Nucleic acid aptamer agonist conjugate as well as preparation method and application thereof

Abstract

The invention provides a nucleic acid aptamer agonist conjugate as well as a preparation method and application thereof. The nucleic acid aptamer agonist conjugate is prepared by coupling a nucleic acid aptamer, a connexon and an STING agonist, the nucleic acid aptamer agonist conjugate can be used as a medicine to recognize a target spot on the surface of a tumor cell in a targeted manner and enter the cell to start a cGAS-STING signal channel so as to realize an anti-tumor effect. The variety of STING agonists and the variety of connexons are also screened, so that the aptamer agonist conjugate not only has the advantages of easiness in transmembrane and cell entry, strong tumor permeability, long half-life period, small toxic and side effects and the like, but also has a strong inhibition effect on triple-negative breast cancer. The aptamer agonist conjugate can also be combined with an immune checkpoint blocking therapy to further realize long-acting and efficient inhibition of tumor growth.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a nucleic acid aptamer agonist conjugate and a preparation method and application thereof. Background Art

[0002] As the first line of defense for mammals against pathogen infection, innate immunity activates the body's immune response by inducing the release of type I interferons and proinflammatory cytokines. As a natural immune pathway in the cytoplasm, the cGAS-interferon gene stimulator protein (STING) signaling pathway plays a key role in antibacterial, antiviral and tumor immunotherapy. The activation of this pathway can simultaneously induce the body's innate immunity and acquired immunity, and play a key regulatory role in tumor antigen release and presentation, T cell activation and tumor infiltration. It can effectively reverse the immunosuppressive tumor microenvironment. At the same time, STING agonists can also promote the upregulation of PD-L1 expression. Therefore, the cGAS-STING pathway can be used as a strategy to enhance the efficacy of immune checkpoint blockade therapy while exerting anti-tumor immunity. However, due to the negatively charged phosphate groups of CDNs, it is not easy to enter cells across the membrane, cannot be administered systemically, has poor tumor penetration and a short half-life, so the clinical efficacy is poor. On the other hand, when STING agonists act indiscriminately on normal tissues and tumor tissues, they can trigger toxic side effects such as systemic cytokine storms and lead to a narrow therapeutic window. Therefore, tumor-targeted delivery of CDNs-type STING agonists is an effective strategy to solve the above problems.

[0003] Aptamers are oligonucleotide sequences that specifically bind to targets through a specific three-dimensional structure. Their targets include small molecules, proteins, cells, tissues, organs and other types. Aptamers are also called "chemical antibodies" because of their high specificity and strong affinity for binding to targets. Compared with antibodies, aptamers have diverse screening methods, simple synthesis and modification, low immunogenicity, strong target affinity and high tissue permeability, so they are also widely used in the field of targeted drug delivery. Aptamer-drug conjugates (ApDCs) constructed by aptamer-drug molecules can achieve tumor-targeted delivery of drug molecules and exhibit excellent anti-tumor efficacy through the specific recognition of aptamers and tumor cell surface receptors. With the tumor-targeting advantage of aptamers, it is expected to provide an effective solution for achieving tumor-targeted delivery of STING agonists. Summary of the invention

[0004] In view of the defects of the prior art, the present invention provides a nucleic acid aptamer agonist conjugate and its preparation method and application. The nucleic acid aptamer agonist conjugate is prepared by coupling a nucleic acid aptamer, a linker and a STING agonist. The nucleic acid aptamer agonist conjugate can be used as a drug to target and identify targets on the surface of tumor cells and activate the cGAS-STING signaling pathway to achieve anti-tumor effects. The present invention also screens the types of STING agonists and linkers, so that the nucleic acid aptamer agonist conjugate not only has the advantages of easy transmembrane entry, strong tumor permeability, long half-life, and small toxic side effects, but also has a strong inhibitory effect on triple-negative breast cancer. The nucleic acid aptamer agonist conjugate combined with immune checkpoint blockade therapy can further achieve long-term and efficient inhibition of tumor growth.

[0005] In one aspect, the present invention provides a nucleic acid aptamer agonist conjugate, comprising a nucleic acid aptamer and a STING agonist, wherein the nucleic acid aptamer and the STING agonist are coupled together via a linker.

[0006] STING agonists can activate the interferon gene stimulator (STING) signaling pathway and the body's natural immune response. They are an immunotherapy drug suitable for a variety of cancers and produce sustained anti-tumor effects. However, STING agonists undergo passive and indiscriminate diffusion in the body, causing toxic side effects such as cytokine storms when acting on normal tissues, and can induce T cell apoptosis in a type I interferon-independent manner, leading to inefficient target cell delivery. On the other hand, low doses of STING agonists can effectively inhibit tumor growth, but high doses will block CD8 ＋ The response of T cells promotes tumor growth, thus presenting a narrow therapeutic window. In particular, for cyclic dinucleotide STING agonists, due to the presence of their own negative charge, it is difficult for them to effectively enter the cell, and the tumor permeability is poor. Although intratumoral administration can improve the above problems to a certain extent, this mode of administration can only act on superficial tumors and has poor efficacy on metastatic tumors. Therefore, connecting nucleic acid aptamers to STING agonists containing linkers can provide an effective solution strategy for the above problems, but different linkers will affect the release efficiency of STING agonists. The present invention constructs a conjugate of nucleic acid aptamers and STING agonists, selects a suitable linker, effectively solves the problems of STING agonists being unstable in the internal environment, having a short half-life, and not being easy to enter tumor cells across the membrane, and successfully achieves efficient targeted delivery of STING agonists.

[0007] Furthermore, the linker includes a cleavable linker and a non-cleavable linker; the cleavable linker includes any one or more of a GSH-responsive linker, a cathepsin-responsive linker, and an acid-responsive linker.

[0008] The conjugate of the cleavable linker and the drug, after the conjugate reaches the target site, the cleavable linker utilizes the difference between the tumor microenvironment and the normal physiological environment to release the drug, and the linker is cleaved through a specific chemical reaction in the tumor microenvironment.

[0009] The conjugate of the non-cleavable linker and the drug cannot be effectively broken after the conjugate reaches the target site, resulting in the ineffective release of the STING agonist.

[0010] The team of the present invention has conducted preliminary research and found that the non-cleavable linker-coupled aptamer agonist conjugate is difficult to activate the cGAS-STING signaling pathway because it cannot effectively release the STING agonist; while the cleavable linker-coupled aptamer agonist conjugate disconnects the linker and the STING agonist through the difference between the tumor microenvironment and the normal physiological environment, has a chemical sensitive site, can effectively release the STING agonist, and has a better effect of inhibiting tumor growth. Therefore, it is preferred to use a cleavable linker for coupling. The aptamer agonist conjugate prepared by the method provided by the present invention has the advantages of strong tumor permeability, easy transmembrane entry, long half-life, systemic administration, small toxic side effects, and a wide therapeutic window.

[0011] Furthermore, the cleavable linker includes any one or more of the following structural formulas:

[0012] , , , , .

