Neural stem cell induced differentiation culture medium and application thereof in preparation of neural stem cells

Abstract

The invention relates to the field of cell biology, and particularly discloses a neural stem cell induced differentiation culture medium and application thereof in preparation of neural stem cells. The neural stem cell induced differentiation culture medium is composed of a basic culture medium and additives, wherein the additives are composed of an N-2 additive, a B-27 additive, glutamine, a human leukemia inhibiting factor, a GSK-3 inhibitor, an ALK inhibitor, a gamma-secretase inhibitor and a CDK8 inhibitor. The neural stem cell induced differentiation culture medium is clear and simple in component, does not need to use antibiotics, and does not contain animal-derived components. When the culture medium is used for carrying out differentiation induction on the human pluripotent stem cells, the human pluripotent stem cells can be induced and differentiated into the neural stem cells within a short time (6-7 days) without depending on pluripotent stem cell cloning and a single cell state, the nonuniformity of pluripotent stem cell cloning formation can be overcome, and the purity of the neural stem cells is improved.

Description

Technical Field

[0001] The present application relates to the field of cell biology, and more specifically, to a neural stem cell induction differentiation culture medium and its application in preparing neural stem cells. Background Art

[0002] Neural stem cells (NSCs) are a special type of cells existing in the nervous system. They highly express specific genes such as SOX1, SOX2, NESTIN, PAX6, and have the ability of self-renewal and multipotent differentiation. NSCs can differentiate into various types of neural cells such as neurons, astrocytes and oligodendrocytes, and maintain the number and stability of cell populations through self-renewal. NSCs play an important role in the development, repair and regeneration of the nervous system, and have important research value and application prospects in the research and treatment of nervous system diseases, such as neurodegenerative diseases, drug screening and toxicity testing.

[0003] The acquisition of primary NSCs faces the problem of limited donor materials. Human pluripotent stem cells, including human embryonic stem cells and human induced pluripotent stem cells, have strong self-renewal and unlimited proliferation capabilities, and can be induced to differentiate into NSCs under specific conditions, which can provide a large number of cell sources for the application of NSCs. Currently, there are various methods for inducing the differentiation of human pluripotent stem cells into NSCs, including embryoid body method, matrix cell co-culture method and monolayer cell induction method.

[0004] The embryoid body method produces a multilayer structure containing multiple cell types such as NSCs by culturing human pluripotent stem cells in suspension to allow them to self-organize into three-dimensional cell aggregates (embryoid bodies). The limitations of this method are that the large variability in the embryoid body formation process affects the stability and consistency of NSCs production, and the dense aggregation state of embryoid body cells poses a challenge to the real-time monitoring of cell morphology, affecting the fine control and evaluation of the differentiation process.

[0005] The stromal cell co-culture method co-cultures human pluripotent stem cells with PA6 or MS5 stromal cells, and uses the inducible vitality factors secreted or expressed by the stromal cells to promote the formation of neural rosette-like structures containing NSCs. The limitations of this method are that the molecular mechanism of its induction process is unclear, and the variability of stromal cells will affect the stability and consistency of NSCs production.

[0006] The monolayer cell induction method forms larger clones by inoculating human pluripotent stem cells in a culture dish covered with matrix gel or vitronectin, and then inducing them to differentiate into neural rosette-like structures containing NSCs through an induction medium containing small molecule compounds and protein factors. The advantage of this method is that the chemical composition of the induction medium is clear, and it is easy to operate, easy to control, and does not require the use of a complex culture system, but the induced cells are still heterogeneous and need to be further purified to obtain uniform NSCs. Chinese patent CN109294991A provides a neural stem cell induction differentiation medium, which contains a variety of growth factors and inhibitors. Although it does not require animal-derived cells as a feeder layer during the differentiation process, and does not need to form embryoid bodies (EBs), the neural stem cells obtained by this method are also largely inhomogeneous and need to be further purified through subsequent subculture.

[0007] Therefore, there is a need to improve the method for preparing NSCs by inducing differentiation of human pluripotent stem cells to increase the induction efficiency and purity of NSCs. Summary of the invention

[0008] In order to solve the above-mentioned problem of low induction efficiency and purity in preparing neural stem cells by inducing differentiation of human pluripotent stem cells, the present application provides a neural stem cell induction differentiation medium and its application in preparing neural stem cells.

