MMLV reverse transcriptase mutant, preparation method and application

Abstract

The invention discloses an MMLV reverse transcriptase mutant, which belongs to the technical field of biology and is obtained by mutation design of specific sites of wild type MMLV reverse transcriptase. The mutation site comprises one or a combination of more of A32, S56, E69, L139, T163, T197, H204, S232, N249, T306, F309, T330, G424, L435, D449, D524, E562, D583, L603, H642 and T664, and the mutation site comprises one or a combination of more of the A32, the S56, the E69, the L139, the T163, the T197, the H204, the S232, the N249, the T306, the F309, the T330, the G424, the L435, the D449, the Compared with the existing MMLV reverse transcriptase, the MMLV reverse transcription mutant disclosed by the invention has higher reverse transcription temperature and rate. The invention also discloses a preparation method of the MMLV reverse transcriptase mutant and application of the MMLV reverse transcriptase mutant in reverse transcription reaction.

Description

Technical Field

[0001] The invention relates to the field of biological polymerases, and in particular to a MMLV reverse transcriptase mutant.

[0002] The present invention also relates to a method for preparing a MMLV reverse transcriptase mutant;

[0003] The invention also relates to an application of the MMLV reverse transcriptase mutant. Background Art

[0004] Real-time fluorescence quantitative reverse transcription polymerase chain reaction (RT-qPCR) is a technology that can detect the expression level of target genes with high throughput and high efficiency. It consists of two steps. The first step is reverse transcription (RT), which reverse transcribes RNA into cDNA; the second step is qPCR, which uses fluorescent groups to monitor the PCR process in real time. Reverse transcriptase is the key enzyme that converts single-stranded RNA into cDNA. Reverse transcriptase generally has three enzyme activities: RNA-dependent DNA polymerase activity, DNA-dependent DNA polymerase activity and RNase H activity. In the biomedical field, reverse transcriptase is widely used in genome analysis, cDNA library preparation, RNA sequencing, and so on.

[0005] So far, dozens of reverse transcriptases have been discovered, and commonly used reverse transcriptases include Moloney Murine Leukemia virus (M-MLV) reverse transcriptase and avian myeloblastosis virus (AMV) reverse transcriptase. M-MLV reverse transcriptase consists of a polypeptide chain, including an N-terminal polymerase domain and a C-terminal RNase H domain. It generally works at 37℃-42℃ and will be quickly inactivated at high temperatures. AMV reverse transcriptase consists of two subunits and has a higher optimal reaction temperature (45℃-50℃), but compared with M-MLV reverse transcriptase, its cDNA synthesis efficiency is lower and its RNase H activity is stronger, so its application range is smaller than that of M-MLV reverse transcriptase.

[0006] Since single-stranded RNA easily pairs with itself to form complex secondary structures such as hairpins at low temperatures, it has a significant impact on the reverse transcription efficiency of the M-MLV enzyme. The simplest way to open the secondary structure of RNA is to open the hydrogen bonds of the secondary structure at high temperatures, so that the RNA becomes a linear single strand, which is conducive to cDNA synthesis. However, the optimal reaction temperature of the wild-type M-MLV enzyme is 37°C, and its stability and activity decrease at high temperatures, which limits the widespread application of M-MLV reverse transcriptase.

[0007] At present, there are two ways to modify wild M-MLV reverse transcriptase: site-directed mutagenesis and random mutation. One effective modification is to reduce or remove their RNase H activity through point mutation. After removing RNase H activity, the thermal stability is also improved to a certain extent. Another modification is that Thermo Fisher uses ribosome display (RD) and in vitro compartmentalization technology (IVC) for high-throughput screening to obtain mutants with significantly improved thermal stability, and its thermal stability is significantly improved to 50°C. Although these methods have increased the reverse transcription temperature to a certain extent, in fact, it is still far from meeting the application requirements in the field of direct RT-qPCR detection. Therefore, it is crucial to develop an M-MLV reverse transcriptase mutant with higher thermal stability and faster reverse transcription rate. Summary of the invention

[0008] The purpose of the present invention is to provide a MMLV reverse transcriptase mutant in response to the above-mentioned problems.

[0009] The technical solution adopted by the present invention is as follows:

[0010] A MMLV reverse transcriptase mutant, wherein the MMLV reverse transcriptase mutant has a mutation / mutation combination at one or more of the amino acid residues A32, S56, E69, L139, T163, T197, H204, S232, N249, T306, F309, T330, G424, L435, D449, D524, E562, D583, L603, H642, and T664, wherein the amino acid residues correspond to the numbers shown in the amino acid sequence SEQ ID NO.1.

