KASP molecular marker for watermelon leaf included angle character and application of KASP molecular marker

Abstract

The invention discloses a KASP molecular marker for a watermelon leaf included angle character and application of the KASP molecular marker. According to the obtained KASP marker MLA of the watermelon leaf included angle character regulating gene, a novel and simple molecular marker and an auxiliary selection method are provided, and the molecular marker and the auxiliary selection method are suitable for rapid screening of the relative height of the watermelon leaf included angle and molecular marker auxiliary breeding. The MLA molecular marker can detect genotypes of materials with different leaf included angles in a natural population, can also be used for molecular-assisted selective breeding of watermelon materials with different leaf included angles, replaces large-scale phenotypic screening, reduces the field workload, and greatly improves the screening accuracy and efficiency.

Description

Technical Field

[0001] The invention belongs to the technical field of vegetable agronomic trait molecular marker development and molecular marker-assisted breeding, and is specifically applicable to the KASP molecular marker of watermelon leaf angle trait and its application. Background Art

[0002] Watermelon (Citrullus lanatus) is an important cash crop with a wide cultivation area and significant economic benefits. my country is an important watermelon producer and consumer in the world. In recent years, my country's watermelon industry has developed rapidly, and its area and output have ranked first in the world for many years (Yu Jiaqing, Xia Yong. Current situation, problems and suggestions of my country's watermelon industry [J]. Modern Agriculture. 2024(05):25-27.). According to statistics from the Food and Agriculture Organization of the United Nations, the harvested area and output of watermelons in my country in 2022 were 1.384 million hm2 respectively. 2 2017 and 2018,000 tons, accounting for 47.46% and 60.41% of the world respectively.

[0003] Leaf angle is a general term for the angle of the leaf away from the main stem, and is one of the important agronomic traits. In climbing watermelon cultivation, the leaf angle is the angle between the leaf and the ground (the plane where the main stem is located). Leaf angle can increase crop yield by improving the photosynthesis efficiency of the group and promoting high-density planting (Lee EA, Tollenaar M. Physiological basis of successful breeding strategies for maize grain yield. Crop Sci. 2007; 47: S202-S215.). Photosynthesis is the process by which organisms convert light energy into chemical energy. It is also an important factor in the yield of melon crops, affecting the yield and quality of crops (Chen, J.; Huang, Y.; Liu, X.; Chen, G.; Liu, L.; Cheng, Z.; Song, W.; Han, L.; Wang, S.; Wang, L.; et al. CsIAGLU Regulates the Angle of Leaf Petiole by Affecting Endogenous Content of Auxin in Cucumber (Cucumis sativus L.). Genes 2022, 13, 2216.). Upright leaves enable crops to capture more light, while reducing mutual shading of leaves, increasing light transmittance, increasing photosynthetic area, and reducing sunlight reflectivity. In addition, densely planted crops have a higher leaf area index, all of which help to improve crop photosynthesis efficiency. Higher photosynthesis efficiency is more conducive to the accumulation of watermelon dry matter, thereby improving the quality and yield of watermelon. In actual greenhouse production, photosynthetic production and dry matter accumulation are the core parts of the watermelon growth and development model (Xu Gang, Guo Shirong, Zhang Changwei, et al. Simulation model of photosynthetic production and dry matter accumulation of small watermelons in greenhouse [J]. Journal of Fruit Science, 2005, (02): 129-133.). Therefore, a higher leaf angle has great potential value in actual production. By breeding high leaf angle watermelon varieties, further improving the yield per unit area of ​​watermelon is an important direction for watermelon breeding in my country.

[0004] There are many factors that can increase the yield per unit area of ​​watermelon. In production, watermelon yields are increased through high-yield varieties, cultivation measures (grafting, pruning, etc.), scientific fertilization, and other methods, but this also increases production costs. Therefore, cultivating and promoting new varieties of high-leaf angle watermelon is the most environmentally friendly way to solve this problem. However, the lack of efficient and accurate phenotypic evaluation technology for measuring the height of watermelon leaf angles and molecular markers available for breeding have seriously restricted the progress of molecular breeding of watermelon with high leaf angles. Summary of the invention

[0005] The present invention aims to address the deficiencies in the prior art and provides a KASP molecular marker for a watermelon leaf angle trait and its use. The molecular marker MLA (Markers of watermelon high leaf angles) obtained by the present invention is a molecular marker tightly linked to the watermelon leaf angle trait and can be used for screening watermelon materials with different leaf angles and auxiliary selection breeding of their offspring.

