chip to find non-coding RNAs that can regulate CRC angiogenesis. Circular RNAs (CircRNAs) are a special type of non-coding RNA that is formed by reverse splicing of gene introns or exons. Because they do not have the 3' and 5' ends of linear RNA, they are highly stable and conserved. In recent years, more and more data have shown that CircRNAs are associated with the progression and angiogenesis of CRC, and studies have found that CircRNAs are abnormally expressed in the blood / serum, cells, CRC tissues, and exosomes of CRC patients. These characteristics make CircRNAs potential markers for CRC diagnosis and prognosis, as well as potential therapeutic targets. Summary of the invention

[0005] The purpose of the present invention is to address the above problems and provide an application of circular RNA Circ3426 as a diagnostic marker and therapeutic target for colorectal cancer.

[0006] In order to achieve its purpose, the present invention adopts the following technical solution:

[0007] A first aspect of the present invention provides use of a reagent for detecting a biomarker in a sample in the preparation of a product for diagnosing colorectal cancer, wherein the biomarker is Circ3426.

[0008] In the above-mentioned application technology scheme, the expression level of Circ3426 in patients is upregulated compared with normal controls.

[0009] In the above-mentioned application technology scheme, the content of Circ3426 in the patient's test sample is obtained by total RNA extraction, reverse transcription, and quantitative PCR detection; the test sample is preferably a serum sample.

[0010] The second aspect of the present invention provides the use of a Circ3426 expression inhibitor in the preparation of a drug for preventing and treating colorectal cancer.

[0011] The Circ3426 expression inhibitor includes siRNA.

[0012] The sequence of the siRNA is:

[0013] Sense strand sequence: 5'-GUCCAGAGAGAACUCAACA-3',

[0014] Antisense strand sequence: 5′-UGUUGAGUUCUCUCUGGAC-3′.

[0015] The third aspect of the present invention provides the use of Circ3426 as a target in screening drugs for treating colorectal cancer.

[0016] The drug inhibits the expression of Circ3426.

[0017] The transcribed nucleotide sequence of Circ3426 is shown in SEQ ID NO.11.

[0018] The beneficial effects of the present invention are:

[0019] The present invention determines the target molecule Circ3426 through gene chip, bioinformatics and RT-qPCR analysis, verifies the cyclic characteristics and stability of Circ3426 by Sanger sequencing, RNase R digestion experiment and actinomycin D tolerance experiment; clarifies the effect of Circ3426 on CRC growth and metastasis function through in vitro functional test; and verifies in vivo that knocking down Circ3426 inhibits tumor growth through nude mouse subcutaneous tumor formation experiment. The present invention provides a new diagnostic marker and therapeutic target for colorectal cancer, and provides new ideas and directions for CRC treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1A heat map of endothelial cell sequencing genes is shown, demonstrating differentially expressed CircRNAs.

[0021] Figure 2 The expression of Circ3426 in CRC cell lines (HCT116, Caco2 and SW480) detected by qRT-PCR is shown.

[0022] Figure 3 The expression of Circ3426 in CRC tissues was analyzed using the GEO database.

[0023] Figure 4 It shows that Circ3426 can be used as a serum diagnostic marker for colorectal cancer: AB, qRT-PCR detection of Circ3426 expression in serum; C, ROC curve of Circ3426 expression in serum of patients with colorectal cancer.

[0024] Figure 5 A schematic diagram of the circular structure of Circ3426 and the back-splicing site of Circ3426 verified by Sanger sequencing are shown.

[0025] Figure 6 Agarose gel electrophoresis confirming the circular nature of Circ3426 is shown.

[0026] Figure 7 The stability of Circ3426 was verified by actinomycin D treatment.

[0027] Figure 8 Verification of the stability of Circ3426 for RNase R digestion.

[0028] Fig. 9 The results of Transwell chamber experiments are shown, and knockdown of Circ3426 inhibits the invasion and migration ability of colorectal cancer cells.