[0011] Furthermore, the mutation combinations of multiple sites of the MMLV reverse transcriptase all include a mutation at the D524G site, and the mutation at this site can reduce the activity of RNAse H and improve the efficiency of cDNA synthesis.

[0012] Furthermore, the MMLV reverse transcriptase mutant comprises the following amino acid substitutions:

[0013] (1) E69K, L139P, T163K, T197A, H204R, S232T, N249D, T306K, F309N, L435R, D449G, D524G; the amino acid sequence is as shown in SEQ ID NO.2, and the corresponding nucleotide sequence is as shown in SEQ ID NO.3;

[0014] (2) E69K, L139P, T163K, T197A, H204R, S232T, N249D, T306K, T330S, G424D, L435R, D449G, D524G, E562Q; the amino acid sequence is as shown in SEQ ID NO.4, and the corresponding nucleotide sequence is as shown in SEQ ID NO.5;

[0015] (3) L139P, T163K, T197A, H204R, S232T, N249D, T306K, F309N, T330S, G424D, L435R, D449G, D524G, E562Q, T664N; the amino acid sequence is as shown in SEQ ID NO. 6, and the corresponding nucleotide sequence is as shown in SEQ ID NO. 7;

[0016] (4) A32V, S56A, H204R, S232T, N249D, T306K, F309N, G424D, L435R, D449G, D524G, D583N, L603W, H642D, T664N; the amino acid sequence is as shown in SEQ ID NO.8, and the corresponding nucleotide sequence is as shown in SEQ ID NO.9;

[0017] (5) A32V, S56A, E69K, L139P, T163K, T197A, H204R, S232T, N249D, T306K, F309N, T330S, G424D, L435R, D449G, D524G, E562Q, D583N, L603W, H642D, T664N. The amino acid sequence is as shown in SEQ ID NO.10, and the corresponding nucleotide sequence is as shown in SEQ ID NO.11;

[0018] Furthermore, the amino acid sequence of the MMLV reverse transcriptase mutant has at least 80% homology with SEQ ID NO.1, preferably, at least 90% homology, and more preferably, an amino acid sequence with more than 95% homology.

[0019] A polynucleotide molecule encoding the nucleotide sequence of the MMLV reverse transcriptase mutant.

[0020] Furthermore, the nucleotide sequence of the MMLV reverse transcriptase mutant is a nucleotide sequence obtained after codon optimization. By codon optimization of the nucleotide sequence, the translation efficiency of the protein can be improved, thereby increasing the expression amount of the protein.

[0021] A recombinant expression vector comprises the nucleotide sequence of the MMLV reverse transcriptase mutant.

[0022] Furthermore, the vector is one of a prokaryotic expression vector, a pET series vector, and a pET-28b*.

[0023] A recombinant host bacterium, wherein the host bacterium comprises a vector containing the nucleotide sequence of the MMLV reverse transcriptase mutant.

[0024] A method for preparing the MMLV reverse transcriptase mutant according to claim 1, comprising:

[0025] Cultivating the host bacteria under suitable conditions and inducing at 18° C. for 16 hours to express the MMLV reverse transcriptase mutant;

[0026] The MMLV reverse transcriptase mutant is isolated and purified.

[0027] Application of MMLV reverse transcriptase mutants in reverse transcription reactions.

[0028] A kit comprising the MMLV reverse transcriptase mutant.

[0029] In summary, due to the adoption of the above technical solution, the beneficial effects of the present invention are:

[0030] 1. The MMLV reverse transcriptase mutant of the present invention can withstand a high temperature of 75°C. At this temperature, the secondary structure of the RNA sample to be reverse transcribed is completely opened, the binding ability of the primer and the sample is improved, the nonspecific binding in the system is reduced, the cDNA synthesis efficiency and the quality of the synthesized cDNA are improved, and when the mutant reverse transcriptase is used for reverse transcription reaction, an efficient reverse transcription reaction can be performed on an RNA template with a complex structure to synthesize higher quality cDNA.