[0009] This application adopts the following technical solutions:

[0010] In one aspect, the present application provides a neural stem cell induction differentiation medium, which is composed of a basic medium and additives;

[0011] The basic culture medium is at least one of DMEM / F12 culture medium and Neurobasal culture medium;

[0012] The additive consists of the following components: N-2 additive, B-27 additive, glutamine, human leukemia inhibitory factor, GSK-3 inhibitor, ALK inhibitor, γ-secretase inhibitor and CDK8 inhibitor;

[0013] Wherein, the CDK8 inhibitor is any one of BI-1347, AS2863619 and MSC2530818, and the content of the CDK8 inhibitor is 1 to 4 μM.

[0014] Furthermore, the above-mentioned additives are composed of the following components: N-2 additive 0.5% to 2%, B-27 additive 1% to 4%, glutamine 1 to 5 mM, human leukemia inhibitory factor 5 to 15 ng / mL, GSK-3 inhibitor 2 to 8 μM, ALK inhibitor 2 to 10 μM, γ-secretase inhibitor 0.05 to 1 μM and CDK8 inhibitor 1 to 4 μM.

[0015] Furthermore, the above-mentioned basal culture medium is obtained by mixing DMEM / F12 culture medium and Neurobasal culture medium in a mass ratio of 1:0.5 to 1.5.

[0016] Furthermore, the GSK-3 inhibitor is CHIR99021, SB216763 or CHIR-98014, the ALK inhibitor is at least one of SB431542, LY-364947, SB-505 and A-83-01, and the γ-secretase inhibitor is Compound E.

[0017] In a second aspect, the present application provides a method for preparing neural stem cells from human pluripotent stem cells, comprising:

[0018] (1) single-cell human pluripotent stem cells are seeded in a culture dish covered with matrix gel;

[0019] (2) Inducing the human pluripotent stem cells to differentiate into neural stem cells within 6-7 days using the neural stem cell induction differentiation medium.

[0020] Furthermore, in step (1), the process of inoculating the above-mentioned human pluripotent stem cells into a culture dish covered with matrix gel comprises:

[0021] The human pluripotent stem cells are dissociated into single cells, resuspended in a human pluripotent stem cell culture medium containing a ROCK inhibitor, and then inoculated into a culture dish covered with matrigel. After cell culture for 12-36 hours, fresh human pluripotent stem cell culture medium is replaced.

[0022] Preferably, the ROCK inhibitor is Y-27632, the content of the ROCK inhibitor is 5-10 μM, and the human pluripotent stem cell culture medium is Essential 8, TeSR or PGM1.

[0023] Furthermore, the step of inducing the human pluripotent stem cells to differentiate into neural stem cells in step (2) comprises:

[0024] A. preparing the above neural stem cell induction differentiation medium;

[0025] B. Replace the human potential stem cell culture medium with the neural stem cell induction differentiation medium, culture at 36-39°C, 3-7% CO2, change the medium on the 2nd day, 4th day and 6th day respectively, add the preheated neural stem cell induction differentiation medium, and obtain P0 generation neural stem cells on the 7th day.

[0026] In a third aspect, the present application provides a kit for preparing neural stem cells, which includes the above-mentioned neural stem cell induction differentiation medium.

[0027] In a fourth aspect, the present application provides a neural stem cell obtained using the above-mentioned neural stem cell induction differentiation medium; or, obtained using the above-mentioned method for preparing neural stem cells from human pluripotent stem cells.

[0028] In summary, this application has the following beneficial effects:

[0029] The neural stem cell induction differentiation medium provided in the present application is based on DMEM / F12 medium and / or Neurobasal medium, and is added with cell culture additives and a variety of cell signaling pathway inhibitors, including CDK8 inhibitors. The components of this neural stem cell induction differentiation medium are clear and simple, no antibiotics are required, and it does not contain animal-derived components. When using this medium to induce differentiation of human pluripotent stem cells, the differentiation efficiency is high, the induction time is short, and the purity is high.

