Specific TCR molecule targeting liver cancer cell alpha fetoprotein antigen peptide and HLA-A24 compound, TCR-T cell and preparation and application

Abstract

The invention relates to a specific TCR molecule targeting a liver cancer cell alpha fetoprotein antigen peptide and HLA-A24 compound, a TCR-T cell and preparation and application, and belongs to the technical field of genetic engineering and immunity. The specific TCR molecule disclosed by the invention can be specifically combined with a compound of alpha fetoprotein and HLA-A24, and can be used for specifically killing liver cancer tumor cells expressing the compound. The research is combined with hepatocellular carcinoma single cell transcriptome sequencing analysis, TCR immunogroup analysis, MHC phenotype analysis, antigen peptide and MHC affinity and TCR, antigen peptide and MHC binding analysis, and deep machine learning combined with multiple omics algorithms is carried out. The TCR11-T disclosed by the invention has efficient killing performance on an HLA-A24 (+) tumor cell line with high expression of alpha fetoprotein.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering and immunotechnology, and more specifically to a specific TCR molecule and TCR-T cell targeting a liver cancer cell alpha-fetoprotein antigen peptide and an HLA-A24 complex, as well as their preparation and application. Background Art

[0002] Liver cancer is the sixth most common cancer in the world and the fourth leading cause of cancer-related death, with more than 750,000 deaths worldwide each year. The pathophysiology of liver cancer is a complex multi-step process. The malignant transformation of liver cells caused by the interaction of various factors is the early stage of liver cancer. Liver cancer cells that have undergone malignant transformation will show some abnormal expression indicators, such as a significant increase in alpha-fetoprotein. Serological tests can usually detect high levels of expression of related indicators in a timely manner. At present, the treatment of liver cancer is mainly based on tumor staging and expected benefits. Surgical resection, liver transplantation and local ablation are usually the first choice for patients with early liver cancer. Interventional treatment is the first choice for patients in the middle stage, while patients in the late stage receive systemic treatment directly.

[0003] However, current clinical treatment methods are still difficult to achieve ideal results for patients with advanced hepatocellular carcinoma. Therefore, new and more effective clinical treatment methods still need to be continuously studied. Among them, the effective application of T cell receptor genetically engineered T cells, namely TCR-modified T cells (TCR-T) therapy in solid tumors is considered to be one of the most promising immunotherapy methods. Reported studies have confirmed the effectiveness and safety of TCR-T transduced by natural high-affinity TCR targeting HBsAg epitope peptide S20-28 presented by HLA-A2 for hepatocellular carcinoma populations.

[0004] Therefore, screening out effective hepatocellular carcinoma-specific TCRs and making TCR-Ts for killing hepatocellular carcinoma is a very promising direction for anti-tumor immunotherapy. Tumor-specific TCRs screened out from tumor tissues can specifically bind to tumor cells that abnormally express tumor-associated antigens, and the transduced TCR-T cells can thereby induce the function of T cells to kill tumor cells. Based on the above analysis, multi-omics machine learning can be used to screen hepatocellular carcinoma alpha-fetoprotein-specific TCR11 and prepare TCR11-T, and the in vitro cell co-culture killing system can verify the killing of hepatocellular carcinoma-specific TCR11-T cells on specific liver cancer cell lines. Summary of the invention

[0005] The present invention utilizes multi-omics machine learning to screen TCR (TCR11)-specific TCR targeting hepatocellular carcinoma antigen-alpha-fetoprotein, prepares TCR11-modified T cells (TCR11-T), and uses an in vitro cell co-culture killing system to verify the killing of hepatocellular carcinoma-specific TCR11-T cells on specific liver cancer cell lines, thereby establishing a personalized TCR-T cell therapy technology for identifying liver cancer tumor cells, thereby achieving the purpose of tumor treatment.

[0006] According to a first aspect of the present invention, a specific TCR molecule targeting a complex of an alpha-fetoprotein antigen peptide of a liver cancer cell and HLA-A24 is provided, wherein the specific TCR molecule comprises an α chain and a β chain, wherein the sequence of the α chain is shown in SEQ ID NO: 1, and the sequence of the β chain is shown in SEQ ID NO: 2;

[0007] The TCR molecule can specifically bind to the complex of alpha-fetoprotein and HLA-A24, and can specifically kill liver cancer tumor cells expressing the complex.