[0031] 2. The MMLV reverse transcriptase mutant of the present invention is resistant to high temperatures and has a fast reverse transcription speed. For ordinary reverse transcription systems, no special reverse transcription procedure is required. A complete cDNA product that can be used for subsequent PCR, qPCR amplification or other further experiments can be synthesized only during the pre-denaturation and temperature rise process before PCR amplification (for complex reverse transcription systems, the reverse transcription time only takes 1 minute). This allows the mutant reverse transcriptase to be used for a wider range of reactions, can be used for rapid cDNA synthesis, and accelerates the detection rate of RT-PCR or RT-qPCR using RNA as a template.

[0032] 3. The MMLV reverse transcriptase mutant of the present invention has good thermal stability and still has high activity after being thermally accelerated at 37° C. for 7 days. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The plasmid map of the present invention for constructing the MMLV-M1 / 2 / 3 / 4 / 5 reverse transcriptase encoding gene sequence into the expression vector pET-28b;

[0034] Figure 2 (a) is a SDS-PAGE image of Ni column affinity purification of MMLV-RT mutants;

[0035] FIG2( b ) is a SP column chromatography SDS-PAGE image of MMLV-RT mutant after Ni affinity purification;

[0036] Figure 2(c) is the SDS-PAGE image of the final MMLV-RT mutant stock solution after E. coli expression and purification. DETAILED DESCRIPTION

[0037] The present invention will be described in detail below in conjunction with the accompanying drawings.

[0038] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0039] The present invention provides a MMLV reverse transcriptase mutant, specifically comprising:

[0040] (1) Construction of MMLV reverse transcriptase mutants:

[0041] In this example, the structure of MMLV was analyzed to obtain amino acid sites that may affect the template binding ability, including A32, S56, E69, L139, T163, T197, H204, S232, N249, T306, F309, T330, G424, L435, D449, D524, E562, D583, L603, H642, and T664. The wild-type MMLV reverse transcriptase, referred to as MMLV-WT, was designed to mutate the aforementioned sites based on SEQ ID NO.1 to obtain an MMLV reverse transcriptase mutant.

[0042] In the present invention, the considerations for site screening are as follows:

[0043] (1) A32, S56, E69, L139, T163, T197, H204, S232, N249, T306, F309, and T330 are the polymerase domain of the primary structure of MMLV reverse transcriptase. Amino acid substitutions at the aforementioned sites can improve the mutant's thermal stability, optimal adaptation temperature, affinity for substrates, and cDNA synthesis efficiency, and reduce sensitivity to inhibitors;

[0044] (2) The G424, L435, and D449 sites are the connection domain of the primary structure of MMLV reverse transcriptase. Amino acid substitutions at the aforementioned sites have an important regulatory function for the overall activity of MMLV reverse transcriptase.

[0045] (3) D524, E562, D583, L603, H642, and T664 are the RNaseH domain of the primary structure of MMLV reverse transcriptase. Amino acid substitutions at the aforementioned sites can reduce the activity of RNAse H and improve thermal stability and cDNA synthesis efficiency.

[0046] In this embodiment, the mutation designs for the screening sites are: A32V, S56A, E69K, L139P, T163K, T197A, H204R, S232T, N249D, T306K, F309N, T330S, G424D, L435R, D449G, D524G, E562Q, D583N, L603W, H642D, and T664N.

[0047] Through molecular docking, a binary complex model of MMLV reverse transcriptase and nucleic acid molecules was constructed, the binding mode of MMLV and nucleic acid molecules was analyzed, and the key amino acid sites were identified based on the binding free energy decomposition of amino acid sites. In order to further improve the thermal stability of reverse transcriptase MMLV, a variety of bioinformatics technologies including electron density analysis, homologous sequence alignment, B-factor analysis, MD conformational change analysis, etc. were used to identify the unstable region of the enzyme. Secondly, FRESCO and Dynamic Disulfide Discovery methods were used to scan the three-dimensional structure of MMLV to identify potential disulfide bond sites. Then, Rosetta and FoldX were used to predict the free energy change of the enzyme before and after mutation. Finally, the mutation site was determined by combining the above information, and MMLV mutants with high activity and strong thermal stability were obtained through mutant screening.

[0048] For the above mutation sites, the specific combinations provided in this embodiment are shown in Table 1 below, and five MMLV reverse transcriptase mutants were obtained, named M1 to M5.