[0029] Fig.10 It shows that targeting Circ3426 can be used as a therapeutic target for colorectal cancer: photos and weights of tumors in each group in the subcutaneous tumor formation experiment; immunohistochemical Ki67 staining to compare the proliferation of cancer cells in each group, and CD31 staining to represent angiogenesis (brown-red circles represent blood vessels). DETAILED DESCRIPTION

[0030] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0031] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0032] The present invention screened differentially expressed circRNAs related to the oncogene JAG2 by using a human umbilical vein endothelial cell (HUVEC) gene chip, and identified Circ3426 (hsa_circ_0003426) which was significantly highly expressed in colorectal cancer. On the basis of preliminarily determining its oncogene role, it was found that Circ3426 was significantly highly expressed in the serum of CRC patients compared with normal physical examination population and colorectal polyp patients; the sequence of Circ3426 was verified by Sanger sequencing, and the stability of Circ3426 was verified by RNase R digestion experiment and actinomycin D treatment experiment; the migration and invasion ability of colorectal cancer cells (SW480 and Caco2 cells) knocked down by Circ3426 was significantly reduced by transwell experiment; the knockdown of Circ3426 was verified by nude mouse subcutaneous tumor formation experiment in vivo, and the knockdown of Circ3426 was proved to inhibit the growth of colorectal cancer cells and angiogenesis in vivo. The results show that Circ3426 can be used as an in vitro diagnostic marker for colorectal cancer. Targeting Circ3426 can inhibit the progression and metastasis of colorectal cancer.

[0033] The specific research process is as follows:

[0034] Example 1

[0035] 1 Experimental Materials

[0036] 1.1 Cell culture

[0037] Human Umbilical Vein Endothelial Cells (HUVEC), human CRC cell lines SW480, Caco2, HCT116, Lovo and normal colorectal epithelial NCM460 were obtained from the Key Laboratory of the Ministry of Education, School of Laboratory Medicine, Chongqing Medical University. All cells were cultured in DMEM / high glucose medium (gbico, Thermo Fisher, USA) containing 10% serum (LONSA SCIENCESRL, Uruguay) at 37°C, 5% CO2 and saturated humidity.

[0038] 1.2 Experimental animals

[0039] All animal-related experiments in this study were approved by the Medical Ethics Committee of Chongqing Medical University.

[0040] BALB / c nude mice (female, four-week-old) were purchased from Beijing Huafukang Biotechnology Co., Ltd. and housed under specific pathogen-free (SPF) conditions at the Animal Center of Chongqing Medical University.

[0041] 1.2.1 Experimental Grouping

[0042] Mice were randomly divided into 2 groups: control group si NC and experimental group si circ, 5 mice in each group. They were raised under the same conditions without restriction of diet or other conditions.

[0043] 1.2.2 Subcutaneous tumor formation experiment

[0044] After the mice were adapted to the feeding environment for 1 week, 4×10 6 SW480 cells were suspended in 100 μL serum-free DMEM and injected subcutaneously into the left forelimb axilla of each mouse. The daily changes in the status of mice in each group and the growth of tumors were observed. After 15 days, the mice were killed by cervical dislocation, and the tumors were removed to measure the volume and weight.

[0045] 1.2.3 Immunohistochemical staining

[0046] All removed tumor samples were completely fixed with 4% paraformaldehyde and further subjected to immunohistochemical staining, which was performed by Sichuan Chengdu Lilaijianuo Biotechnology Co., Ltd. Measurements were performed using Image J software (National Institutes of Health, Bethesda, MD, USA).

[0047] 2 Experimental methods

[0048] 2.1 Bioinformatics analysis

[0049] The expression levels of Circ3426 in colorectal cancer tissues and control adjacent cancer tissues were obtained through the GEO website (https: / / www.ncbi.nlm.nih.gov / geo / ) database dataset (GSE235850).

[0050] 2.2 Extraction of cellular RNA and serum RNA

[0051] RNA was extracted from SW480 colorectal cancer cells and Caco2 colorectal cancer cells when the cells grew to 80%-90%. The RNA was extracted using the SteadyPure Quick Extraction Kit (Accurate Biotechnology, China). According to the instructions of the reagent product, total cellular RNA was extracted and the RNA concentration in the solution was detected by UV spectrophotometer.