[0013] Said , It is a GSH-responsive linker, under the action of high concentration of GSH in tumor cells, the disulfide bond undergoes a reduction reaction, resulting in the cleavage of the linker to release the STING agonist; , It is a cathepsin-responsive linker, which is cleaved and cleaved by cathepsins (such as cathepsin B) in tumor cells to release the STING agonist; It is an acid-responsive linker that utilizes the acidic internal environment of tumor cells to trigger the cleavage of the linker to release the STING agonist.

[0014] In some methods, different aptamer cyclic dinucleotide agonists are formed by coupling cyclic dinucleotide agonists and Sgc8c with a cathepsin-responsive linker, a GSH-responsive linker, and an acid-responsive linker, respectively, and then the ability of the different aptamer cyclic dinucleotide agonists to induce SUM159 cells to produce CXCL-10 is detected. The test results show that the aptamer cyclic dinucleotide agonist containing a cathepsin-responsive linker has a stronger ability to induce cells to produce CXCL-10, indicating that it has a stronger ability to activate the cGAS-STING signaling pathway.

[0015] Furthermore, the cathepsin-responsive linker is preferably

[0016] .

[0017] Furthermore, the STING agonist includes one or more of cyclic dinucleotides and non-cyclic dinucleotides.

[0018] Natural cyclic dinucleotide molecules have poor stability in the body and are easily degraded by nucleases in the body, so cyclic dinucleotide analogs are designed based on their structures. The cyclic dinucleotide analogs have the same functions as natural cyclic dinucleotides.

[0019] Furthermore, the structural formula of the cyclic dinucleotide is:

[0020] ;

[0021] Among them, R 1 or R 1 ' is one of H, F, -OH, and modified -OH; B 1 is one of adenine or guanine, B2 is one of adenine or guanine; Indicates that the phosphate bond can be attached to the 2' or 3' position of the pentose, and the position that is not ringed with the phosphate is R 2 / R 2 'substituted, said R 2 / R 2 ' is one of H, F, -OH, and modified -OH; the R 3 is one of O and S; the structural formula of the acyclic dinucleotide is:

[0022] .

[0023] After each substituent in the general structural formula of the cyclic dinucleotide is substituted, its stereoisomers, tautomers, stable isotope variants, pharmaceutically acceptable salts, prodrugs or solvates can all be used as cyclic dinucleotide STING agonists.

[0024] In some embodiments, the cyclic dinucleotide agonist is 3ʹ,3ʹ-di-(2ʹ-F)-cG s A s MP-2 (F2), the structural formula of F2 is:

[0025] .

[0026] The F2 described herein replaces the phosphate group with a thiophosphate. The thiophosphate structure can effectively resist the degradation of a variety of extracellular and intracellular nucleases to increase the stability of F2 in the organism and extend its half-life.

[0027] The acyclic dinucleotide The name of the drug is MSA-2. It exists in the form of monomer and dimer interconversion in the solution. Its dimer structure binds to the STING protein in tumor cells and can activate the cGAS-STING pathway.

[0028] In some methods, experiments have shown that the ability of the conjugate of nucleic acid aptamer and non-cyclic dinucleotide agonist MSA-2 to activate the cGAS-STING signaling pathway and the anti-tumor effect are not as good as free MSA-2, and the ability of the conjugate of nucleic acid aptamer and cyclic dinucleotide agonist F2 to activate the cGAS-STING signaling pathway and the anti-tumor effect are significantly better than free F2. Therefore, the STING agonist for preparing nucleic acid aptamer agonist conjugates is preferably cyclic dinucleotide agonist F2.

[0029] Furthermore, the nucleic acid aptamer agonist conjugate comprises any one or more of the following structural formulas:

[0030] ,

[0031] ,

[0032] ,

[0033] , ,

[0034] , ,

[0035] .

[0036] In some embodiments, the structural formula of the nucleic acid aptamer agonist conjugate is preferably:

[0037] .

[0038] Furthermore, the nucleic acid aptamer targets PTK7.

[0039] Theoretically, any aptamer can be used to prepare the aptamer-agonist conjugate provided by the present invention. In order to improve the anti-tumor effect, aptamers that efficiently target tumor cells can be preferred to improve the targeted delivery effect of the agonist.

[0040] The nucleic acid aptamer is a DNA oligonucleotide sequence, and the 3′ end and / or 5′ end thereof can be coupled with the linker and STING agonist provided by the present invention through modification.

[0041] In some embodiments, the nucleic acid aptamer is Sgc8c, and the target recognized is PTK7, which is obtained by screening and optimization through exponential enrichment ligand system evolution technology (SELEX), and the sequence is: ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA. The modification of Sgc8c includes 3′-thiol modification or 3′-thiol, 5′-amino modification. The modification of Sgc8c is obtained by steps such as synthesis by DNA solid phase synthesizer, aminolysis, reduction, HPLC purification, etc. 3′-thiol modified Sgc8c can be connected to one STING agonist, while 3′-thiol, 5′-amino modified Sgc8c can be connected to two STING agonists.

[0042] The PTK7 is a cell surface transmembrane protein that is highly expressed in a variety of cancers, including triple-negative breast cancer, non-small cell lung cancer, ovarian cancer, colorectal cancer, gastric cancer, etc. Therefore, by recognizing PTK7 on the surface of the above tumor cells through Sgc8c and delivering the STING agonist to the tumor cells to exert its efficacy, it can minimize damage to normal cells, reduce side effects, and improve the treatment effect.

[0043] In another aspect, the present invention provides a method for preparing a nucleic acid aptamer agonist conjugate, the method comprising the following steps:

[0044] (1) coupling a STING agonist to a linker; the STING agonist comprises one or more of a cyclic dinucleotide and a non-cyclic dinucleotide; the linker comprises a cleavable linker and a non-cleavable linker; the cleavable linker comprises any one or more of a GSH-responsive linker, a cathepsin-responsive linker, and an acid-responsive linker;

[0045] (2) Conjugating the STING agonist containing a linker to the nucleic acid aptamer.

[0046] In some embodiments, the molar ratio of the STING agonist containing a linker to the nucleic acid aptamer in step (2) is (3-5):1.

[0047] On the other hand, the present invention provides the use of F2 for preparing a reagent for improving the anti-tumor effect of a nucleic acid aptamer agonist conjugate, wherein the structural formula of F2 is

[0048] .

[0049] In some methods, the aptamer agonist conjugate prepared from the cyclic dinucleotide agonist F2 and the aptamer agonist conjugate prepared from the non-cyclic dinucleotide agonist MSA-2 were tested for their inhibitory effects on triple-negative breast cancer. The test results showed that the inhibitory effect of the aptamer agonist conjugate containing F2 on triple-negative breast cancer was significantly stronger than that of free F2, while the inhibitory effect of the aptamer agonist conjugate containing MSA-2 on triple-negative breast cancer was significantly weaker than that of free MSA-2, indicating that preparing monomer F2 into a aptamer agonist conjugate can further improve the inhibitory effect of F2 on triple-negative breast cancer.

[0050] On the other hand, the present invention provides a composition for inhibiting tumor growth, comprising a nucleic acid aptamer agonist conjugate and a PD-1 monoclonal antibody, wherein the nucleic acid aptamer agonist conjugate is formed by coupling a nucleic acid aptamer and a STING agonist via a linker, wherein the STING agonist comprises one of a cyclic dinucleotide and a non-cyclic dinucleotide, and wherein the linker comprises a cleavable linker and a non-cleavable linker; and the cleavable linker comprises any one or more of a GSH-responsive linker, a cathepsin-responsive linker, and an acid-responsive linker.