[0049] Table 1 Mutation site combinations

[0050]

[0051] According to the amino acid sequence of the M1-M5 mutant reverse transcriptase, the codons of the E. coli expression system were optimized to obtain a deoxynucleotide sequence that can be efficiently expressed in the E. coli host bacteria, and the DNA molecule encoding the mutant reverse transcriptase was amplified by PCR, as follows:

[0052] Amplification system: 10×Buffer for KOD-Plus-5μL, 2mM dNTPs 5μL, 25mM MgSO4 2μL, final concentration of 0.2μM forward and reverse primers F1 and R1, template 50ng, KOD-Plus-(1.0U / μL), ddH2O supplemented to 50ul.

[0053] The PCR program was 94°C for 2 min; 94°C for 15 s, 58°C for 30 s, 68°C for 1 min (1 min / kb), 25 cycles; 68°C for 5 min; 4°C hold; nucleic acid gel electrophoresis: gel concentration was 1.0%, electrophoresis pressure was 100 V, and time was 30 min. After completion, gel recovery was performed using the Omega nucleic acid gel recovery kit;

[0054] Finally, the target gene of the gel recovery product was connected to the vector pET-28b by homologous recombination to obtain a recombinant vector, such as Figure 1 shown.

[0055] (2) Screening of MMLV reverse transcriptase mutants, as follows:

[0056] Take 4 μL of the obtained recombinant vector and add it to 100ul DH5α competent cells, place it on ice for 30min, heat shock it at 42℃ for 90s, place it on ice for 15min, add 200ul LB, activate it at 37℃ for 1h, and finally take 100ul to plate. Send the plate colony to a third-party company for sequencing to obtain the positive clones with correct sequencing. Cultivate the positive clones and extract the plasmids. The obtained plasmids are the recombinant vectors containing DNA molecules encoding mutant reverse transcriptase.

[0057] (3) Fermentation and purification of MMLV reverse transcriptase mutants, as follows:

[0058] The obtained recombinant vector was transformed into the host cell E. coli Rosetta (DE3), and a single colony was picked and inoculated into liquid LB medium containing 50 μg / mL kanamycin to culture until OD600 was 0.8, IPTG was added to a final concentration of 0.5 mmol / L, induced at 18°C ​​for 16 h, and the bacteria were collected.

[0059] After the collected bacteria were fully resuspended in lysis buffer, they were broken with a cell high-pressure homogenizer, and then centrifuged at 13000g for 20 minutes, centrifuged twice, and the supernatant was purified with a Ni affinity chromatography purification column and collected step by step, and the eluate collected in a single tube was subjected to SDS-PAGE electrophoresis detection; the buffer used in the Ni affinity chromatography process includes: equilibrium buffer, rinsing buffer and gradient elution buffer; the elution peak of the Ni affinity chromatography was subjected to SP ion column chromatography, and the elution peak was collected and dialyzed into a storage buffer (20mM Tris-HCl (pH 8.0), 300mM NaCl, 0.1mM EDTA, 1mM DTT, 0.01% (v / v) NP-40, 50% glycerol), and stored at -20°C. The entire purification process was carried out on ice or at 4°C; mutant MMLV reverse transcriptase was obtained, and the gel image of SDS-PAGE electrophoresis detection of some mutants was shown in Figure 2;

[0060] Figure 2a Lane 1 in the middle is the whole bacterial sample after lysis, lane 2 is the centrifugal precipitate after lysis, lane 3 is the supernatant after lysis (sample before Ni affinity), lane 4 is the flow-through during Ni affinity loading, lane 5 is the eluate during Ni affinity, and lane 6 is the eluate during Ni filler regeneration;

[0061] Figure 2b Lane 1 in the middle is the sample before SP column chromatography, lane 2 is the flow-through when the sample is loaded on the SP column, lane 3 is the eluent 1 during SP column chromatography, lane 4 is the eluent 2 during SP column chromatography, and lane 5 is the eluent during the regeneration of the SP column filler;

[0062] Figure 2c Lane 1 in the middle is MMLV-RT mutant reverse transcriptase; Lane 2 is bovine serum albumin BSA.

[0063] Verification Example 1

[0064] The mutant reverse transcriptase performance test is as follows:

[0065] 1) Thermal activity assay of reverse transcriptase mutants

[0066] The amount of enzyme required to incorporate 1 nmol of dTTP into acid-insoluble substances within 10 minutes at 37°C using Poly(A)-Oligo(dT) as template / primer is defined as 1 activity unit. The enzyme solution after measuring the activity unit concentration is diluted to 200 U / μl using reverse transcriptase storage solution.