[0030] The method for preparing neural stem cells from human pluripotent stem cells provided in the present application does not rely on pluripotent stem cell cloning. The single-cell state can be induced to differentiate into neural stem cells in a short period of time (6-7 days), which can overcome the heterogeneity of pluripotent stem cell cloning and improve the purity of neural stem cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 A schematic diagram of the timeline for directional induction and differentiation of human pluripotent stem cells using a neural stem cell induction and differentiation medium provided in Application Example 1 of this application;

[0032] Figure 2 The cell morphology diagram provided in Application Example 1 of the present application during the process of directional induction differentiation of human pluripotent stem cells using neural stem cell induction differentiation medium;

[0033] Figure 3 This is an immunofluorescence analysis diagram of neural stem cells differentiated from Application Example 1 of this application;

[0034] Figure 4 This is a graph showing the results of RT-qPCR analysis of neural stem cells differentiated from Application Example 1 and Comparative Example 1 of the present application; wherein H9, NSC w / o BI-1347, and NSC with BI-1347 respectively indicate the human pluripotent stem cell line H9, neural stem cells induced by a neural stem cell culture medium without the CDK8 inhibitor BI-1347, and neural stem cells induced by a complete neural stem cell culture medium containing the CDK8 inhibitor BI-1347;

[0035] Figure 5The following are the results of flow cytometry analysis of PAX6 protein of neural stem cells differentiated from Application Example 1 and Comparative Example 1 of the present application: (A) is a representative flow cytometry graph of immunofluorescence of anti-PAX6 antibody, blank is a negative control, NSC w / o BI-1347 and NSC with BI-1347 respectively indicate neural stem cells induced by neural stem cell culture medium without CDK8 inhibitor BI-1347 and neural stem cells induced by complete neural stem cell culture medium containing CDK8 inhibitor BI-1347; (B) is the statistical result of average fluorescence intensity of anti-PAX6 antibody. DETAILED DESCRIPTION

[0036] The embodiments of the present invention will be described in detail below in conjunction with examples. However, those skilled in the art will understand that the following examples are only used to illustrate the present invention and should not be construed as limiting the scope of the present invention. The specific conditions not specified in the examples are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially.

[0037] The technical solution of the present invention is:

[0038] This embodiment provides a neural stem cell differentiation induction medium, which consists of two parts:

[0039] (I) Basic culture medium:

[0040] There are three options for the basal culture medium, namely, DMEM / F12 culture medium, or Neurobasal culture medium, or a culture medium formed by mixing DMEM / F12 culture medium and Neurobasal culture medium in a certain mass ratio, for example, a mixture of 1:0.5-1.5, preferably a mixture of 1:0.8-1.2, and more preferably a mixture of 1:1, that is, the basal culture medium is 50% DMEM / F12 culture medium + 50% Neurobasal culture medium.

[0041] (ii) Additives:

[0042] The additive consists of the following components: N-2 additive, B-27 additive, glutamine, human leukemia inhibitory factor, GSK-3 inhibitor, ALK inhibitor, γ-secretase inhibitor and CDK8 inhibitor.

[0043] Among them, N-2 additive and B-27 additive are cell culture additives, both of which are optimized serum-free additives. After adding N-2 additive and B-27 additive to the neural cell differentiation induction medium, it helps to provide an optimized and stable serum-free culture link for neural cells to promote the survival and differentiation of human pluripotent stem cells. Preferably, N-2 additive is 0.5% to 2%, and B-27 additive is 1% to 4%; more preferably, N-2 additive is 0.8% to 1.5%, and B-27 additive is 1.5% to 3%; most preferably, N-2 additive is 1% and B-27 additive is 2%.

[0044] Glutamine is added to the neural cell differentiation induction medium to provide the cells with necessary amino acid support to meet their growth and differentiation needs. Preferably, the content of glutamine is 1 to 5 mM; more preferably, the content of glutamine is 1.5 to 3 mM; more preferably, the content of glutamine is 2 mM.

[0045] Human leukemia inhibitory factor is added to the neural cell differentiation induction medium to promote the regulation of neural cell differentiation. Preferably, the content is 5-15 ng / mL; more preferably, the content is 8-12 ng / mL; more preferably, the content is 10 ng / mL.

[0046] GSK-3 inhibitors, ALK inhibitors and γ-secretase inhibitors, these inhibitors provide effective regulatory means for the induced differentiation of neural cells by affecting related signaling pathways and cell proliferation and differentiation processes. By controlling their concentrations and culture conditions, a better differentiation effect can be achieved. Preferably, GSK-3 inhibitors are 2 to 8 μM, ALK inhibitors are 2 to 10 μM, and γ-secretase inhibitors are 0.05 to 1 μM; more preferably, GSK-3 inhibitors are 3 to 5 μM, ALK inhibitors are 2.5 to 5 μM, and γ-secretase inhibitors are 0.05 to 0.15 μM; more preferably, GSK-3 inhibitors are 4 μM, ALK inhibitors are 3 μM, and γ-secretase inhibitors are 0.1 μM. The inhibitor may be a conventional inhibitor in the art, for example, the GSK-3 inhibitor may be CHIR99021, SB216763 or CHIR-98014; the ALK inhibitor may be at least one of SB431542, LY-364947, SB-505 and A-83-01; and the γ-secretase inhibitor may be Compound E.