[0051] In theory, the aptamer agonist conjugate provided by the present invention activates the cGAS-STING signaling pathway to promote the production of interferon and the activation of immune cells, and reverses the immunosuppressive tumor microenvironment. The aptamer agonist conjugate is administered in combination with PD-1 monoclonal antibody to further enhance the tumor inhibition effect. PD-1 monoclonal antibody inhibits tumor growth through immune checkpoint blockade therapy, and its principle is based on the activation mechanism of immune cell T cells. PD-1 (programmed death receptor 1) is expressed on the surface of T cells, and its ligand PD-L1 is expressed on the surface of tumor cells. The binding of PD-1 to its ligand PD-L1 can cause T cells to fail and fail to kill tumor cells normally, so that tumor cells can escape the host's immune surveillance. PD-1 monoclonal antibody can bind to PD-1 on the surface of T cells, blocking the binding of ligand PD-L1 on the surface of tumor cells to PD-1, thereby ensuring that T cells are in an activated state, so that tumor cells cannot escape immune surveillance, and PD-1 monoclonal antibody can enhance the killing effect of T cells on tumor cells, thereby exerting an anti-tumor effect.

[0052] In some embodiments, it is experimentally demonstrated that F2-L1-Sgc8c, with a structural formula of

[0053] ,

[0054] The tumor inhibition rate of F2-L1-Sgc8c combined with PD-1 monoclonal antibody can not only be maintained at 70%-80% for a long time, but also allow mice to survive for a long time, indicating that F2-L1-Sgc8c activates the cGAS-STING signaling pathway and combines with immune blocking therapy to significantly improve the effect of tumor treatment. ＋ T / CD4 ＋ The ratio of T cells proved that the combined administration of F2-L1-Sgc8c and PD-1 monoclonal antibody can significantly promote the maturation of DC cells in tumors and tumor-draining lymph nodes, and significantly increase the CD8 ＋ T / CD4 ＋ Especially in tumors, the combination of F2-L1-Sgc8c and PD-1 monoclonal antibody showed an effect on increasing the proportion of CD8 ＋ Therefore, especially for the treatment of patients with malignant tumors, the combined administration of F2-L1-Sgc8c and PD-1 provided by the present invention can be expected to enhance the immune system of tumor patients and prolong the survival time of tumor patients.

[0055] The present invention has the following beneficial effects:

[0056] (1) The present invention provides a nucleic acid aptamer agonist conjugate, comprising a nucleic acid aptamer, a linker and a STING agonist. The nucleic acid aptamer agonist conjugate can be used as a drug to target and recognize targets on the surface of tumor cells and activate the cGAS-STING signaling pathway to achieve an anti-tumor effect;

[0057] (2) The present invention also screens the types of STING agonists and linkers to make the nucleic acid aptamer agonist conjugates have stronger anti-tumor effects;

[0058] (3) The nucleic acid aptamer agonist conjugate not only has the advantages of easy transmembrane entry, strong tumor permeability, long half-life, and small toxic side effects, but also has a strong inhibitory effect on triple-negative breast cancer;

[0059] (4) The nucleic acid aptamer agonist conjugate can be used in combination with immune checkpoint blockade therapy to achieve long-term and high-efficiency inhibition of tumor growth and prolong survival period. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 is the hydrogen spectrum of MSA-Mal;

[0061] Figure 2 is the mass spectrum of MSA-Mal-Sgc8c conjugate;

[0062] Figure 3 is the mass spectrum of MSA-NHS;

[0063] Figure 4 is the mass spectrum of Sgc8c-3′,5′-2MSA conjugate;

[0064] Figure 5 The expression of IFN-1 produced by THP1-dual-PTK7 reporter cells induced by nucleic acid aptamer STING agonist conjugates MSA-Mal-Sgc8c, Sgc8c-3′,5′-2MSA and monomer MSA-2;

[0065] Figure 6 Tumor volume, relative tumor volume, mouse weight, and relative weight change of mice in the in vivo anti-tumor experiment of nucleic acid aptamer STING agonist conjugate MSA-Mal-Sgc8c and monomer MSA-2;

[0066] Figure 7 is the hydrogen spectrum of compound 2;

[0067] Figure 8 is the hydrogen spectrum of linker L1;

[0068] Fig. 9 is the mass spectrum of linker L1;

[0069] Fig.10 is the hydrogen spectrum of cyclic dinucleotide F2;

[0070] Fig.11 It is the high-resolution mass spectrum of cyclic dinucleotide F2;

[0071] Fig.12 is the mass spectrum of F2-L1;

[0072] Fig.13 is the mass spectrum of F2-L1-Sgc8c conjugate;

[0073] Fig.14 The expression of IFN-1 produced by THP1-dual-PTK7 reporter cells induced by the nucleic acid aptamer STING agonist conjugate F2-L1-Sgc8c and the monomer F2;

[0074] Fig.15 Tumor volume, relative tumor volume, mouse weight, and relative weight change of mice in the in vivo anti-tumor experiment of the nucleic acid aptamer STING agonist conjugate F2-L1-Sgc8c and the monomer F2;

[0075] Fig.16 is the mass spectrum of F2-L2;

[0076] Fig.17 is the mass spectrum of F2-L2-Sgc8c conjugate;

[0077] Fig.18 The expression amount of IFN-1 produced by THP1-dual-PTK7 reporter cells induced by F2-L1-Sgc8c coupled with a degradable linker and F2-L2-Sgc8c coupled with a non-degradable linker;

[0078] Fig.19 Tumor volume, relative tumor volume, mouse weight, relative weight change of mice and survival curve of in vivo anti-tumor experiments of the nucleic acid aptamer STING agonist conjugate F2-L1-Sgc8c and PD-1 monoclonal antibody co-administration and F2-L1-Sgc8c and PD-1 administration alone;

[0079] Fig. 20 This is a study on the in vivo anti-tumor mechanism after combined administration of F2-L1-Sgc8c and PD-1 monoclonal antibody, as well as after separate administration of F2, F2-L1-Sgc8c, and PD-1 monoclonal antibody. DETAILED DESCRIPTION

[0080] The present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be pointed out that the embodiments described below are intended to facilitate the understanding of the present invention and do not have any limiting effect on the present invention.

[0081] Example 1: Effects of nucleic acid aptamer non-cyclic dinucleotide agonist conjugates on IFN-Ⅰ production and tumor inhibition

[0082] In this example, the non-cyclic dinucleotide agonist MSA-2 was coupled to the aptamer through different linkers to prepare the aptamer agonist conjugate to examine the effect of the non-cyclic dinucleotide agonist conjugate containing different linkers on inducing cells to produce IFN-I and inhibiting tumors. Since PTK7 is widely expressed in a variety of tumors, Sgc8c, which can specifically bind to the PTK7 protein on the surface of tumor cells and be internalized into cells, was selected as the aptamer, and its sequence is: ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA, and the Sgc8c was screened and optimized by the systematic evolution of ligands by exponential enrichment (SELEX) technology.