[0067] 2) Reverse transcription performance test of mutant reverse transcriptases M1-M5

[0068] The RT-qPCR one-tube method was used to test the Transmissible grastroenteritis virus (TGEV) detection system of a certain company. The commercial MMLV-RT (Company YG) was used as the control group to test the mutant reverse transcriptases M1 to M5. The reverse transcription amplification system and procedure are shown in Tables 2 and 3.

[0069] Table 2 Reverse transcription amplification system

[0070] 10×Buffer for MMLV-RT 2.5μL TGEV-probe mix (100 μM) 0.235μL Taq DNA polymerase (5U / μL) 0.4μL RNase Inhibit (40U / μL) 0.125μL RT (200 U / μL) 0.04μL <![CDATA[ddH2O]]> 16.7μL TGEV Template 5μL

[0071] Table 3 One-step RT-qPCR reaction procedure

[0072]

[0073]

[0074] The test results are shown in Table 4:

[0075] Table 4 Test results

[0076] 50℃ Competitors M1 M2 M3 M4 M5 Template 1 28.668 28.270 28.399 28.278 28.590 27.945 Template 2 31.789 31.195 32.113 31.613 31.746 31.578 Template 3 35.164 34.559 35.157 34.871 34.789 34.614

[0077] The test results show that the reverse transcription performance of the MMLV reverse transcriptase mutants M1 to M5 of this example is comparable to that of competing products in a conventional system and a conventional temperature of 50° C., and the MMLV reverse transcriptase mutants M1 to M5 of this example can adapt to conventional amplification systems and procedures.

[0078] Verification Example 2

[0079] The thermal stability test of the mutant reverse transcriptase is as follows:

[0080] This verification example tests the high temperature reverse transcription performance of mutant reverse transcriptases M1-M5, and tests the competitor and the mutant reverse transcriptases M1-M5 of this example at different reverse transcription temperatures in the TGEV system; the reverse transcription temperature is set at 60-75°C for 10 minutes, with 5°C as an increment unit, a total of 4 gradient increments, and 4 sets of eight-tubes are placed in the Gentier 96E / 96R fully automatic medical PCR detection instrument for testing. The test results are shown in Table 5:

[0081] Table 5 Thermal stability test table

[0082]

[0083]

[0084] The results show that M1-M5 of this example have good thermal stability, among which M1-M5 complete reverse transcription at 60°C, 65°C, 70°C, and 75°C. In particular, M3 and M5 have extremely high thermal stability and can complete reverse transcription at a high temperature of 75°C. The Ct value is 4 earlier than that of the other three mutants and competitors.

[0085] Verification Example 3

[0086] This verification example provides a comparison of the reverse transcription rate of the mutant reverse transcriptase and other similar commercial enzymes, as follows:

[0087] In this verification example, the reverse transcription rate performance of the competitor and the mutant reverse transcriptases M1 to M5 of this example were tested in the TGEV system. The test system was the same as Table 2 of Verification Example 1. The reverse transcription temperature was 50°C, and the reverse transcription time was set to 5min, 3min, 1min, and 0min for testing. The test results are shown in Table 6 below:

[0088] Table 6 Reverse transcription rate test table of mutant reverse transcriptase and other similar commercial enzymes

[0089] 5min Competitors M1 M2 M3 M4 M5 Template 1 28.020 27.895 27.852 27.750 28.090 28.004 Template 2 31.582 31.535 31.446 31.590 32.137 34.621 Template 3 34.996 34.657 34.539 34.973 35.254 34.641 3min Competitors M1 M2 M3 M4 M5 Template 1 28.875 29.754 27.719 27.645 28.875 28.199 Template 2 32.309 32.864 30.988 31.430 32.309 31.711 Template 3 35.895 35.817 34.121 35.223 35.895 34.563 1min Competitors M1 M2 M3 M4 M5 Template 1 29.883 29.672 28.087 28.598 28.879 28.295 Template 2 33.441 33.274 31.285 32.145 32.731 31.655 Template 3 37.133 36.211 34.565 35.434 35.645 34.949 0min Competitors M1 M2 M3 M4 M5 Template 1 30.098 30.270 28.133 28.891 29.836 28.586 Template 2 33.852 34.098 31.493 32.949 34.161 31.826 Template 3 36.426 37.352 34.857 36.407 37.242 35.203

[0090] The results show that compared with other similar commercial enzymes on the market, the mutant reverse transcriptases M2 and M5 of this example have the smallest Ct values, proving that the mutant reverse transcriptase of this example has stronger reverse transcription ability and faster speed in generating cDNA by reverse transcription.