[0047] CDK8 inhibitors. The applicant has found that adding CDK8 inhibitors to the neural cell differentiation induction medium can significantly increase the proportion of cells expressing specific genes (SOX2, SOX1, PAX6 and NESTIN), and improve the uniformity and purity of neural stem cells. The CDK8 inhibitor can be any one of BI-1347, AS2863619 and MSC2530818; preferably, the CDK8 inhibitor is BI-1347. The content of the CDK8 inhibitor is 1 to 4 μM; more preferably, the content of the CDK8 inhibitor is 1.5 to 3 μM; more preferably, the content of the CDK8 inhibitor is 2 μM.

[0048] It should be noted that the content of each component of the above additives refers to the concentration in the neural stem cell induction differentiation medium.

[0049] The "human pluripotent stem cells" in the present application are human embryonic stem cells or human induced pluripotent stem cells; wherein the embryonic stem cells are human embryonic stem cells available from commercial channels, preferably cells of any of the following NIH numbered cell lines: BG01, BG02, BG03, BG04, SA01, SA02, SA03, ES01, ES02, ES03, ES04, ES05, ​​ES06, TE03, TE32, TE33, TE04, TE06, TE62, TE07, TE72, UC01, UC06, WA01, WA07, WA09, WA13 and WA14.

[0050] Some of the reagents and sources used in this embodiment are shown in Table 1:

[0051] Table 1.

[0052]

[0053]

[0054] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0055] Example 1

[0056] This embodiment provides a neural stem cell differentiation induction medium, which includes:

[0057] 50% DMEM / F12, 50% Neurobasal, 1% N-2, 2% B-27, 2mM glutamine, 10ng / ml human leukemia inhibitory factor, 4μM GSK-3 inhibitor, 3μM ALK inhibitor, 0.1μM γ-secretase inhibitor, and 2μM CDK8 inhibitor.

[0058] Among them, glutamine is GlutaMAX, human leukemia inhibitory factor is hLIF, GSK-3 inhibitor is CHIR99021, ALK inhibitor is SB431542, γ-secretase inhibitor is Compound E, and CDK8 inhibitor is BI-1347.

[0059] Example 2

[0060] This embodiment provides a neural stem cell differentiation induction medium, which includes:

[0061] 50% DMEM / F12, 50% Neurobasal, 0.5% N-2, 1% B-27, 5mM glutamine, 5ng / ml human leukemia inhibitory factor, 8μM GSK-3 inhibitor, 2μM ALK inhibitor, 0.05μM γ-secretase inhibitor, and 4μM CDK8 inhibitor.

[0062] Among them, glutamine is GlutaMAX, human leukemia inhibitory factor is hLIF, GSK-3 inhibitor is CHIR99021, ALK inhibitor is SB431542, γ-secretase inhibitor is Compound E, and CDK8 inhibitor is AS2863619.

[0063] Example 3

[0064] This embodiment provides a neural stem cell differentiation induction medium, which includes:

[0065] 50% DMEM / F12, 50% Neurobasal, 2% N-2, 4% B-27, 1 mM glutamine, 15 ng / ml human leukemia inhibitory factor, 2 μM GSK-3 inhibitor, 10 μM ALK inhibitor, 1 μM γ-secretase inhibitor, and 1 μM CDK8 inhibitor.

[0066] Among them, glutamine is GlutaMAX, human leukemia inhibitory factor is hLIF, GSK-3 inhibitor is CHIR99021, ALK inhibitor is SB431542, γ-secretase inhibitor is Compound E, and CDK8 inhibitor is MSC2530818.

[0067] Example 4

[0068] This embodiment provides a neural stem cell differentiation induction medium, which includes:

[0069] 40% DMEM / F12, 60% Neurobasal, 1% N-2, 3% B-27, 1 mM glutamine, 8 ng / ml human leukemia inhibitory factor, 5 μM GSK-3 inhibitor, 6 μM ALK inhibitor, 0.5 μM γ-secretase inhibitor, and 3 μM CDK8 inhibitor.