[0008] According to another aspect of the present invention, a TCR-T cell is provided, wherein the TCR-T cell contains the specific TCR molecule targeting the liver cancer cell alpha-fetoprotein antigen peptide and HLA-A24 complex.

[0009] Preferably, the T cells of the TCR-T cells are selected from CD8 + T cells, CD4 + T cells, NKT cells or MAIT cells.

[0010] According to another aspect of the present invention, a method for screening specific TCR molecules targeting the liver cancer cell alpha-fetoprotein antigen peptide and HLA-A24 complex is provided, comprising the following steps:

[0011] (1) Based on the single-cell transcriptome sequencing results of liver cancer tissues and adjacent tissues, single-cell transcriptome analysis was performed. First, the clustering of cancer tissues, adjacent tissues, and peripheral blood cells was determined by dimensionality reduction analysis. Then, TCR enrichment analysis was performed to extract TCRs with an enrichment number of more than 20 to obtain tumor-enriched TCRs.

[0012] (2) Screening out antigenic peptide sequences of liver cancer tumor-associated antigens;

[0013] (3) Obtain transcriptome data of liver cancer tumor samples, select chromosomes for genome comparison, and determine the HLA typing results of liver cancer tumor samples;

[0014] (4) based on the affinity between the MHC molecules obtained in step (3) and the antigen peptides of the liver cancer tumor cell-associated antigens obtained after screening in step (2), screening the antigen peptide-MHC complexes that can bind, and using them as targets for screening tumor-specific TCRs;

[0015] (5) The antigen peptide-MHC complex screened in step (4) and the TCR molecule with the strongest tumor-enriched TCR affinity obtained in step (1) are used as specific TCR molecules targeting the liver cancer cell alpha-fetoprotein antigen peptide and HLA-A24 complex.

[0016] Preferably, the liver cancer tumor-associated antigens are alpha-fetoprotein-derived antigenic peptides, glypican-3-derived antigenic peptides, mucin-1-derived antigenic peptides, New York esophageal squamous cell carcinoma-1-derived antigenic peptides and sal-like gene-4-derived antigenic peptides.

[0017] According to another aspect of the present invention, a method for preparing TCR-T cells is provided, characterized in that it comprises the following steps:

[0018] S1: According to the TCR clustering information of the specific TCR molecule targeting the liver cancer cell alpha-fetoprotein antigen peptide and HLA-A24 complex, and the transcriptome characteristic information of the liver cancer tumor sample, a T cell receptor sequence targeting the liver cancer tumor cell alpha-fetoprotein-specific activated T cell is obtained; then the base sequence corresponding to the T cell receptor sequence information is obtained, the base sequence is assembled into a lentiviral vector, and the sequence is connected to end with a stop codon to obtain a specific TCR receptor vector plasmid targeting the liver cancer cell alpha-fetoprotein antigen peptide and HLA-A24 complex;

[0019] S2: inoculating the tool cells into a culture dish and culturing overnight, co-transfecting the plasmid obtained in step S1 and the lentiviral packaging helper plasmid into the tool cells using a liposome transfection reagent, collecting the virus supernatant after culturing, filtering through a filter membrane, and concentrating the virus supernatant by ultrafiltration centrifugation to obtain concentrated lentivirus;

[0020] S3: Transfect the concentrated lentivirus obtained in step S2 into target cells to obtain TCR-T cells.

[0021] According to another aspect of the present invention, there is provided the use of the specific TCR molecule targeting the liver cancer cell alpha-fetoprotein antigen peptide and HLA-A24 complex in the preparation of a drug for treating liver cancer.

[0022] According to another aspect of the present invention, there is provided the use of the TCR-T cells in the preparation of drugs for treating liver cancer.