[0083] 1. Preparation of nucleic acid aptamer non-cyclic dinucleotide agonist conjugates containing different linkers

[0084] (1) Preparation of MSA-Mal-Sgc8c

[0085] The non-cyclic dinucleotide agonist MSA-2 (50 mg, 0.17 mmol) and N-hydroxyethylmaleimide (96 mg, 0.68 mmol) were dissolved in 2 mL of anhydrous acetonitrile, and 10 μL of sulfuric acid was added. The reaction was carried out at 80 °C overnight. After the reaction, the solvent was evaporated and the target product MSA-Mal was separated by HPLC, a total of 35 mg. The hydrogen spectrum of MSA-Mal is as follows: Figure 1 The reaction formula is as follows:

[0086]

[0087] 3′-thiol-modified Sgc8c (4 μmol) was dissolved in 2.3 ml DPBS, and MSA-Mal (8.5 mg, 20 μmol) was dissolved in 1 ml acetonitrile. The two were mixed and reacted at 37 °C overnight. After the reaction was completed, 0.1 M TEAA was added for dilution, and the target product MSA-Mal-Sgc8c was obtained by HPLC separation. The mass spectrum of MSA-Mal-Sgc8c is shown in Figure 2 The reaction formula is as follows:

[0088]

[0089] (2) Preparation of MSA-NHS-Sgc8c

[0090] The non-cyclic dinucleotide agonist MSA-2 (50 mg, 0.17 mmol), N-hydroxysuccinimide (97 mg, 0.85 mmol) and TBTU (273 mg, 0.85 mmol) were dissolved in 2 ml of anhydrous dichloromethane, and then 30 μL of DIPEA was added. The reaction was carried out at 45 °C overnight. After the reaction, the mixture was washed with 5% citric acid solution, and the organic phase was collected. The solvent was evaporated and then re-dissolved in ethyl acetate. The precipitate was collected by centrifugation to obtain 32 mg of crude MSA-NHS. The mass spectrum of MSA-NHS is shown in the following figure. Figure 3 The reaction formula is as follows:

[0091]

[0092] The 5′-amino-modified Sgc8c (1 μmol) was suspended in 1 ml of acetonitrile, and the MSA-NHS (2 mg, 5 mmol) prepared in (2) was added, and stirred at 37 °C overnight. After the reaction, the precipitate was collected by centrifugation, and MSA-NHS-Sgc8c was obtained by HPLC separation after ammonia cleavage and reduction. The reaction formula is as follows:

[0093]

[0094] (3) Preparation of Sgc8c-3′,5′-2MSA

[0095] 3′-Mercapto-Sgc8c-NHS-MSA (0.5 μmol) was dissolved in 400 μL 0.1 M TEAA, and MSA-Mal (1 mg, 2.5 μmol) was dissolved in 170 μL acetonitrile. The two were mixed and reacted at 37 °C overnight. After the reaction was completed, 0.1 M TEAA was added for dilution, and the target product Sgc8c-3′, 5′-2MSA was separated by HPLC. The mass spectrum of Sgc8c-3′, 5′-2MSA is shown in Figure 4 The reaction formula is as follows:

[0096]

[0097] 2. Detect the ability of each nucleic acid aptamer STING agonist to induce cells to produce IFN-Ⅰ

[0098] The four groups of additives shown in Table 1 were added to THP1-dual-PTK7 reporter cells to examine the ability of each nucleic acid aptamer STING agonist to induce cells to produce IFN-I.

[0099] Table 1. Non-cyclic dinucleotide agonist conjugates with different linkers

[0100]

[0101] THP1-dual-PTK7 reporter cells are THP1-dual reporter cells that overexpress PTK7 and are used to determine the efficacy of STING agonists. The construction method is to construct a THP1-dual (THP1-dual-PTK7) reporter cell line that overexpresses PTK7 by lentiviral transfection. The specific steps are as follows: prepare 12 ml of 10 5 THP1-dual cell suspension of 100 μg / mL was inoculated into 6-well plates (2 mL / well). 60 μL of virus solution and 40 μL of infection reagent were added to each well. After centrifugation for 30 min, the cells were cultured at 37 °C for 12 h, and the medium was changed and cultured for 72 h. When the infection efficiency was about 80% under the microscope, puromycin (2 μg / mL) was added for resistance screening. After 48 h of screening, the cells were changed and puromycin (1 μg / mL) was added again to continue screening and amplification of the infected cells.

[0102] The specific method is as follows: THP1-dual-PTK7 cells (10,000 / well) were plated in 96-well plates at 37°C and 5% CO 2After 18 h of culture, MSA-2, MSA-Mal-Sgc8c, Sgc8c-3′, 5′-2MSA, and PBS were administered at a concentration of 20 μM. At 24 h, 48 h, 72 h, and 96 h, 10 μl of cell supernatant was taken to a 96-well white ELISA plate, 50 μl of QUANTI-Luc™ detection reagent was added, and the fluorescence intensity was detected by an ELISA instrument. PBS was used as a blank control, and the amount of IFN-I produced in the drug-treated group was expressed as a multiple of that in the PBS group. The results of the ability of each nucleic acid aptamer STING agonist to induce cells to produce IFN-I are shown in Tables 2 and Figure 5 shown.

[0103] Table 2 Results of MSA-2 conjugates with different linkers inducing cells to produce IFN-Ⅰ

[0104]

[0105] According to Table 2 and Figure 5 The results showed that compared with free MSA-2, MSA-Mal-Sgc8c and Sgc8c-3′, 5′-2MSA showed a slow activation effect. The ability of MSA-Mal-Sgc8c and Sgc8c-3′, 5′-2MSA to induce cells to produce IFN-Ⅰ was weaker than that of free MSA-2, among which Sgc8c-3′, 5′-2MSA had the weakest ability to induce IFN-Ⅰ.

[0106] 3. Detection of the tumor inhibition ability of each nucleic acid aptamer STING agonist

[0107] 4T1 cells that highly expressed PTK7 protein were injected into the second mammary pad of 6-8 week-old female BALB / c mice. When the tumor grew to about 70-100 mm 3 The patients were randomly divided into three groups and injected with Saline, MSA-2 and MSA-Mal-Sgc8c in Table 1 through the tail vein at a dose of 8.5 μmol / kg, once every three days for a total of three times. The tumor volume (V = 0.5 × L × W) was measured every three days. 2 ), calculate the average tumor volume of each group of mice, observe the difference in drug efficacy among the drug-treated groups, and when the tumor grows to 1500 mm 3 The mice were killed when the tumor of one mouse in each group grew to 1500 mm 3 The changes in tumor volume and relative tumor volume, weight and relative weight of mice in different dosing groups are shown in Figure 2. Figure 6 The tumor volumes and inhibition rates of different drug administration groups are shown in Table 3 below, where the inhibition rate = (1-tumor volume of experimental group / tumor volume of Saline group) × 100%.

[0108] Table 3. Tumor inhibition rate of MSA-2 conjugates with different linkers

[0109]

[0110] According to Table 3 and Figure 6 Data analysis showed that there was no significant difference in the weight changes of mice in each group within 0-14 days; in terms of anti-tumor efficacy, MSA-Mal-Sgc8c showed an anti-tumor effect comparable to that of free MSA-2. However, free MSA-2 has no targeting and acts on normal cells in addition to tumor cells, which may trigger a systemic cytokine storm, with symptoms such as tissue damage and organ failure.