[0006] In order to realize the screening function, the present invention provides a KASP molecular marker for locating the watermelon leaf angle trait gene based on BSA mixed pool sequencing for identifying different watermelon leaf angles. The molecular marker MLA is a SNP mutation marker located at 4950696bp of chromosome 1 of the watermelon genome, and the sequence of the previous and next 50bp is shown in SEQ ID NO.1 or SEQ ID NO.2.

[0007] The KASP molecular marker genotype is C or T; the sequence of 50 bp before and after the C genotype is shown in SEQ ID NO.1, and the corresponding phenotype is a low leaf angle type; the sequence of 50 bp before and after the T genotype is shown in SEQ ID NO.2, and the corresponding phenotype is a high leaf angle type.

[0008] TTCTTTATTTCTTTTTTTCGATATTATTGGGGTGGGGATTGAACCTCGATCTATGTTG TGTACGCATTTATGTTATTTATGTTTTTTACCCTAAGGTTTA(SEQ ID NO.1)

[0009] TTCTTTATTTCTTTTTTTCGATATTATTGGGGTGGGGATTGAACCTCGATTTATGTTG TGTACGCATTTATGTTATTTATGTTTTTTACCCTAAGGTTTA(SEQ ID NO.2)

[0010] In addition, the present invention also provides a KASP molecular marker MLA primer combination for identifying the watermelon leaf angle trait, and the nucleotide sequence thereof is 5'-3':

[0011] Forward Primer (F-HEX):

[0012] GAAGGTGACCAAGTTCATGCTGGTGGGGATTGAACCTCGATT(SEQ ID NO.3)

[0013] Forward Primer (F-FAM):

[0014] GAAGGTCGGAGTCAACGGATTGGTGGGGATTGAACCTCGATC(SEQ ID NO.4)

[0015] Reverse primer (R):

[0016] CGTATCCCTCTAAACCTTAGGGTAA(SEQ ID NO.5)

[0017] The invention also provides a use of a KASP molecular marker for the watermelon leaf angle trait, which is used for molecular assisted selection breeding of watermelon materials with different leaf angles or their progeny.

[0018] The present invention also provides a method for developing a KASP molecular marker for the watermelon leaf angle trait, comprising the following steps:

[0019] (1) Using high leaf angle watermelon material ZJU87 and low leaf angle watermelon material ZJU87 as parents for hybridization and then self-pollination, a population of F2 recombinant inbred lines with leaf angle trait segregating was obtained;

[0020] (2) The genomic DNA of watermelon parents and hybrid offspring F2 populations was extracted by the CTAB (hexadecyl trimethyl ammoniumbromide) method;

[0021] (3) Select materials with extreme leaf angle phenotypes in the F2 population to construct high leaf angle and low leaf angle mixed pools, and use BSA segregant analysis (Bulked Segregant analysis) to locate genes related to the leaf angle trait;

[0022] (4) Identify SNP variants and InDel insertion / deletion variants that are closely linked to the watermelon leaf angle trait;

[0023] (5) Based on linkage variation, the molecular markers for watermelon leaf angle trait were screened by KASP (competitive allele specific polymerase chain reaction) method;

[0024] (6) A KASP molecular marker MLA that is tightly linked to the watermelon leaf angle trait was developed.

[0025] The specific method of using the above molecular markers to identify watermelon materials with different leaf angles is:

[0026] (1) Polymorphism analysis of molecular markers in high leaf angle material ZJU87, low leaf angle material ZJU165 and their progeny populations:

[0027] The KASP molecular marker was designed and developed to detect the polymorphism of parent materials with different leaf angles and their offspring genotypes. The KASP molecular marker primer combination consists of forward primers F-HEX, F-FAM and reverse primer R. Remarks: The primers (molecular markers) were synthesized by Shanghai Sangon Biotechnology Co., Ltd. and amplified on an ABI Step One PCR instrument.