[0070] Among them, glutamine is GlutaMAX, human leukemia inhibitory factor is hLIF, GSK-3 inhibitor is SB216763, ALK inhibitor is SB-505, γ-secretase inhibitor is Compound E, and CDK8 inhibitor is BI-1347.

[0071] Example 5

[0072] This embodiment provides a neural stem cell differentiation induction medium, which includes:

[0073] 60% DMEM / F12, 40% Neurobasal, 1% N-2, 2% B-27, 2mM glutamine, 10ng / ml human leukemia inhibitory factor, 4μM GSK-3 inhibitor, 3μM ALK inhibitor, 0.1μM γ-secretase inhibitor, and 2μM CDK8 inhibitor.

[0074] Among them, glutamine is GlutaMAX, human leukemia inhibitory factor is hLIF, GSK-3 inhibitor is CHIR-98014, ALK inhibitor is A-83-01, γ-secretase inhibitor is Compound E, and CDK8 inhibitor is BI-1347.

[0075] Application Example 1

[0076] Directed differentiation of human pluripotent stem cells using neural stem cell induction differentiation medium:

[0077] 1. Experimental materials: human embryonic stem cells (H9);

[0078] 2. Neural stem cell induction medium (NIM): provided in Example 1;

[0079] 3. Experimental methods (e.g. Figure 1 shown):

[0080] (1) D-2: Human embryonic stem cells were incubated with Accutase digestion solution at 37°C and 5% CO2 for 3-5 min to dissociate into single cells. After centrifugation and removal of the supernatant, the cells were resuspended in human pluripotent stem cell culture medium PGM1 containing 8 μM Y-27632 and seeded into 12-well plates covered with Matrigel (1:80 dilution) at a cell number of 10,000 cells per well and cultured at 37°C and 5% CO2;

[0081] (2) D-1: The next day, fresh human pluripotent stem cell culture medium PGM1 (preheated at 37°C) was added, 1 mL per well.

[0082] (3) D0: Start neural induction, aspirate the consumed medium, and add 1.25 mL of 37°C preheated NIM to each well;

[0083] (4) D2: Change the medium and add 1.25 mL of 37°C preheated NIM to each well;

[0084] (5) D4: Change the medium and add 2.5 mL of 37°C preheated NIM to each well;

[0085] (6) D6: The cells should be at approximately maximum confluence. Change the medium and add 2.5 mL of 37°C preheated NIM to each well.

[0086] (7) D7: Harvest and expansion of P0 NSCs.

[0087] Figure 2 The cell morphology at different stages during the process of directed induction of neural stem cell differentiation from human embryonic stem cells (H9) is shown. As can be seen from the figure, the cell morphology gradually changes from pluripotent stem cell morphology to neural stem cell morphology, and dense neural stem cell clones can be seen on the 6th to 7th day.

[0088] Application Example 2

[0089] Directed differentiation of human pluripotent stem cells using neural stem cell induction differentiation medium:

[0090] 1. Experimental materials: human embryonic stem cells (BG01);

[0091] 2. Neural stem cell induction differentiation medium (NIM): provided in Example 2;

[0092] 3. Experimental methods:

[0093] (1) D-2: Human embryonic stem cells were incubated with EDTA digestion solution at 37°C and 5% CO2 for 3-5 min to dissociate into single cells. After centrifugation and removal of the supernatant, the cells were resuspended in Essential 8, a human pluripotent stem cell culture medium containing 10 μM Y-27632, and seeded into 12-well plates covered with Matrigel (1:50 dilution) at a cell number of 10,000 cells per well and cultured at 37°C and 5% CO2;

[0094] (2) D-1: The next day, fresh human pluripotent stem cell culture medium Essential 8 (preheated at 37°C) was added, 1 mL per well.

[0095] (3) D0: Start neural induction, aspirate the consumed medium, and add 1.25 mL of 37°C preheated NIM to each well;

[0096] (4) D2: Change the medium and add 1.25 mL of 37°C preheated NIM to each well;

[0097] (5) D4: Change the medium and add 2.5 mL of 37°C preheated NIM to each well;

[0098] (6) D6: The cells should be at approximately maximum confluence. Change the medium and add 2.5 mL of 37°C preheated NIM to each well.