[0023] In general, the above technical solution conceived by the present invention has the following technical advantages compared with the prior art:

[0024] (1) The present invention uses single-cell transcriptome data to perform deep machine learning to ensure the representativeness and accuracy of the screening results. This study combines single-cell transcriptome sequencing analysis of hepatocellular carcinoma with TCR immune group analysis, MHC phenotype analysis, antigen peptide and MHC affinity, and TCR and antigen peptide and MHC binding analysis to perform deep machine learning combined with multi-omics algorithms, providing a solid theoretical and technical foundation for accurately screening hepatocellular carcinoma tumor-specific TCRs.

[0025] (2) The TCR11-T of the present invention has high efficiency in killing HLA-A24(+) tumor cell lines that highly express alpha-fetoprotein. The in vitro cell killing experiment verified that the TCR11-T screened and transduced in vitro has high efficiency and specificity in killing HLA-A24(+) human liver cancer cell lines that highly express alpha-fetoprotein. (3) The present invention establishes a precise treatment strategy based on patient personalization. The individualized single-cell transcriptome data analysis of the present invention enables the screening of TCRs with specific individual immunogenicity.

[0026] (4) The present invention is scalable. The system has the ability to kill hepatocellular carcinoma tumor cells that express specific MHC molecules and highly express alpha-fetoprotein, so the screened TCR can provide a reference for the preparation of other anti-tumor immunotherapy for liver cancer patients with the same MHC molecules and high expression of alpha-fetoprotein. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Flow chart for screening and validation of specific TCR sequences targeting the complex of hepatocellular carcinoma cell alpha-fetoprotein antigen peptide and HLA-A24.

[0028] Figure 2 TCR enrichment analysis for hepatocellular carcinoma.

[0029] Figure 3 This is a flow cytometric identification diagram of T cells transduced with alpha-fetoprotein antigen peptide and HLA-A24 complex-specific TCR11 in vitro.

[0030] Figure 4 These are the flow cytometry results of in vitro killing of hepatoma cell alpha-fetoprotein antigen peptide and HLA-A24 complex by specific TCR11. DETAILED DESCRIPTION

[0031] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. In addition, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0032] The present invention provides a specific TCR molecule, a TCR-T cell, and a preparation and application thereof that targets a liver cancer cell alpha-fetoprotein antigen peptide and an HLA-A24 complex, and comprises the following steps:

[0033] 1. Single-cell transcriptome sequencing of tumor specimens and adjacent adjacent specimens

[0034] Cancer tissues and adjacent tissues from patients with hepatocellular carcinoma were collected, and tumor-enriched TCRs were obtained by single-cell transcriptome sequencing combined with TCR analysis. Bioinformatics analysis was used to screen the affinity between TCR and hepatocellular carcinoma tumor antigen peptide-MHC complex.

[0035] 1.1 Single-cell transcriptome analysis to obtain tumor-enriched TCRs;

[0036] 1.2 Analysis of antigenic peptides of tumor-associated antigens and tumor-specific antigens in hepatocellular carcinoma;

[0037] 1.3 HLA typing results of patient specimens;

[0038] 1.4 Comparison of the affinity of tumor-associated antigens and tumor-specific antigens to patients' MHC molecules;

[0039] 1.5 Comparison of affinity between antigen peptide-MHC molecule complex and tumor-enriched TCR.

[0040] 2. In vitro transduction of liver cancer-specific TCR11 into T cells to prepare TCR11-T cells

[0041] 2.1TCR11 light chain, heavy chain splicing and gene synthesis;

[0042] 2.2 Lentivirus packaging and identification;

[0043] 2.3 Lentiviral transduction and identification of TCR11 expression.

[0044] 3. In vitro killing verification experiment of specific TCR11-T targeting liver cancer cell alpha-fetoprotein antigen peptide and HLA-A24 complex

[0045] 3.1 Identification of alpha-fetoprotein levels in tumor cell lines;

[0046] 3.2 Identification of HLA-A24 expression in tumor cell lines;

[0047] 3.3 CFSE labeling and staining of target cells;

[0048] 3.4 In vitro killing experiment of TCR11-T cells transduced by lentivirus.