[0028] The PCR reaction system was: 30-50 ng / μl watermelon genomic DNA 5.0 μl, KASP Master Mix 5.0 μl, KASP Assay Mix (F-HEX: F-FAM: R = 2:2:5 molar concentration ratio, primer concentrations were all 10 ng / μl) 0.14 μl, and the total volume was 10.14 μl;

[0029] The PCR reaction program was as follows: 30°C, 1 minute (reading fluorescence signal); 94°C, 15 minutes (pre-denaturation); 94°C, 20 seconds (denaturation); 61°C (-0.6°C / cycle) annealing for 60 seconds, 10 cycles; 94°C, 20 seconds (denaturation); 55°C, annealing for 60 seconds, 31-35 cycles; 30°C, 1 minute (reading fluorescence signal).

[0030] After amplification, the fluorescence signal is detected and the genotyping is analyzed. If the typing is not sufficient, the amplification can be continued, and the fluorescence signal can be read every 3 cycles to check the typing until the typing is complete.

[0031] Genotyping results Figure 1 As shown in the figure, the molecular marker can be clearly typed in watermelon materials with different leaf angles, and the corresponding genotype of the material can be determined according to the different fluorescent signals. The red point is the high leaf angle material ZJU87, which is the homozygous genotype TT, the blue point is the low leaf angle material ZJU165, which is the homozygous genotype CC, and the yellow point is F1, with a genotype of TC.

[0032] (2) The above molecular markers can be used to carry out molecular-assisted selection breeding for the high leaf angle trait of watermelon:

[0033] The KASP molecular marker designed and developed, which is closely linked to the high leaf angle trait, can be used for preliminary screening of watermelon varieties with high leaf angles, so as to achieve molecular marker-assisted breeding and accelerate the breeding process. In production, this molecular marker can also be used to detect it at the seedling stage to screen plants with high leaf angle traits, improve watermelon photosynthetic efficiency, promote dry matter accumulation, and thus increase watermelon yield per unit area. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] The specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0035] Figure 1 It is the MLA molecular marker genotyping diagram of the parent materials ZJU87 and ZJU165 of the present invention and their F1;

[0036] Figure 2 It is the MLA molecular marker genotyping diagram of the F2 generation population produced by selfing of the F1 generation population of the present invention;

[0037] Figure 3 It is the MLA molecular marker genotyping diagram of the natural population materials of watermelons with different leaf angles of the present invention;

[0038] Figure 4 It is a distribution diagram of leaf angle heights of natural populations of watermelons with different genotypes according to the present invention. DETAILED DESCRIPTION

[0039] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0040] Example 1: Location of the main QTL for watermelon leaf angle trait

[0041] ZJU87 and ZJU165 were selected from the laboratory germplasm resource bank. Both of them are parental materials with large differences in leaf angle traits. The above parents were used for hybridization and self-pollination to construct the recombinant inbred line population F2. The population was planted with seedlings and transplanted when there were 3 true leaves. After 15 days of transplantation, the vines grew to about 1m. The angle between the bottom end of the petiole of the third alternate leaf at the base of the left and right stems and the horizontal line of the ground was measured with an angle ruler.

[0042] The genomic DNA of watermelon parents and hybrid offspring F2 seedlings was extracted using the CTAB (hexadecyl trimethyl ammonium bromide) method; extreme phenotypic materials of the offspring were selected to construct a BSA mixed pool, and genome resequencing was performed. Association analysis was performed using the △SNP-index method, and a QTL related to leaf angle changes was located in the 3773610-6289054 interval on chromosome 1 with a 95% confidence interval.

[0043] Example 2: Development and verification of KASP molecular markers for watermelon leaf angle trait

[0044] According to the gene localization results in Example 1, the SNP and InDel mutations in the chromosome 1 interval of the parental materials were extracted and analyzed, and molecular markers were developed by KASP technology for fine localization.

[0045] The details are as follows:

[0046] 1. DNA Extraction

[0047] The genomic DNA of watermelon parents and their hybrid F2 populations was extracted using the CTAB method.

[0048] 2. PCR Amplification

[0049] The PCR reaction system was: 30-50 ng / μl watermelon genomic DNA 5.0 μl, KASP Master Mix 5.0 μl, KASP Assay Mix (primer concentrations were all 10 ng / μl and satisfied the molar concentration ratio of F-HEX: F-FAM: R = 2:2:5) 0.14 μl, and the total volume was 10.14 μl;

[0050] The PCR reaction program was as follows: 30°C, 1 minute (reading fluorescence signal); 94°C, 15 minutes (pre-denaturation); 94°C, 20 seconds (denaturation); 61°C (-0.6°C / cycle) annealing for 60 seconds, 10 cycles; 94°C, 20 seconds (denaturation); 55°C, annealing for 60 seconds, 31-35 cycles; 30°C, 1 minute (reading fluorescence signal).