[0099] (7) D7: Harvest and expansion of P0 NSCs.

[0100] Application Example 3

[0101] Directed differentiation of human pluripotent stem cells using neural stem cell induction differentiation medium:

[0102] 1. Experimental materials: human embryonic stem cells (ES06);

[0103] 2. Neural stem cell induction differentiation medium (NIM): provided by Example 3;

[0104] 3. Experimental methods:

[0105] (1) D-2: Human embryonic stem cells were incubated with ReLeSR digestion solution at 37°C and 5% CO2 for 3-5 min to dissociate into single cells. After centrifugation and removal of the supernatant, the cells were resuspended in human pluripotent stem cell culture medium TeSR containing 5 μM Y-27632 and seeded into 12-well plates covered with Matrigel (1:100 dilution) at a cell number of 10,000 cells per well and cultured at 37°C and 5% CO2;

[0106] (2) D-1: The next day, fresh human pluripotent stem cell culture medium TeSR (preheated at 37°C) was added, 1 mL per well.

[0107] (3) D0: Start neural induction, aspirate the consumed medium, and add 1.25 mL of 37°C preheated NIM to each well;

[0108] (4) D2: Change the medium and add 1.25 mL of 37°C preheated NIM to each well;

[0109] (5) D4: Change the medium and add 2.5 mL of 37°C preheated NIM to each well;

[0110] (6) D6: The cells should be at approximately maximum confluence. Change the medium and add 2.5 mL of 37°C preheated NIM to each well.

[0111] (7) D7: Harvest and expansion of P0 NSCs.

[0112] Comparative Example 1

[0113] This comparative example provides a neural stem cell induction differentiation medium, which is different from Example 1 in that it does not contain the CDK8 inhibitor BI-1347.

[0114] The method of Application Example 1 was adopted, and the neural stem cell induction differentiation medium provided in Comparative Example 1 was used to induce differentiation of human pluripotent stem cells H9, and D7 cells were collected.

[0115] Performance testing

[0116] The D7 cells collected from Application Example 1 (the culture medium contains a CDK8 inhibitor, named NSC with BI-1347) and Comparative Example 1 (the culture medium does not contain a CDK8 inhibitor, named NSC w / o BI-1347) were used as experimental objects to compare the differences in the expression of marker genes of neural stem cells obtained under the above two groups of conditions:

[0117] 1. Immunofluorescence detection

[0118] 1. Experimental process:

[0119] After passage, immunofluorescence staining was performed using Certificate of Analysis Human Neural Stem Cell Immunocytochemistry Kit, 1Kit detects four antibodies: SOX2, SOX1, PAX6 and NESTIN (Thermo Fisher, Cat: A24354).

[0120] (1) Fixation: Aspirate the culture medium in the culture plate (provided in Example 1) obtained after differentiation induction, wash once with PBS, and add Fixative Solution to fix at room temperature for 15 min.

[0121] (2) Permeabilization: Aspirate the Fixative Solution and add the Permeabilization Solution at room temperature for 15 min.

[0122] (3) Blocking: Permeabilization Solution, add Blocking Solution, room temperature for 60 minutes.

[0123] (4) Primary antibody incubation: dilute anti-SOX2 (host: rabbit) with Blocking Solution 1:50; dilute anti-NESTIN (host: mouse) with Blocking Solution 1:50 in one well; dilute anti-SOX1 (host: goat) and anti-PAX6 (host: rabbit) with Blocking Solution 1:50 in another well; incubate at 4°C overnight (12h-16h).

[0124] (5) Secondary antibody incubation: remove the primary antibody, wash with PBS three times, 5 min / time, and add Blocking Solution 1:250 diluted Alexa 594donkey anti-rabbit;Alexa 594donkey anti-mouse;Alexa 488donkey anti-goat, Alexa 594donkey anti-rabbit; protect from light, incubate at room temperature for 1 hour, remove secondary antibody, and wash with PBS 3 times, 5 minutes each time.

[0125] (6) DAPI staining of cell nuclei.

[0126] 2. Experimental results:

[0127] The results of immunofluorescence detection of neural stem cell-specific genes SOX2, SOX1, PAX6 and NESTIN under the two groups of conditions are as follows Figure 3 As shown in Table 2:

[0128] Table 2.