[0049] The preparation and application of the specific TCR molecule and TCR-T cell targeting the hepatoma cell alpha-fetoprotein antigen peptide and HLA-A24 complex of the present invention specifically include the following steps:

[0050] 1. Single-cell transcriptome sequencing of tumor specimens and adjacent adjacent specimens

[0051] 1.1 Single-cell transcriptome analysis to obtain tumor-enriched TCRs:

[0052] The single-cell transcriptome sequencing results of 5 pairs of cancer tissues and adjacent tissues of hepatocellular carcinoma were downloaded from the public database GSE98638. Single-cell transcriptome analysis was performed using R language. First, the clustering of cancer tissues, adjacent tissues, and peripheral blood cells was determined by dimensionality reduction analysis. Next, TCR enrichment analysis was performed, and TCRs with more than 20 enrichments were extracted and mapped in the dimensionality reduction analysis diagram to obtain the tissue information of the enriched TCRs, T cell population information, and T cell receptor sequence information.

[0053] 1.2 Analysis of hepatocellular carcinoma tumor-associated antigens and tumor-specific antigen peptides:

[0054] Information related to the sequences of hepatocellular carcinoma tumor-associated antigen peptides was screened out from existing and databases, including 20 alpha-fetoprotein-derived antigen peptides, 23 phosphatidylinositol proteoglycan-3-derived antigen peptides, 2 mucin 1-derived antigen peptides, 26 New York esophageal squamous cell carcinoma 1-derived antigen peptides, and 7 sal-like gene 4-derived antigen peptides.

[0055] 1.3 HLA typing results of patient specimens:

[0056] The transcriptome data of the selected patient tumor samples were obtained, and Python was used to select the main chromosomes for genome alignment to determine the patient's HLA typing results.

[0057] 1.4 Comparison of the affinity of tumor-associated antigens and tumor-specific antigens to patients’ MHC molecules:

[0058] The NetMHCpan server was used to predict the affinity of the patient MHC molecules obtained in 1.3 and the hepatocellular carcinoma tumor-associated antigens and tumor-specific antigen peptides obtained after screening in 1.2. Based on the affinity scores, antigen peptide-MHC complexes with high binding affinity (with an affinity of less than 500nM) were screened and used as targets for screening tumor-specific TCRs.

[0059] 1.5 Comparison of affinity between antigen peptide-MHC molecule complex and tumor-enriched TCR:

[0060] Based on the premise of high affinity binding of the antigen peptide-MHC complex, we screened TCR sequences that can recognize and bind to the complex with high affinity. The pMTnet server was used to predict the affinity between the antigen peptide-MHC complex screened by 1.4 and the TCR enriched by 1.1. We obtained the candidate TCR for hepatocellular carcinoma tumor-specific killing, TCR11, and the antigen peptide-MHC molecule complex with the highest affinity binding to it, AFP and HLA-A24.

[0061] 2. In vitro transduction of liver cancer-specific TCR11 into T cells

[0062] 2.1TCR11 light chain, heavy chain splicing and gene synthesis:

[0063] By querying the TCR group information and T cell receptor sequence information of TCR11 in 1.1 and the transcriptome feature information of the corresponding patient in 1.3, the potential T cell receptor sequence targeting hepatocellular carcinoma alpha-fetoprotein-specific activated T cells was obtained, and the base sequence corresponding to the above T cell receptor sequence information was obtained according to the IMGT database (human TCR database), and the TCR α chain sequence (SEQ ID NO: 1) was obtained by online identification and comparison:

[0064] ATGAACTATTCTCCAGGCTTAGTATCTCTGATACTCTTACTGCTTGGAAGAACCCGTGGAAATTCAGTGACCCAGATGGAAGGGCCAGTGACTCTCTCAGAAGAGGCCTTCCTGACTATAAACTGCACGTACACAGCCACAGGATACCCTTCCCTTTTCTGGTATGTCCAATATCCTGGAGAAGGTCTACAGCTCCTCCTGAAAGCCACGAAGGCTGATGACAAGGGAAGCAACAAAGGTTTTGAAGCCACATACCGTAAAGAAACCACTTCTTTCCACTTGGAGAAAGGCTCAGTTCAAGTGTCAGACTCAGCGGTGTACTTCTGTGCCCTGAGGTTCCCCAATGCTGGTGGTACTAGCTATGGAAAGCTGACATTTGGACAAGGGACCATCTTGACTGTCCATCCAAATATCCAGAACCCTGACCCTGCCGTGTACCAGCTGAGAGACTCTAAATCCAGTGACAAGTCTGTCTGCCTATTCACCGATTTTGATTCTCAAACAAATGTGTCACAAAGTAAGGATTCTGATGTGTATATCACAGACAAAACTGTGCTAGACATGAGGTCTATGGACTTCAAGAGCAACAGTGCTGTGGCCTGGAGCAACAAATCTGACTTTGCATGTGCAAACGCCTTCAACAACAGCATTATTCCAGAAGACACCTTCTTCCCCAGCCCAGAAAGTTCCTGTGATGTCAAGCTGGTCGAGAAAAGCTTTGAAACAGATACGAACCTAAACTTTCAAAACCTGTCAGTGATTGGGTTCCGAATCCTCCTCCTGAAAGTGGCCGGGTTTAATCTGCTCATGACGCTGCGGCTGTGGTCCAGC

[0065] TCR β-chain sequence (SEQ ID NO:2):

[0066] ATGCTGCTGCTTCTGCTGCTTCTGGGGCCAGGTATAAGCCTCCTTCTACCTGGGAGCTTGGCAGGCTCCGGGCTTGGTGCTGTCGTCTCTCAACATCCGAGCTGGGTTATCTGTAAGAGTGGAACCTCTGTGAAGATCGAGTGCCGTTCCCTGGACTTTCAGGCCACAACTATGTTTTGGTATCGTCAGTTCCCGAAACAGAGTCTCATGCTGATGGCAACTTCCAATGAGGGCTCCAAGGCCACATACGAGCAAGGCGTCGAGAAGGACAAGTTTCTCATCAACCATGCAAGCCTGACCTTGTCCACTCTGACAGTGACCAGTGCCCATCCTGAAGACAGCAGCTTCTACATCTGCAGCGCCAGCCCCGAGGGCCTGGGCCTGTATGGCTACACCTTCGGTTCGGGGACCAGGTTAACCGTTGTAGAGGACCTGAACAAGGTGTTCCCACCCGAGGTCGCTGTGTTTGAGCCATCAGAAGCAGAGATCTCCCACACCCAAAAGGCCACACTGGTGTGCCTGGCCACAGGCTTCTTCCCCGACCACGTGGAGCTGAGCTGGTGGGTGAATGGGAAGGAGGTGCACAGTGGGGTCAGCACGGACCCGCAGCCCCTCAAGGAGCAGCCCGCCCTCAATGACTCCAGATACTGCCTGAGCAGCCGCCTGAGGGTCTCGGCCACCTTCTGGCAGAACCCCCGCAACCACTTCCGCTGTCAAGTCCAGTTCTACGGGCTCTCGGAGAATGACGAGTGGACCCAGGATAGGGCCAAACCCGTCACCCAGATCGTCAGCGCCGAGGCCTGGGGTAGAGCAGACTGTGGCTTTACCTCGGTGTCCTACCAGCAAGGGGTCCTGTCTGCCACCATCCTCTATGAGATCCTGCTAGGGAAGGCCACCCTGTATGCTGTGCTGGTCAGCGCCCTTGTGTTGATGGCCATGGTCAAGAGAAAGGATTT

[0067] The obtained α chain and β chain sequences of the above-mentioned reactive TCR were assembled into a lentiviral vector, connected through the P2A sequence, and ended with a stop codon to obtain a successfully constructed specific TCR receptor vector plasmid targeting the liver cancer cell alpha-fetoprotein antigen peptide and HLA-A24 complex (this step was synthesized by the company).