[0111] Example 2: Effects of aptamer cyclic dinucleotide agonist conjugates on IFN-Ⅰ production and tumor inhibition

[0112] 1. Preparation of valine-alanine-maleimide linker

[0113] Compound 1 (1 g, 2.54 mmol) was dissolved in 30 ml of acetonitrile. The structural formula of compound 1 is:

[0114]

[0115] Then, a 4 M hydrochloric acid solution of dioxane (33 ml, 132 mmol) was added and the reaction was carried out at room temperature for 2 h. After the reaction, the solvent was evaporated and the mixture was resuspended in acetonitrile and filtered. After washing twice with ether, the filter cake was collected to obtain compound 2. The hydrogen spectrum of compound 2 was as follows: Figure 7 As shown, the structural formula of compound 2 is:

[0116]

[0117] Without purification, it was directly carried out to the next step.

[0118] The crude compound 2 (780 mg, 2.5 mmol) was dissolved in 8 ml DMF, and DIPEA (1.3 ml, 7.5 mmol) was added, followed by a DMF solution of 5-maleimidopentanoic acid succinimidyl ester (882 mg, 3 mmol). The reaction was allowed to proceed at room temperature for 30 min. After the reaction was completed, the reaction solution was poured into a pre-cooled PBS solution. The precipitate was collected by centrifugation, and the precipitate was washed with water, ether, and ethyl acetate to obtain compound L1 (694 mg, yield 55%). The hydrogen spectrum of compound L1 is shown in FIG. Figure 8 As shown, the mass spectrum Fig. 9 As shown, the structural formula of compound L1 is:

[0119] .

[0120] The reaction formula for preparing the valine-alanine-maleimide linker L1 is as follows:

[0121]

[0122] 2. Preparation of STING agonists containing L1 linkers

[0123] The cyclic dinucleotide analog is 3ʹ,3ʹ-di-(2ʹ-F)-cG s A s Isomer of MP 3ʹ,3ʹ-di-(2ʹ-F)-cG s A s MP-2 is represented by F2, and the hydrogen spectrum of F2 is as follows Fig.10 As shown, the mass spectrum Fig.11 As shown, the structural formula of F2 is:

[0124]

[0125] Preparation of F2-L1: Under nitrogen protection, the freeze-dried and dehydrated F2 (10 mg, 10.9 μmol) was dissolved in 400 μL ultra-dry DMF, followed by the addition of compound L1 (8.3 mg, 16.4 μmol) and sodium iodide (0.82 mg, 5.45 μmol), and the reaction was carried out at 50 °C for 1 h. After the reaction, HPLC purification was directly performed to obtain compound F2-L1 (3.5 mg, yield 27.5%). The mass spectrum of F2-L1 is shown in the following figure. Fig.12 shown.

[0126] The above reaction formula is as follows:

[0127]

[0128] 3. Preparation of nucleic acid aptamer STING agonist

[0129] The same Sgc8c as in Example 1 was selected as the nucleic acid aptamer.

[0130] 3′-thiol-modified Sgc8c (0.5 μmol) was dissolved in 500 μL DPBS, and the above-prepared F2-L1 (1.74 mg, 1.5 μmol) was dissolved in 500 μL acetonitrile. The two were mixed and reacted at 37 °C overnight. After the reaction was completed, 0.1 M TEAA was added for dilution, and the target product F2-L1-Sgc8c was obtained by HPLC separation. The mass spectrum of F2-L1-Sgc8c is shown in Fig.13 As shown, the structural formula of F2-L1-Sgc8c is:

[0131] .

[0132] The above reaction formula is as follows:

[0133]

[0134] The ability of the F2-L1-Sgc8c conjugate prepared above to induce THP1-dual-PTK7 reporter cells to produce IFN-Ⅰ was detected. F2-L1-Sgc8c group, free F2 group and PBS group were set up. The detection method was referred to Example 1. The evaluation results are shown in Tables 4 and Fig.14 As shown, the ability of F2-L1-Sgc8c coupled with the cathepsin-responsive linker to induce IFN-Ⅰ was significantly better than that of free F2.

[0135] Table 4 Results of IFN-Ⅰ production induced by F2-L1-Sgc8c and free F2

[0136]

[0137] Further, the ability of F2-L1-Sgc8c to inhibit 4T1 tumors with high expression of PTK7 protein was detected. F2-L1-Sgc8c group, free F2 group and Saline group were set up. The detection method was based on the detection of the ability of nucleic acid aptamer STING agonist to inhibit tumors in Example 1. The tumor volume and relative tumor volume changes, mouse body weight changes and relative body weight changes of mice in different groups were as follows: Fig.15 The tumor volumes and inhibition rates of different drug administration groups are shown in Table 5 below.

[0138] Table 5. Tumor suppression effects of F2-L1-Sgc8c and free F2

[0139]

[0140] According to Table 5 and Fig.15 Data analysis showed that there was no significant difference in the body weight of mice in each drug-treated group within 0-24 days. The tumor volume of the F2-L1-Sgc8c-treated group was smaller than that of the free F2-treated group at each time point, and the tumor inhibition rate was higher than that of the free F2-treated group. F2-L1-Sgc8c showed a stronger tumor inhibition effect. Compared with the two, free F2 lacks targeting and acts on tumor cells and normal cells at the same time, which may trigger a systemic cytokine storm, and F2 has poor tumor permeability, resulting in a relative reduction in free F2 enriched in tumor tissues. The F2-L1-Sgc8c conjugate exists stably in the body, targets tumor cells through nucleic acid aptamers, and has strong tumor permeability, so F2-L1-Sgc8c has a stronger tumor inhibition effect than free F2.

[0141] Comprehensively comparing the experimental results of this example with those of Example 1, the anti-tumor effect of F2-L1-Sgc8c is better than that of free MSA-2, and the cyclic dinucleotide agonist F2 is preferably used as the STING agonist for preparing nucleic acid aptamer agonist conjugates.

[0142] Example 3: Activation effect of nucleic acid aptamer cyclic dinucleotide agonist conjugates containing cleavable and non-cleavable linkers on the STING signaling pathway

[0143] 1. Comparison of the activation effects of nucleic acid aptamer cyclic dinucleotide agonist conjugates prepared with cleavable and non-cleavable linkers on the STING signaling pathway

[0144] The cyclic dinucleotide agonist F2 was connected to different types of cleavable linkers and non-cleavable linkers to prepare nucleic acid aptamer agonist conjugates to examine their activation effects on the STING signaling pathway. The cleavable linker was L1 in Example 2, and the structural formula was , the non-cleavable linker is L2, and the structural formula is The nucleic acid aptamer selected was Sgc8c which was the same as that in Example 1.

[0145] (1) Preparation of nucleic acid aptamer cyclic dinucleotide agonist conjugates containing cleavable and non-cleavable linkers

[0146] 1) Preparation of F2-L1-Sgc8c

[0147] F2-L1-Sgc8c was prepared according to the method provided in Example 2.