[0091] Verification Example 4

[0092] Storage stability of reverse transcriptase mutants was determined as follows:

[0093] The reverse transcriptase mutant was diluted to the storage concentration and placed in a 37°C oven for 7 days to test its storage stability. The RT-qPCR one-tube method was used to test the TGEV detection system of a certain company's transmissible grastroenteritis virus. After 7 days at 37 degrees, the results of the competitor reverse transcriptase Company YG and the mutant reverse transcriptase are shown in Table 7.

[0094] Table 7 Storage stability test table of reverse transcriptase mutants

[0095]

[0096] It can be seen that the Ct values ​​of the competitor Company YG-RT and the reverse transcriptase mutants M3 and M5 of this example are consistent before and after thermal acceleration, and it is believed that the change of the mutation site of M3 and M5 is beneficial to storage stability.

[0097] In summary, the M5 mutant has extremely high thermal stability and can complete reverse transcription at a high temperature of 75°C. It also performs well in thermal stability, reverse transcription ability and speed, and storage stability.

[0098] The term "nucleic acid" or "nucleic acid sequence" herein refers to any molecule, preferably a polymeric molecule, comprising ribonucleic acid, deoxyribonucleic acid or analog units thereof. The nucleic acid may be single-stranded or double-stranded. A single-stranded nucleic acid may be a nucleic acid of one strand of a denatured double-stranded DNA. Alternatively, a single-stranded nucleic acid may be a single-stranded nucleic acid that is not derived from any double-stranded DNA.

[0099] The principles and implementation methods of the present invention are described in this article using specific embodiments. The description of the above embodiments is only used to help understand the method and core ideas of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made to the present invention without departing from the principles of the present invention, and these improvements and modifications also fall within the scope of protection of the claims of the present invention.

[0100] The sequences mentioned in this article are as follows:

[0101] SEQ ID NO.1 (wild-type MMLV enzyme amino acid sequence):

[0102] TLNIEDEYRLHETSKEPDVSLGSTWLSDFPQAWAETGGMGLAVRQAPLIIPLKATSTPVSIKQYPMSQEARLGIKPHIQRLLDQGILVPCQSPWNTPLLPVKKPGTNDYRPVQDLREVNKRVEDIHPTVPNPYNLLSGLPPSHQWYTVLDLKDAFFCLRLHPTSQPLFAFEWRDPEMGISGQLTWTRLPQGFKNSPTLFDEALHRDLADFRIQHPDLILLQYVDDLLLAATSELDCQQGTRALLQTLGNLGYRASAKKAQICQKQVKYLGYLLKEGQRWLTEARKETVMGQPTPKTPRQLREFLGTAGFCRLWIPGFAEMAAPLYPLTKTGTLFNWGPDQQKAYQEIKQALLTAPALGLPDLTKPFELFVDEKQGYAKGVLTQKLGPWRRPVAYLSKKLDPVAAGWPPCLRMVAAIAVLTKDAGKLTMGQPLVILAPHAVEALVKQPPDRWLSNARMTHYQALLLDTDRVQFGPVVALNPATLLPLPEEGLQHNCLDILAEAHGTRPDLTDQPLPDADHTWYTDGSSLLQEGQRKAGAAVTTETEVIWAKALPAGTSAQRAELIALTQALKMAEGKKLNVYTDSRYAFATAHIHGEIYRRRGLLTSEGKEIKNKDEILALLKALFLPKRLSIIHCPGHQKGHSAEARGNRMADQAARKAAITETPDTSTLLIENSSPNSRLIN*

[0103] SEQ ID NO.2 (Amino acid sequence of MMLV-M1 mutant)