[0052] Serum RNA was extracted using the Steady Pure Blood, Serum and Plasma Small RNA Extraction kit (Accurate Biotechnology, China) according to the reagent product instructions to extract serum total RNA (including small RNA).

[0053] 2.3g DNA extraction

[0054] PureLinkTM Genomic DNA Mini Kit (Thermo Fisher, USA) was used to extract genomic DNA (gDNA) from SW480 colorectal cancer cells and Caco2 colorectal cancer cells according to the instructions of the kit.

[0055] 2.4 Reverse transcription (RT-PCR) and real-time quantitative PCR (qRT-PCR)

[0056] Evo M-MLVRT Premix (Accurate Biotechnology, China) was used to reverse transcribe mRNA into cDNA at 37°C for 15 min and 85°C for 5 s. The reverse transcription system (20 μL) is shown in Table 1:

[0057] Table 1

[0058]

[0059]

[0060] qRT-PCR was performed on Bio-Rad CFX96TM (Bio Rad, USA) using SYBR Green Premix Pro TaqHS qPCRKit (Accurate Biotechnology, China). The qRT-PCR reaction was performed at 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and primer-specific annealing temperature of 60°C for 30 s. GAPDH was used as an internal reference, and the relative quantitative value of RNA was calculated using the 2-ΔΔCt method. The qRT-PCR system (10 μL) is shown in Table 2, and the qRT-PCR primer sequences are shown in Table 3.

[0061] Table 2

[0062]

[0063] Table 3

[0064]

[0065] 2.5 Gel electrophoresis

[0066] Dissolve agar powder in 1×TAE Buffer to prepare 1% agarose gel, pour into the conical bottle mouth and put into the microwave, cook on medium-high heat until the liquid is clear, and rinse the bottle wall with running water until it is not hot to the touch. Shake the melted agar solution to mix well, insert the comb into the gel plate, pour in the agarose gel, and solidify at room temperature for about 30-40 minutes. Remove the comb, put the gel into the electrophoresis tank, pour in 1×TAE Buffer until the gel is covered, and remove the bubbles in the gel hole. For loading, add 1ul loading buffer ((GenStar, item number: E106) and 1ul dye to 5ul DNA sample, mix with a gun and add to the gel hole; adjust the voltage of the electrophoresis instrument to 120V and run for 15-30min. After the end, put the gel into the gel imager to observe the band results.

[0067] 2.6 Sanger sequencing

[0068] Gel electrophoresis of PCR amplification product of SW480 colorectal cancer cell cDNA (Circ 3426), the target molecular band was cut with a clean blade and sent for Sanger sequencing, which was completed by Shanghai Sangon Biotechnology Co., Ltd.

[0069] 2.7 Cell transfection

[0070] Circ3426-targeting si NC and si RNA were designed and synthesized by Tsingke Biotechnology (Tsingke, China). Transfection reagent GP-transfect-Mate was purchased from Gene Pharma (Gene Pharma, China).

[0071] Take the 2ml system as an example (60mm culture dish), add 200μl serum-free medium to a 1.5ml sterile centrifuge tube, add 8μl transfection reagent GP-transfect-Mate (restore to room temperature), mix gently with a pipette, and let stand at room temperature for 5min; at the same time, add 200μl serum-free medium to another 1.5ml sterile centrifuge tube, add 8μl (80nM) si NC / si RNA, mix gently with a pipette, and let stand at room temperature for 5min; add the GP-transfect-Mate medium mixture dropwise to the si NC / si RNA medium mixture, mix gently with a pipette, let stand at room temperature for 15min, and then transfect immediately. Replace the medium with complete medium 4-6h after transfection.

[0072] The siRNA sequences are shown in Table 4.

[0073] Table 4

[0074]

[0075] 2.8 RNase R digestion experiment

[0076] Total RNA (2 μg / group) was extracted from SW480 and Caco2 cells and incubated with 10 U / μg RNase R (Solarbio, China) at 37°C for 0, 10, 20, and 30 min, inactivated in a 70° metal bath for 10 min, and then qRT-PCR was used to analyze the expression changes of linear RNA (CBFA2T2) and circular RNA (Circ3426).