[0051] PCR amplification was performed on the ABI Step One PCR instrument. The instrument detected the fluorescence signal and directly obtained the genotyping situation. The results were as follows: Figure 1 As shown (where the genotype of ZJU87 is TT, shown in red; the genotype of ZJU165 is CC, shown in blue; the genotype of F1 is TC, shown in green; the black cross represents a negative control with no fluorescent signal.). The software divides the test samples into homozygous TT genotype, homozygous CC genotype and heterozygous TC genotype according to different genotypes.

[0052] The forward primers F-HEX and F-FAM are respectively provided with respective fluorescent connectors (displayed in different colors on the typing diagram, for example, TT genotype is red, CC genotype is blue, and TC genotype is green). If the material being tested is a homozygous genotype, only one of the corresponding primers will be selected for amplification during amplification. The results can be displayed by fluorescence difference, and it can be distinguished whether the material being tested is a homozygous TT genotype or a CC genotype. If the material being tested is a heterozygous genotype, both primers will be amplified, and a third fluorescent signal will be generated, thereby achieving the distinction between heterozygous genotypes.

[0053] By screening molecular markers, we finally obtained the KASP molecular marker MLA which is closely linked to the watermelon leaf angle trait. The molecular marker primer combination sequence is as follows:

[0054] Forward Primer (F-HEX):

[0055] GAAGGTGACCAAGTTCATGCTGGTGGGGATTGAACCTCGATT(SEQ ID NO.3)

[0056] Forward Primer (F-FAM):

[0057] GAAGGTCGGAGTCAACGGATTGGTGGGGATTGAACCTCGATC(SEQ ID NO.4)

[0058] Reverse primer (R):

[0059] CGTATCCCTCTAAACCTTAGGGTAA (SEQ ID NO. 5).

[0060] The SNP marker is located at 4950696bp on watermelon chromosome 1. The molecular marker is a SNP mutation marker, which is divided into C genotype and T genotype. The sequence of 50bp before and after the molecular marker site is:

[0061] TTCTTTATTTCTTTTTTTCGATATTATTGGGGTGGGGATTGAACCTCGATCTATGTTG TGTACGCATTTATGTTATTTATGTTTTTTACCCTAAGGTTTA(SEQ ID NO.1)

[0062] or

[0063] TTCTTTATTTCTTTTTTTCGATATTATTGGGGTGGGGATTGAACCTCGATTTATGTTG TGTACGCATTTATGTTATTTATGTTTTTTACCCTAAGGTTTA (SEQ ID NO. 2);

[0064] Among them, SEQ ID NO.1 is C genotype, and SEQ ID NO.2 is T genotype.

[0065] according to Figure 1 As shown, the high leaf angle material ZJU87 is a homozygous TT genotype, which is shown in red in the figure; the low leaf angle material ZJU87 is a homozygous CC genotype, which is shown in blue in the figure; the F1 representative of the hybrid of ZJU87 and ZJU165 is a heterozygous TC genotype, which is shown in green in the figure.

[0066] according to Figure 2As shown (red represents the TT genotype consistent with the high leaf angle material ZJU87; blue represents the CC genotype consistent with the low leaf angle material ZJU87; green represents the TC genotype consistent with F1; the black cross represents the negative control with no fluorescent signal. The MLA molecular marker showed obvious separation in the hybrid offspring materials, indicating the reliability of the marker and can be used to screen offspring materials with different hardness.) Using MLA to perform typing in the F2 generation population, the genotype of the material corresponding to the red color of ZJU87 is TT; the genotype of the material corresponding to the blue color of ZJU165 is CC; the genotype of the material corresponding to the green color of F1 is TC.

[0067] The leaf angle of watermelon germplasm in the natural population was measured with reference to Example 1, and the detection was carried out according to the method described in Example 2 and the developed molecular markers. The results of the natural population are shown in Table 1.