[0148] 2) Preparation of F2-L2-Sgc8c

[0149] Preparation of F2-L2: Under nitrogen protection, the freeze-dried and dehydrated F2 (5 mg, 5.4 μmol) was dissolved in 200 μL ultra-dry DMF, and then N-bromoethylmaleimide L2 (2.2 mg, 10.8 μmol) and sodium iodide (0.4 mg, 2.7 μmol) were added. The reaction was carried out at 50 °C for 20 h. After the reaction, HPLC purification was directly performed to obtain compound F2-L2 (0.8 mg). The mass spectrum of F2-L2 is shown in FIG. Fig.16 As shown, the reaction formula is as follows:

[0150]

[0151] Preparation of F2-L2-Sgc8c: 3′-thiol-modified Sgc8c (0.5 μmol) was dissolved in 500 μL DPBS, and F2-L2 (1.25 mg, 1.5 μmol) was dissolved in 500 μL acetonitrile. The two were mixed and reacted at 37 °C overnight. After the reaction was completed, 0.1 M TEAA was added for dilution. The target product F2-L2-Sgc8c was separated by HPLC. The mass spectrum of F2-L2-Sgc8c is shown in Figure 2. Fig.17 shown.

[0152]

[0153] (2) Detection of the ability of nucleic acid aptamer cyclic dinucleotide agonist conjugates prepared with cleavable and non-cleavable linkers to induce cells to produce IFN-Ⅰ

[0154] F2-L1-Sgc8c, F2-L2-Sgc8c and PBS were added as additives to THP1-dual-PTK7 reporter cells to examine the ability of each nucleic acid aptamer STING agonist conjugate to induce cells to produce IFN-Ⅰ.

[0155] The specific steps are as follows: THP1-dual-PTK7 cells (50,000 / well) were plated in 96-well plates and incubated at 37°C and 5% CO 2 After 18 h of culture, F2-L1-Sgc8c, F2-L2-Sgc8c, and PBS additives were administered at a concentration of 200 nM. After 24 h of culture, 10 μl of cell supernatant was taken to a 96-well white ELISA plate, 50 μl of QUANTI-Luc™ detection reagent was added, and the fluorescence intensity was detected using an ELISA instrument. PBS was used as a blank control, and the amount of IFN-Ι produced in the drug administration group was expressed as a multiple of that in the PBS group. The test results are shown in Tables 6 and Fig.18 shown.

[0156] Table 6 Results of IFN-Ⅰ production induced by aptamer F2 conjugates containing cleavage and non-cleavage

[0157]

[0158] According to Table 6 and Fig.18Data analysis showed that the ability of F2-L1-Sgc8c containing a cleavable linker to induce cells to produce IFN-Ⅰ at a concentration of 200 nM was significantly higher than that of F2-L2-Sgc8c containing a non-cleavable linker, indicating that the nucleic acid aptamer agonist conjugate coupled to the cleavable linker has a better STING activation effect, while F2-L2-Sgc8c containing a non-cleavable linker cannot activate the STING pathway and produce IFN-Ⅰ due to the difficulty in effectively releasing F2. In addition, compared with non-cleavable linkers, cleavable linkers can release drugs under specific conditions, and their drug release efficiency and accuracy are higher.

[0159] 2. Comparison of the activation effects of nucleic acid aptamer cyclic dinucleotide agonist conjugates prepared with different cleavage linkers on the STING signaling pathway

[0160] The above experiment 1 proves that the nucleic acid aptamer cyclic dinucleotide agonist conjugate prepared by the cleavage-type linker has a stronger ability to induce THP1-dual-PTK7 cells to produce IFN-Ι. The following experiment will compare the STING activation effect of the nucleic acid aptamer cyclic dinucleotide agonist conjugate prepared by different cleavage-type linkers.

[0161] The cleavable linkers include cathepsin-responsive linkers, GSH-responsive linkers and acid-responsive linkers. The cathepsin-responsive linkers are L1 and L3, and their structural formulas are respectively

[0162] , ; The GSH response linkers are L4 and L5, and the structural formulas are , ; The acid-responsive linker is L6, and the structural formula is .

[0163] (1) Preparation of nucleic acid aptamer-cyclic dinucleotide agonist conjugates containing different cleavage-type linkers

[0164] 1) Preparation of F2-L1-Sgc8c

[0165] F2-L1-Sgc8c was prepared according to the method provided in Example 2.

[0166] 2) Preparation of F2-L3-Sgc8c

[0167] Preparation of linker L3: Under nitrogen protection, compound 3 (420 mg, 0.73 mmol) was dissolved in 5 ml of anhydrous DMF, and a dichloromethane solution of thionyl chloride (104 mg, 0.87 mmol) was slowly added dropwise under an ice bath and reacted for 30 min. The mixture was then transferred to room temperature and continued to react for 2 h. After vacuum concentration, linker L3 was obtained after column chromatography separation.

[0168] The above reaction formula is as follows:

[0169] .

[0170] Preparation of F2-L3: Under nitrogen protection, the freeze-dried and dehydrated F2 (10 mg, 10.9 μmol) was dissolved in 400 μL ultra-dry DMF, and then the linker L3 (9.7 mg, 16.4 μmol) and sodium iodide (0.82 mg, 5.45 μmol) were added. The reaction was carried out at 50 °C for 1 h. After the reaction, HPLC purification was directly performed to obtain compound F2-L3.

[0171] The above reaction formula is as follows:

[0172] .

[0173] Preparation of F2-L3-Sgc8c: 3′-thiol-modified Sgc8c (0.5 μmol) was dissolved in 500 μL DPBS, and F2-L3 (1.25 mg, 1.5 μmol) was dissolved in 500 μL acetonitrile. The two were mixed and reacted at 37 °C overnight. After the reaction was completed, 0.1 M TEAA was added to dilute it, and the target product F2-L3-Sgc8c was obtained by HPLC separation.

[0174] 3) Preparation of F2-L4-Sgc8c

[0175] Preparation of linker L4: 3-((2-aminoethyl)disulfanyl)propionic acid (180 mg, 1 mmol) and maleic anhydride (186 mg, 2 mmol) were dissolved in 5 ml of acetic acid / toluene mixed solution (3 / 1) and reacted at 120 °C overnight. After the reaction was completed, the mixture was cooled to room temperature, and then pentane was added under an ice bath to precipitate the precipitate. After washing with ether, the precipitate was concentrated in vacuum to obtain a crude product of compound 6, which was directly subjected to the next step without purification. Under nitrogen protection, the crude product of compound 6 (100 mg, 0.383 mmol) was dissolved in 5 ml of anhydrous dichloromethane, and dichlorothionyl (91 mg, 0.766 mmol) was slowly added dropwise under an ice bath and reacted under an ice bath for 30 min, then transferred to room temperature for overnight reaction, and after the reaction was completed, the crude product of linker L4 was concentrated in vacuum to obtain a crude product of linker L4, which was directly subjected to the subsequent reaction without purification.

[0176] The above reaction formula is as follows:

[0177] .

[0178] Preparation of F2-L4: Under nitrogen protection, the freeze-dried and dehydrated F2 (10 mg, 10.9 μmol) was dissolved in 400 μL of ultra-dry pyridine, and then the linker L4 (15.2 mg, 54.5 μmol) was added. The reaction was carried out at 50 °C for 40 h. After the reaction was completed, HPLC purification was directly performed to obtain compound F2-L4.