[0129]

[0130] Figure 3The immunofluorescence detection images of NSC with BI-1347, where (A) shows the immunofluorescence and fusion images of DAPI, SOX1, and PAX6; (B) shows the immunofluorescence and fusion images of bright field, DAPI, and SOX2; (C) shows the immunofluorescence and fusion images of bright field, DAPI, and NESTIN; among them, DAPI is used to show the location of the cell nucleus. It can be seen that almost all neural stem cells of NSC with BI-1347 express the neural stem cell-specific genes SOX2, SOX1, PAX6, and NESTIN, and the expression ratio is nearly 100%.

[0131] As can be seen from the data in Table 2, the expression ratio and fluorescence intensity of the four specific genes in NSC with BI-1347 are significantly higher than those in NSC w / o BI-1347, indicating that the neural stem cells induced and differentiated in the medium containing CDK8 inhibitors have higher uniformity and purity. This shows that the addition of CDK8 inhibitors to the neural stem cell induction differentiation medium can effectively improve the uniformity and purity of neural cell differentiation.

[0132] 2. RT-qPCR detection

[0133] RNA was extracted from D7 cells using RNA isolater Total RNA Extraction Reagent (Novagen, Cat: R401-01), and cDNA was synthesized using a reverse transcription kit (Novagen, Cat: R412-02). The reaction reagent used was ChamQ Universal SYBR qPCR Master Mix (Novagen, Cat: Q711-02). A 20 μl reaction system was prepared according to the instructions, and raw data collection and quality inspection were completed on the BIO-RAD CFX Connect "Real-Time PCR Detection System (Bio-Rad, Cat: 1855201) instrument.

[0134] The specific QPCR procedure is as follows: first, 95°C, 30 seconds; then 95°C, 10 seconds; 60°C, 30 seconds; 40 cycles of reaction; and finally the dissolution procedure. The expression values ​​of different gene mRNAs are normalized to the GAPDH gene, and the primer information used is shown in Table 3:

[0135] Table 3.

[0136] SEQ ID name sequence SEQ ID NO.1 GAPDH_Forward TGCACCACCAACTGCTTAGC SEQ ID NO.2 GAPDH_Reverse GGCATGGACTGTGGTCATGAG SEQ ID NO.3 SOX1_Forward CAGTACAGCCCCATCTCCAAC SEQ ID NO.4 SOX1_reverse GCGGGCAAGTACATGCTGA SEQ ID NO.5 SOX2_Forward GCCGAGTGGAAACTTTTGTCG SEQ ID NO.6 SOX2_Reverse GGCAGCGTGTACTTATCCTTCT SEQ ID NO.7 PAX6_Forward TGGGCAGGTATTACGAGACTG SEQ ID NO.8 PAX6_Reverse ACTCCCGCTTATACTGGGCTA SEQ ID NO.9 NESTIN_Forward CTGCTACCCTTGAGACACCTG SEQ ID NO.10 NESTIN_Reverse GGGCTCTGATCTCTGCATCTAC

[0137] RT-qPCR results Figure 4As shown in the figure, although the two types of conditionally induced neural stem cells have significantly upregulated the expression of neural stem cell-specific genes relative to H9, the expression values ​​of neural stem cell-specific genes SOX2, SOX1, PAX6 and NESTIN in the conditionally induced neural stem cells containing CDK8 inhibitors (NSC with BI-1347) are significantly higher than those in the conditionally induced neural stem cells without CDK8 inhibitors (NSC w / o BI-1347). This shows that adding CDK8 inhibitors to the neural stem cell induction differentiation medium can effectively enhance the induction effect of neural stem cells.

[0138] 3. Flow Cytometry Analysis

[0139] (1) Fixation / permeabilization: D7 cells were digested with Accutase for 5 minutes and single cells were prepared using BD Pharmingen TM Transcription Factor Buffer Set Kit Fixation / Permeabilization (BD Pharmingen TM , Part Number: 562574)

[0140] (2) Primary antibody incubation: dilute anti-PAX6 (Abcam, catalog number: AB195045, species: Rabbit) 1:1000 in 0.5% BSA PBS buffer, add 100 μL to each tube of cells, and incubate at room temperature for 1 h; wash twice by centrifugation with 1× PBS, and discard the supernatant;

[0141] (3) Secondary antibody incubation: Resuspend the cells in 100 μL of 1 / 2000 diluted donkey anti-rabbit IgG H&L (Alexa Fluor 647)(abcam, catalog number: ab150075), incubate at room temperature in the dark for 30 min; wash twice by centrifugation in 1× PBS and discard the supernatant;

[0142] (4) Resuspend the cells in 200-500 μL 1× PBS and analyze on a flow cytometer.