[0068] 2.2 Lentivirus packaging and concentration:

[0069] 293T cells were inoculated into 10 cm culture dishes and cultured overnight. The core plasmid loaded with the full sequence of TCR11 and two lentiviral packaging auxiliary plasmids (PMD2.0G and PSPAX2) were co-transfected into 293T tool cells using liposome transfection reagent. After 3 days of culture, the viral supernatant was collected, filtered through a 0.45 μm filter membrane and concentrated by ultrafiltration centrifugation. The obtained virus was named TCR11-lentivirus, packaged and stored in a -80°C refrigerator for later use.

[0070] 2.3 Lentiviral transduction and TCR11 expression identification:

[0071] Jurkat 76 cell line was used as the target cell for viral transduction. The control virus and TCR11 virus were used to infect Jurkat 76 cell line, respectively. A virus infection gradient was set to obtain the optimal infection system. The culture medium was replaced with fresh culture medium 2 days after infection. 3 days after infection, the expression of T cell marker CD3 signal by target cells was detected by flow cytometry to identify whether the viral infection was successful. The negative control was Jurkat 76 cell line transfected with control virus. The results showed that more than 80% of the T cell marker CD3 positive signals were detected only in the cell line transfected with TCR11-lentivirus.

[0072] 3. In vitro killing verification experiment of specific TCR11-T targeting liver cancer cell alpha-fetoprotein antigen peptide and HLA-A24 complex

[0073] The cell line HepG2 (MHC molecule is HLA-A24 positive) with high expression of alpha-fetoprotein, the cell line HLF (MHC molecule is HLA-A24 positive) with low expression of alpha-fetoprotein, and the H1299 cell line (MHC molecule is HLA-A24 negative) were selected to verify the specific recognition of TCR11-T for specific AFP and HLA-A24 and the killing of target cells expressing the corresponding molecules.

[0074] 3.1 Identification of alpha-fetoprotein levels in tumor cell lines:

[0075] Take 1*10 of each of the three tumor cell lines 6Add 1ml Trizol reagent to lyse at room temperature, add 200u chloroform and shake for 15 seconds, place on ice for 10 minutes and then centrifuge at high speed, aspirate the upper extraction layer liquid and add 400ul isopropanol, place on ice for 10 minutes and then centrifuge at high speed, clear the precipitation twice with 75% ethanol, dry at room temperature and dissolve the RNA precipitation with enzyme-free water. Use reverse transcriptase to reverse it to cDNA. Use SYBR to amplify the alpha-fetoprotein gene fragment with it as a template and compare it. The results show that HepG2 has a significantly higher alpha-fetoprotein expression level than the other two cell lines.

[0076] 3.2 Identification of HLA-A24 expression in tumor cell lines:

[0077] Take 1*10 of each of the three tumor cell lines 6 Proteinase K was added to digest and decompose the protein, and the protein was separated after phenol and chloroform extraction, and the cell line genomic DNA was obtained by ethanol precipitation. The HLA-A24 molecule was amplified by PCR, and the results verified that the HepG2 and HLF cell lines were HLA-A24 positive cell lines, and the H1299 cell line was HLA-A24 negative cell line.

[0078] 3.3 CFSE labeling and staining of target cells:

[0079] Three tumor cell lines (namely HepG2, H1299, and HLF cell lines) were labeled with CFSE staining solution and stained in a cell culture incubator at 37°C for 20 minutes. FBS with half the volume of the suspension was added to terminate the staining. After washing twice with PBS, 1640 medium containing 10% FBS was added to resuspend the cells for later use.

[0080] 3.4 Lentivirus transduction TCR11-T in vitro killing experiment:

[0081] CFSE-stained target cells and the prepared TCR11-T cell line were added to each 96-well plate at a ratio of 1:10. After co-culture for 24 hours, the cells were centrifuged and stained with propidium iodide. Flow cytometry was used to detect the killing of CFSE-positive cell populations (i.e., tumor cell lines). The results showed that the HepG2 tumor cell line, which was HLA-A24 positive and highly expressed alpha-fetoprotein, showed an obvious killing positive population, while the HLF cell line, which was HLA-A24 positive and lowly expressed alpha-fetoprotein, only showed a lower killing positive population, and the H1299 cell line, which was HLA-A24 negative, showed no obvious killing positive population.