[0179] The above reaction formula is as follows:

[0180] .

[0181] Preparation of F2-L4-Sgc8c: 3′-thiol-modified Sgc8c (0.5 μmol) was dissolved in 500 μL DPBS, and F2-L4 (1.25 mg, 1.5 μmol) was dissolved in 500 μL acetonitrile. The two were mixed and reacted at 37 °C overnight. After the reaction was completed, 0.1 M TEAA was added to dilute it, and the target product F2-L4-Sgc8c was obtained by HPLC separation.

[0182] 4) Preparation of F2-L5-Sgc8c

[0183] Preparation of linker L5: Under nitrogen protection, L4 (100 mg, 0.36 mmol) was slowly added dropwise to the reaction system of paraformaldehyde (16.2 mg, 0.54 mmol) and zinc chloride (1 mg, 7.2 μmol) in an ice bath, and reacted in an ice bath for 30 min, then heated to 45 °C and reacted for 24 h. After the reaction, the reaction was completed, filtered, washed with DCM, and the filtrate was collected. The solvent was evaporated and separated by column chromatography to collect linker L5.

[0184] The above reaction formula is as follows:

[0185] .

[0186] Preparation of F2-L5: Under nitrogen protection, the freeze-dried and dehydrated F2 (10 mg, 10.9 μmol) was dissolved in 400 μL of ultra-dry DMF, and then the linker L5 (4 mg, 13.1 μmol) and sodium iodide (0.82 mg, 5.45 μmol) were added. The reaction was carried out at 50 °C overnight. After the reaction was completed, HPLC purification was directly performed to obtain compound F2-L5.

[0187] The above reaction formula is as follows:

[0188] .

[0189] Preparation of F2-L5-Sgc8c: 3′-thiol-modified Sgc8c (0.5 μmol) was dissolved in 500 μL DPBS, and F2-L5 (1.25 mg, 1.5 μmol) was dissolved in 500 μL acetonitrile. The two were mixed and reacted at 37 °C overnight. After the reaction was completed, 0.1 M TEAA was added to dilute it, and the target product F2-L5-Sgc8c was obtained by HPLC separation.

[0190] 5) Preparation of F2-L6-Sgc8c

[0191] Preparation of linker L6: Compound 7 maleimide (1 g, 10 mmol) was dissolved in 40 mL of ethyl acetate, and N-methylmorpholine (930 mg, 10.5 mmol) in ethyl acetate was slowly added dropwise under ice bath, followed by slowly adding compound 8 methyl chloroformate (1.23 g, 10 mmol) in ethyl acetate. After the addition was completed, the mixture was transferred to room temperature for reaction for 1 h. After the reaction was completed, the filtrate was collected by filtration, dried over anhydrous sodium sulfate, filtered, concentrated in vacuo, and then recrystallized by adding ethyl acetate and isopropyl ether to obtain compound 9.

[0192] Compound 10 n-propanolamine (150 mg, 2 mmol) was dissolved in 6 ml saturated sodium bicarbonate solution, and compound 9 (306 mg, 2 mmol) was added in batches under ice bath, and reacted under ice bath for 30 min, and then transferred to room temperature for reaction for 20 min. After the reaction, chloroform was extracted three times, and the organic phase was collected, dried over anhydrous sodium sulfate, filtered, and concentrated to obtain compound 11.

[0193] Under nitrogen protection, compound 11 (116 mg, 0.5 mmol) was dissolved in 2 ml of anhydrous pyridine, and triphosgene (74 mg, 0.25 mmol) was dissolved in 2 ml of anhydrous dichloromethane, and then slowly added dropwise to compound 11 under ice bath. After the addition, the mixture was transferred to room temperature for reaction for 5 h. After the reaction, the crude linker L6 was obtained by vacuum concentration, which was directly used for subsequent reactions without purification.

[0194] The above reaction formula is as follows:

[0195] .

[0196] Preparation of F2-L6: Under nitrogen protection, the freeze-dried and dehydrated F2 (10 mg, 10.9 μmol) was dissolved in 400 μL of ultra-dry pyridine, and then the linker L6 (16 mg, 55 μmol) was added. The reaction was carried out at 50 °C for 40 h. After the reaction was completed, HPLC purification was directly performed to obtain compound F2-L6.

[0197] The above reaction formula is as follows:

[0198] .

[0199] Preparation of F2-L6-Sgc8c: 3′-thiol-modified Sgc8c (0.5 μmol) was dissolved in 500 μL DPBS, and F2-L6 (1.25 mg, 1.5 μmol) was dissolved in 500 μL acetonitrile. The two were mixed and reacted at 37 °C overnight. After the reaction was completed, 0.1 M TEAA was added to dilute it, and the target product F2-L6-Sgc8c was obtained by HPLC separation.

[0200] (2) Detection of the ability of nucleic acid aptamer F2 conjugates prepared with different cleavage-type linkers to induce cells to produce CXCL-10

[0201] The six groups of additives shown in Table 7 were added to SUM159 cells to examine the ability of each nucleic acid aptamer F2 conjugate to induce cells to produce CXCL-10.

[0202] Table 7. Nucleic acid aptamer F2 conjugates with different linkers

[0203]

[0204] The specific steps are as follows: SUM159 cells (5,000 / well) were plated in 96-well plates and incubated at 37°C and 5% CO 2 After 18 h of culture, the six groups of additives in Table 7 were administered at a concentration of 100 nM. After 48 h of culture, 100 μl of cell supernatant was centrifuged and added to the ELISA kit. The absorbance at 450 nm was measured according to the instructions and the concentration of CXCL-10 was calculated. The test results are shown in Table 8 below.

[0205] Table 8. Results of aptamer F2 conjugates with different linkers inducing cells to produce CXCL-10

[0206]

[0207] According to the data analysis in Table 8 above, the content of CXCL-10 produced by SUM159 cells induced by administration of aptamer agonist conjugates coupled with different cleavage-type linkers at a concentration of 100 nM was compared, showing that F2-L1-Sgc8c and F2-L3-Sgc8c coupled with cathepsin-responsive linkers were significantly higher than the other groups, and could more effectively activate the cGAS-STING signaling pathway. The ability of two conjugates containing cathepsin-responsive linkers, F2-L1-Sgc8c and F2-L3-Sgc8c, to induce SUM159 cells to produce CXCL-10 was compared, and F2-L1-Sgc8c was preferred.

[0208] In summary, L1 is preferably used as a linker for preparing nucleic acid aptamer cyclic dinucleotide agonists.

[0209] Example 4: Anti-tumor effect of nucleic acid aptamer agonist conjugate combined with PD-1

[0210] Example 3 experiments prove that F2-L1-Sgc8c has a stronger ability to activate the cGAS-STING signaling pathway. This example explores the tumor treatment effect of F2-L1-Sgc8c activating the cGAS-STING signaling pathway combined with immune checkpoint blockade therapy.