[0068] like Figure 3 (Red indicates the TT genotype consistent with the high leaf angle material ZJU87; blue indicates the CC genotype consistent with the low leaf angle material ZJU165; the black cross indicates the negative control with no fluorescent signal) and as shown in Table 1, the leaf angle and MLA molecular marker identification results of 126 watermelon germplasm natural materials are as follows:

[0069] Table 1

[0070]

[0071]

[0072]

[0073]

[0074] According to theoretical speculation, watermelons with genotype TT should be high leaf angle materials, while watermelons with genotype CC should be low leaf angle materials. The theoretical results are basically consistent with the measured leaf angle results. MLA molecular markers can detect different genotypes of materials with different leaf angles in natural populations, further clarifying that this molecular marker can be used for molecular assisted selection breeding of watermelon materials with different leaf angles.

[0075] like Figure 4From the data analysis of Table 1, it can be seen that the results show that the leaf angle of the homozygous TT genotype watermelon is significantly higher than that of the CC genotype watermelon. There are individual watermelon materials with leaf angles greater than 60° and less than 70°, which are phenotypically similar to high leaf angles, but genotypically show low leaf angles of the CC genotype. This may be related to the fact that the leaf angle of watermelon is a quantitative trait controlled by multiple genes, and there are other genes that regulate the leaf angle of watermelon, which affect the change of the leaf angle of watermelon, or the growth process is affected by uncertain environmental factors. Therefore, the molecular markers of the present invention are mainly used for the initial screening of watermelon varieties with high leaf angles to achieve the purpose of molecular marker-assisted breeding.

[0076] Finally, the above examples are only some specific embodiments of the present invention. The present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. A KASP molecular marker for watermelon leaf angle trait, characterized in that Located at 4950696bp of chromosome 1 of the watermelon genome, the sequence of 50bp before and after is shown in SEQ ID NO.1 or SEQ ID NO.2: TTCTTTATTTCTTTTTTTCGATATTATTGGGGTGGGGATTGAACCTCGATCTATGTTG TGTACGCATTTATGTTATTTATGTTTTTTACCCTAAGGTTTA(SEQ ID NO.1) TTCTTTATTTCTTTTTTTCGATATTATTGGGGTGGGGATTGAACCTCGATTTATGTTG TGTACGCATTTATGTTATTTATGTTTTTTACCCTAAGGTTTA (SEQ ID NO. 2).

2. The KASP molecular marker according to claim 1, characterized in that The KASP molecular marker genotype is C or T; the sequence of 50 bp before and after the C genotype is shown in SEQ ID NO.1, and the corresponding phenotype is a high leaf angle type; the sequence of 50 bp before and after the T genotype is shown in SEQ ID NO.2, and the corresponding phenotype is a low leaf angle type.

3. The KASP molecular marker according to claim 1, characterized in that The KASP molecular marker MLA primer combination used to identify the leaf angle trait of watermelon, wherein the nucleotide sequence is 5'-3': The forward primer F-HEX is shown in SEQ ID NO.3: GAAGGTGACCAAGTTCATGCTGGTGGGGATTGAACCTCGATT The forward primer F-FAM is shown in SEQ ID NO.4: GAAGGTCGGAGTCAACGGATTGGTGGGGATTGAACCTCGATC The reverse primer R is shown in SEQ ID NO.5: CGTATCCCTCTAAACCTTAGGGTAA.

4. Use of the KASP molecular marker for the watermelon leaf angle trait as claimed in any one of claims 1 to 3: for molecular assisted selection breeding of watermelon materials with different leaf angles or their progeny.

5. A method for KASP molecular markers of watermelon leaf angle trait according to any one of claims 1 to 3, characterized in that: The following steps are involved: (1) Extracting genomic DNA of watermelon samples to be tested; using MLA molecular marker primer set to perform PCR amplification on watermelon genomic DNA on ABI Stepone PCR instrument; using ABI Stepone PCR instrument to detect fluorescence signals and analyze genotyping; according to the difference in fluorescence signals of PCR products, the genotype of each watermelon to be tested is identified, and homozygous TT genotype, homozygous CC genotype, and heterozygous TC genotype are identified; (2) When the typing result of the sample is consistent with the genotype TT of the high leaf angle watermelon material, the identified watermelon sample exhibits the high leaf angle trait; when the typing result of the sample is consistent with the genotype CC of the low leaf angle material, the identified watermelon sample exhibits the low leaf angle trait.

Images