[0077] 2.9 Actinomycin D tolerance test

[0078] SW480 and Caco2 cells were seeded in 6-well plates. When the cell confluence reached 60%-80% on the second day, actinomycin D (MCE, USA) with a final concentration of 100 ng / ml was added for treatment for 0, 4, 8, 12, and 24 hours, respectively. Total cell RNA was extracted. qRT-PCR was used to analyze the stability of Circ3426 and CBFA2T2 mRNA.

[0079] 2.10 Transwell invasion, migration and scratch healing assays

[0080] SW480 and Caco2 cells were inoculated in 6-well plates, transfected with si NC and si circ3426 (Tsingke, China), and digested and counted after 24 hours of treatment. In the invasion experiment, 1:9 diluted Matrigel (Corning, USA) was added to the lower chamber of the 24-well plate and placed in an incubator for 1 hour to solidify. At the same time, the cells were digested and counted, and then 200 μl of 4*10 4 Serum-free medium for cells, 500 μl complete medium was added to the lower chamber, and the cells were placed in an incubator for 24-48 hours before fixation and staining to observe the number of cells. No matrix gel was required for migration experiments. After the cells were fully grown in the scratch test, a vertical scratch was made in the middle of the well plate, and the medium was replaced with serum-free medium. Photos were taken at 0, 24, and 48 hours. Measurements were performed using Image J software (National Institutes of Health, Bethesda, MD, USA).

[0081] 2.11 Statistical analysis

[0082] All experiments were repeated at least three times, and all results were expressed as mean ± standard deviation (SD). GraphPadPrism 9.5 was used for statistical analysis and graph generation. The differences between the two groups were analyzed using a two-tailed Student's t test, and * / P<0.05, ** / P<0.01, *** / P<0.001, **** / P<0.0001 were considered statistically significant.

[0083] 3 Results

[0084] 3.1Circ3426 is highly expressed in colorectal cancer cells and tissues

[0085] We first knocked down the expression of colorectal cancer invasive molecule JAG2 in vascular endothelial cells by lentivirus, and sent it for whole transcriptome sequencing to obtain related gene chips. We found that a total of 18 circRNAs were downregulated by JAG2 (P>0.05, LogFC>2.0) ( Figure 1 ). qRT-PCR was used to detect the expression of CircRNA in colorectal cancer cell lines SW480, Caco2, and HCT116, and compared with the expression in intestinal epithelial cells NCM460. It was found that Circ3426 (hsa_circ_0003426) was significantly highly expressed in colorectal cancer cells ( Figure 2 ). Then, we searched the colorectal cancer tissue sequencing chip dataset (GSE235850) on the GEO website and found that Circ3426 was highly expressed in CRC clinical tissue samples compared with adjacent tissues ( Figure 3 ). The above results suggest that Circ3426 may be an important marker for colorectal cancer.

[0086] 3.2Circ3426 can be used as a serum diagnostic marker for colorectal cancer

[0087] Given the stability of circular RNA, we wanted to explore its possibility as a serum tumor diagnostic marker. We collected serum samples from 26 physical examination subjects, 16 colorectal polyp patients, and 44 colorectal cancer patients, and detected the expression of Circ3426. We found that it was significantly highly expressed in the serum of colorectal cancer patients ( Figure 4 A), and the expression of Circ3426 increased with the increase of tumor TNM stage, suggesting that it is associated with CRC disease progression ( Figure 4 B). The ROC curve drawn based on clinical test data showed that compared with the traditional cancer marker CEA (AUC = 0.668, p = 0.081), the AUC of Circ3426 was significantly higher (AUC = 0.767, p = 0.005), indicating that Circ3426 has good specificity and sensitivity as a serum diagnostic marker for colorectal cancer, and combined diagnosis with CEA can further improve specificity and sensitivity (AUC = 0.835, p < 0.0001) ( Figure 4 C).