[0082] It will be easily understood by those skilled in the art that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A specific TCR molecule targeting the complex of liver cancer cell alpha-fetoprotein antigen peptide and HLA-A24, characterized in that: The specific TCR molecule contains an α chain and a β chain, the sequence of the α chain is shown in SEQ ID NO: 1, and the sequence of the β chain is shown in SEQ ID NO: 2; The TCR molecule can specifically bind to the complex of alpha-fetoprotein and HLA-A24, and can specifically kill liver cancer tumor cells expressing the complex.

2. A TCR-T cell, characterized in that: The TCR-T cell contains the specific TCR molecule targeting the liver cancer cell alpha-fetoprotein antigen peptide and HLA-A24 complex as claimed in claim 1.

3. The TCR-T cell according to claim 2, characterized in that The T cells of the TCR-T cells are selected from CD8 + T cells, CD4 + T cells, NKT cells or MAIT cells.

4. The method for screening specific TCR molecules targeting the complex of liver cancer cell alpha-fetoprotein antigen peptide and HLA-A24 according to claim 1, characterized in that: The following steps are involved: (1) Based on the single-cell transcriptome sequencing results of liver cancer tissues and adjacent tissues, single-cell transcriptome analysis was performed. First, the clustering of cancer tissues, adjacent tissues, and peripheral blood cells was determined by dimensionality reduction analysis. Then, TCR enrichment analysis was performed to extract TCRs with an enrichment number of more than 20 to obtain tumor-enriched TCRs. (2) Screening out antigenic peptide sequences of liver cancer tumor-associated antigens; (3) Obtain transcriptome data of liver cancer tumor samples, select chromosomes for genome comparison, and determine the HLA typing results of liver cancer tumor samples; (4) based on the affinity between the MHC molecules obtained in step (3) and the antigen peptides of the liver cancer tumor cell-associated antigens obtained after screening in step (2), screening the antigen peptide-MHC complexes that can bind, and using them as targets for screening tumor-specific TCRs; (5) The antigen peptide-MHC complex screened in step (4) and the TCR molecule with the strongest tumor-enriched TCR affinity obtained in step (1) are used as specific TCR molecules targeting the liver cancer cell alpha-fetoprotein antigen peptide and HLA-A24 complex.

5. The method for screening TCR molecules according to claim 4, characterized in that: The liver cancer tumor-associated antigens are alpha-fetoprotein derived antigen peptides, phosphatidylinositol proteoglycan-3 derived antigen peptides, mucin-1 derived antigen peptides, New York esophageal squamous cell carcinoma-1 derived antigen peptides and sal-like gene-4 derived antigen peptides.

6. The method for preparing TCR-T cells according to claim 2 or 3, characterized in that: The following steps are involved: S1: According to claim 1, the TCR grouping information of the specific TCR molecule targeting the liver cancer cell alpha-fetoprotein antigen peptide and the HLA-A24 complex, and the transcriptome characteristic information of the liver cancer tumor sample, obtain the T cell receptor sequence that specifically activates T cells targeting the liver cancer tumor cell alpha-fetoprotein; then obtain the base sequence corresponding to the T cell receptor sequence information, assemble the base sequence into a lentiviral vector, and perform sequence connection to end with a stop codon to obtain a specific TCR receptor vector plasmid targeting the liver cancer cell alpha-fetoprotein antigen peptide and the HLA-A24 complex; S2: inoculating the tool cells into a culture dish and culturing overnight, co-transfecting the plasmid obtained in step S1 and the lentiviral packaging helper plasmid into the tool cells using a liposome transfection reagent, collecting the virus supernatant after culturing, filtering through a filter membrane, and concentrating the virus supernatant by ultrafiltration centrifugation to obtain concentrated lentivirus; S3: Transfect the concentrated lentivirus obtained in step S2 into target cells to obtain TCR-T cells.

7. Use of the specific TCR molecule targeting the liver cancer cell alpha-fetoprotein antigen peptide and HLA-A24 complex as claimed in claim 1 in the preparation of a drug for treating liver cancer.

8. Use of the TCR-T cell according to claim 2 or 3 in the preparation of a drug for treating liver cancer.

Images