[0211] The specific experimental method is: 4T1 cells with high expression of PTK7 protein were injected into the second mammary pad of 6-8 week old female BALB / c mice. When the tumor grew to about 120 mm 3 The patients were randomly divided into five groups and injected with Saline, F2-L1-Sgc8c conjugate (dosage 0.11 μmol / kg), negative control F2-L1-40A conjugate (dosage 0.11 μmol / kg, 40A is a single-stranded DNA formed by 40 adenines), PD-1 monoclonal antibody (intraperitoneal administration, dose 5 mg / kg), F2-L1-Sgc8c conjugate & PD-1 monoclonal antibody (F2-L1-Sgc8c conjugate dose 0.11 μmol / kg, PD-1 monoclonal antibody intraperitoneal administration, dose 5 mg / kg) through the tail vein, once every three days, for a total of five times, and the PD-1 monoclonal antibody in the combined administration group was intraperitoneally administered the next day. The tumor volume was measured every 3 days (V=0.5×L×W 2 ), calculate the average tumor volume of each group of mice, observe the difference in drug efficacy among the drug-treated groups, and when the tumor grows to 1500 mm 3 The mice were killed when the tumor of one mouse in each group grew to 1500 mm 3 The changes in tumor volume and relative tumor volume, the changes in body weight and relative body weight, and the survival curves of mice in different groups were shown in Figure 2. Fig.19 The tumor volumes, inhibition rates and mouse survival rates of different dosing groups are shown in Tables 9 to 11 below.

[0212] Table 9. Tumor volume in different drug administration groups

[0213]

[0214] Table 10. Tumor inhibition rate in different drug administration groups

[0215]

[0216] Table 11. Survival rate of mice

[0217]

[0218] According to Table 9-Table 11 and Fig.19 Data analysis showed that compared with the negative control F2-L1-40A conjugate, the F2-L1-Sgc8c conjugate targeting PTK7 protein showed a stronger tumor inhibition effect, indicating that F2-L1-Sgc8c can effectively target tumor tissue after intravenous injection, significantly increasing the enrichment of F2 in tumor tissue; at the same time, compared with the single administration of F2-L1-Sgc8c conjugate or PD-1 monoclonal antibody, the combined administration of F2-L1-Sgc8c & PD-1 monoclonal antibody showed a stronger tumor inhibition effect, significantly prolonging the survival period of tumor-bearing mice, with a survival rate of 100% on the 40th day, and finally 20% of the mice achieved long-term survival. The tumors of all mice in the other groups had grown to 1500 mm on the 40th day. 3 This indicates that the combined administration of nucleic acid aptamer cyclic dinucleotide agonist conjugate F2-L1-Sgc8c and PD-1 monoclonal antibody not only has a stronger tumor inhibitory effect, but also can significantly prolong the survival of tumor-bearing mice.

[0219] It should be noted that the experiments on inhibiting mouse tumors in Example 2 and the experiments on inhibiting mouse tumors in this example are not the same batch of experiments, and the starting volumes of the inhibited tumors are different, so there are differences in the tumor inhibition effects.

[0220] To further explore the mechanism of the combined administration of F2-L1-Sgc8c and F2-L1-Sgc8c & PD-1 monoclonal antibodies in inhibiting tumor growth, the DC cell maturation ratio and CD8 ＋ T / CD4 ＋ T cell ratio. Test results are as follows Fig. 20 As shown in the figure, compared with free F2, the F2-L1-Sgc8c conjugate can significantly promote the maturation of DC cells in tumors and tumor-draining lymph nodes, and can significantly increase the expression of CD8 ＋ T / CD4 ＋ The proportion of T cells showed more CD8 ＋ T cells are recruited to the tumor site to exert anti-tumor effects. When the F2-L1-Sgc8c conjugate is combined with PD-1 monoclonal antibody, the DC cell maturation ratio and CD8 ＋ T / CD4 ＋ The proportion of T cells was further increased, especially in tumors. The combined administration of F2-L1-Sgc8c and PD-1 monoclonal antibody showed an effect on increasing CD8 ＋ T / CD4 ＋The ratio of T cells has a synergistic effect, indicating that the F2-L1-Sgc8c conjugate can effectively reverse the immunosuppressive tumor microenvironment, thereby improving the anti-tumor efficacy of immune checkpoint inhibitors.

[0221] Although the present invention is disclosed as above, the present invention is not limited thereto. Any person skilled in the art can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the scope defined by the claims.

Claims

1. A nucleic acid aptamer agonist conjugate, characterized in that: The invention comprises a nucleic acid aptamer and a STING agonist, wherein the nucleic acid aptamer and the STING agonist are coupled into one through a linker.

2. The nucleic acid aptamer agonist conjugate according to claim 1, characterized in that The linkers include cleavable linkers and non-cleavable linkers; the cleavable linkers include any one or more of GSH-responsive linkers, cathepsin-responsive linkers, and acid-responsive linkers.

3. The nucleic acid aptamer agonist conjugate according to claim 2, characterized in that: The cleavable linker includes any one or more of the following structural formulas: 、 、 、 、 。 4. The nucleic acid aptamer agonist conjugate according to claim 1, characterized in that: The STING agonist includes one or more of cyclic dinucleotides and non-cyclic dinucleotides.

5. The nucleic acid aptamer agonist conjugate according to claim 4, characterized in that: The structural formula of the cyclic dinucleotides is: ； Wherein, R1 or R1′ is one of H, F, -OH, and modified -OH; B1 is one of adenine or guanine, and B2 is one of adenine or guanine; Indicates that the phosphate bond can be connected to the 2' or 3' position of the pentose, and the position that does not form a ring with the phosphate is replaced by R2 / R2', wherein R2 / R2' is one of H, F, -OH, and modified -OH; and R3 is one of O and S; The structural formula of the acyclic dinucleotide is: .

6. The nucleic acid aptamer agonist conjugate according to claim 5, characterized in that: The nucleic acid aptamer agonist conjugate includes any one or more of the following structural formulas: 、 、 、 、 、 、 、 。 7. The nucleic acid aptamer agonist conjugate according to claim 6, characterized in that: The nucleic acid aptamer targets PTK7.

8. A method for preparing a nucleic acid aptamer agonist conjugate, characterized in that: The following steps are involved: (1) coupling a STING agonist to a linker; the STING agonist comprises one or more of a cyclic dinucleotide and a non-cyclic dinucleotide; the linker comprises a cleavable linker and a non-cleavable linker; the cleavable linker comprises any one or more of a GSH-responsive linker, a cathepsin-responsive linker, and an acid-responsive linker; (2) Conjugating the STING agonist containing a linker to the nucleic acid aptamer.

9. Use of F2 for preparing a reagent for improving the anti-tumor effect of nucleic acid aptamer agonist conjugates, characterized in that: The structural formula of F2 is 。 10. A composition for inhibiting tumor growth, characterized in that: It includes a nucleic acid aptamer agonist conjugate and a PD-1 monoclonal antibody. The nucleic acid aptamer agonist conjugate is formed by coupling a nucleic acid aptamer and a STING agonist through a linker. The STING agonist includes one of a cyclic dinucleotide and a non-cyclic dinucleotide. The linker includes a cleavable linker and a non-cleavable linker; the cleavable linker includes any one or more of a GSH-responsive linker, a cathepsin-responsive linker, and an acid-responsive linker.

Images