[0088] 3.3Circ3426 has good stability

[0089] According to the CBFA2T2 circular RNA information collected by NCBI (https: / / www.ncbi.nlm.nih.gov / ) and the authoritative circular RNA database circBase (http: / / www.circbase.org / ), chr20:32207322-32211102 of the CBFA2T2 gene formed a closed circular RNA molecule Circ3426 through head-to-tail connection. The ID in circBase is hsa_circ_0003426. Sanger sequencing verified that its base sequence and splicing site were consistent with the database annotations ( Figure 5 ). Circ3426 can only be amplified from cDNA using divergent primers, confirming its circular structure ( Figure 6 ). RNase R digestion was used ( Figure 7 ) and actinomycin D experiments ( Figure 8 ) found that as the experimental treatment time increased, Circ3426 was less susceptible to RNase degradation and had a longer half-life compared with linear mRNA (CBFA2T2), suggesting that it has good stability.

[0090] The sequence of human Circ3426 is as follows (SEQ ID NO.11):

[0091] AACTCAACAGTGACAATTGAGGAATTCCACTGTAAGCTCCAAGAAGCCACAAACTTTCCCCTTCGTCCTTTTGTGATTCCATTTCTCAAGGCCAACCTGCCCCTGCTGCAGCGGGAACTGCTGCACTGCGCTCGGG CGGCCAAGCAGACCCCATCCCAGTACCTGGCTCAGCACGAACACCTTCTGCTCAACACAAGCATTGCATCGCCTGCTGACTCGTCAGAGTTGCTCATGGAGGTGCACGGAAATGGGAAGAGGCCCAGTCCAGAGAG.

[0092] 3.4 Knockdown of Circ3426 inhibits colorectal cancer invasion

[0093] In order to explore the effect of Circ3426 on the migration and invasion of colorectal cancer cells, a Transwell chamber migration and invasion assay was performed and it was found that knockdown of Circ3426 significantly inhibited the migration and invasion of CRC cells SW480 and Caco2, and the number of CRC cells crossing the chamber membrane was significantly reduced ( Fig. 9 ).

[0094] 3.5 Targeting Circ3426 can be used as a therapeutic target for colorectal cancer

[0095] SW480 cells with Circ3426 knockdown were injected into the subcutaneous part of the left forelimb axilla of 4-5-week-old nude mice. The mice were killed by cervical dislocation on the 15th day, and then the samples were collected, photographed, weighed, and fixed. The tumor size of mice in the Circ3426 knockdown group was significantly smaller than that in the control group, and the tumor weight was also lighter. Immunohistochemical staining was performed on each group, and the Circ3426 knockdown group significantly inhibited the proliferation ability of tumor cells Ki67, and the expression of angiogenesis marker CD31 was less ( Fig.10 ).

Claims

1. Use of a reagent for detecting biomarkers in a sample in the preparation of a product for diagnosing colorectal cancer, characterized in that: The biomarker is Circ3426.

2. The use according to claim 1, characterized in that: Compared with normal controls, the expression level of Circ3426 was upregulated in patients.

3. The use according to claim 2, characterized in that: The content of Circ3426 in the patient's test sample is obtained by total RNA extraction, reverse transcription, and quantitative PCR; the test sample is preferably a serum sample.

4. Application of Circ3426 expression inhibitors in the preparation of drugs for the prevention and treatment of colorectal cancer.

5. The use according to claim 4, characterized in that: The Circ3426 expression inhibitor includes siRNA.

6. The use according to claim 5, characterized in that: The sequence of the siRNA is: Sense strand sequence: 5'-GUCCAGAGAGAACUCAACA-3', Antisense strand sequence: 5′-UGUUGAGUUCUCUCUGGAC-3′.

7. Application of Circ3426 as a target in screening drugs for the treatment of colorectal cancer.

8. The use according to claim 7, characterized in that: The drug inhibits the expression of Circ3426.

9. The use according to any one of claims 1 to 8, characterized in that: The transcribed nucleotide sequence of Circ3426 is shown in SEQ ID NO.11.

Images