[0143] The analysis results are as follows Figure 5 As shown, consistent with the RT-qPCR results, the flow cytometry analysis results showed that the PAX6 expression intensity of the neural stem cells induced by the condition containing CDK8 inhibitor (NSC with BI-1347) was significantly higher than that of the neural stem cells induced by the condition without CDK8 inhibitor (NSC w / o BI-1347). This shows that CDK8 inhibitor is a necessary component to enhance the induction effect of neural stem cells.

[0144] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make modifications to the present embodiment without any creative contribution as needed, but such modifications are protected by the patent law as long as they are within the scope of the claims of the present application.

Claims

1. A neural stem cell differentiation induction medium, characterized in that: It consists of a basal medium and additives; The basic culture medium is at least one of DMEM / F12 culture medium and Neurobasal culture medium; The additive consists of the following components: N-2 additive, B-27 additive, glutamine, human leukemia inhibitory factor, GSK-3 inhibitor, ALK inhibitor, γ-secretase inhibitor and CDK8 inhibitor; Wherein, the CDK8 inhibitor is any one of BI-1347, AS2863619 and MSC2530818, and the content of the CDK8 inhibitor is 1 to 4 μM.

2. The neural stem cell induction differentiation medium according to claim 1, characterized in that The additive consists of the following components: 0.5% to 2% of N-2 additive, 1% to 4% of B-27 additive, 1 to 5 mM of glutamine, 5 to 15 ng / mL of human leukemia inhibitory factor, 2 to 8 μM of GSK-3 inhibitor, 2 to 10 μM of ALK inhibitor, 0.05 to 1 μM of γ-secretase inhibitor and 1 to 4 μM of CDK8 inhibitor.

3. The neural stem cell induction differentiation medium according to claim 1, characterized in that The basal culture medium is obtained by mixing DMEM / F12 culture medium and Neurobasal culture medium in a mass ratio of 1:0.5 to 1.

5.

4. The neural stem cell induction differentiation medium according to any one of claims 1 to 3, characterized in that The GSK-3 inhibitor is CHIR99021, SB216763 or CHIR-98014, the ALK inhibitor is at least one of SB431542, LY-364947, SB-505 and A-83-01, and the γ-secretase inhibitor is Compound E.

5. A method for preparing neural stem cells from human pluripotent stem cells, characterized in that: include: The human pluripotent stem cells in a single-cell state are seeded in a culture dish coated with matrix gel; The human pluripotent stem cells are induced to differentiate into neural stem cells within 6-7 days using the neural stem cell induction differentiation medium as described in any one of claims 1-4.

6. The method for preparing neural stem cells from human pluripotent stem cells according to claim 5, characterized in that: The process of inoculating the human pluripotent stem cells into a culture dish covered with matrix gel comprises: The human pluripotent stem cells are dissociated into single cells, resuspended in a human pluripotent stem cell culture medium containing a ROCK inhibitor, and then inoculated into a culture dish covered with matrigel. After cell culture for 12-36 hours, fresh human pluripotent stem cell culture medium is replaced.

7. The method for preparing neural stem cells from human pluripotent stem cells according to claim 6, characterized in that: The ROCK inhibitor is Y-27632, the content of the ROCK inhibitor is 5-10 μM, and the human pluripotent stem cell culture medium is Essential 8, TeSR or PGM1.

8. The method for preparing neural stem cells from human pluripotent stem cells according to claim 6, characterized in that: The step of inducing the human pluripotent stem cells to differentiate into neural stem cells comprises: Prepare the neural stem cell induction differentiation medium as described in any one of claims 1 to 4; The human potential stem cell culture medium is replaced with the neural stem cell induction differentiation medium, and cultured at 36-39° C. and 3-7% CO 2 . The medium is changed on the 2nd, 4th and 6th days respectively, and the preheated neural stem cell induction differentiation medium is added to obtain P0 generation neural stem cells on the 7th day.

9. A kit for preparing neural stem cells, characterized in that: It comprises the neural stem cell induction differentiation medium as described in any one of claims 1 to 4.

10. A neural stem cell, characterized in that It is obtained using the neural stem cell induction differentiation medium described in any one of claims 1-4; or, it is obtained using the method described in any one of claims 5-8.

Images