[0104] TLNIEDEYRLHETSKEPDVSLGSTWLSDFPQAWAETGGMGLAVRQAPLIIPLKATSTPVSIKQYPMSQKARLGIKPHIQRLLDQGILVPCQSPWNTPLLPVKKPGTNDYRPVQDLREVNKRVEDIHPTVPNPYNLLSGPPPSHQWYTVLDLKDAFFCLRLHPKSQPLFAFEWRDPEMGISGQLTWTRLPQGFKNSPALFDEALRRDLADFRIQHPDLILLQYVDDLLLAATTELDCQQGTRALLQTLGDLGYRASAKKAQICQKQVKYLGYLLKEGQRWLTEARKETVMGQPTPKTPRQLREFLGKAGNCRLWIPGFAEMAAPLYPLTKTGTLFNWGPDQQKAYQEIKQALLTAPALGLPDLTKPFELFVDEKQGYAKGVLTQKLGPWRRPVAYLSKKLDPVAAGWPPCLRMVAAIAVLTKDAGKLTMGQPLVIRAPHAVEALVKQPPGRWLSNARMTHYQALLLDTDRVQFGPVVALNPATLLPLPEEGLQHNCLDILAEAHGTRPDLTDQPLPDADHTWYTGGSSLLQEGQRKAGAAVTTETEVIWAKALPAGTSAQRAELIALTQALKMAEGKKLNVYTDSRYAFATAHIHGEIYRRRGLLTSEGKEIKNKDEILALLKALFLPKRLSIIHCPGHQKGHSAEARGNRMADQAARKAAITETPDTSTLLIENSSPNSRLINSEQ ID NO.3 (Nucleotide sequence of MMLV-M1 mutant)

[0105]

[0106] TLNIEDEYRLHETSKEPDVSLGSTWLSDFPQAWAETGGMGLAVRQAPLIIPLKATSTPVSIKQYPMSQKARLGIKPHIQRLLDQGILVPCQSPWNTPLLPVKKPGTNDYRPVQDLREVNKRVEDIHPTVPNPYNLLSGPPPSHQWYTVLDLKDAFFCLRLHPKSQPLFAFEWRDPEMGISGQLTWTRLPQGFKNSPALFDEALRRDLADFRIQHPDLILLQYVDDLLLAATTELDCQQGTRALLQTLGDLGYRASAKKAQICQKQVKYLGYLLKEGQRWLTEARKETVMGQPTPKTPRQLREFLGKAGFCRLWIPGFAEMAAPLYPLTKSGTLFNWGPDQQKAYQEIKQALLTAPALGLPDLTKPFELFVDEKQGYAKGVLTQKLGPWRRPVAYLSKKLDPVAAGWPPCLRMVAAIAVLTKDADKLTMGQPLVIRAPHAVEALVKQPPGRWLSNARMTHYQALLLDTDRVQFGPVVALNPATLLPLPEEGLQHNCLDILAEAHGTRPDLTDQPLPDADHTWYTGGSSLLQEGQRKAGAAVTTETEVIWAKALPAGTSAQRAQLIALTQALKMAEGKKLNVYTDSRYAFATAHIHGEIYRRRGLLTSEGKEIKNKDEILALLKALFLPKRLSIIHCPGHQKGHSAEARGNRMADQAARKAAITETPDTSTLLIENSSPNSRLINSEQ ID NO.5 (Nucleotide sequence of MMLV-M2 mutant)

[0107] ACCCTGAATATCGAAGATGAATACCGCCTGCATGAAACCTCCAAAGAACCGGATGTTTCCCTGGGTTCTACCTGGCTGTCTGATTTCCCGCAGGCATGGGCTGAAACTGGTGGCATGGGTCTGGCGGTGCGTCAGGCACCACTGATCATCCCGCTGAAAGCGACCTCTACTCCAGTGTCTATCAAACAGTATCCGATGAGCCAAAAAGCGCGCCTGGGTATTAAACCGCACATCCAGCGTCTGCTGGACCAGGGTATTCTGGTACCATGCCAATCTCCGTGGAACACCCCGCTGCTGCCGGTCAAAAAACCGGGCACTAACGATTACCGTCCGGTACAGGACCTGCGTGAAGTTAACAAACGTGTTGAGGACATCCACCCGACTGTTCCGAACCCGTATAACCTGCTGTCTGGTCCGCCGCCAAGCCAC

[0108] CAGTGGTATACTGTGCTGGATCTGAAAGATGCGTTCTTCTGCCTGCGTCTGCACC

[0109] CGAAATCTCAGCCGCTGTTCGCATTCGAATGGCGTGATCCTGAGATGGGCATCT

[0110] CTGGCCAACTGACCTGGACCCGTCTGCCGCAGGGCTTCAAAAATTCTCCGGCA

[0111] CTGTTTGACGAAGCGCTGCGCCGTGACCTGGCTGACTTTCGTATCCAGCACCCA

[0112] GATCTGATCCTGCTGCAGTACGTTGATGATCTGCTGCTGGCTGCAACCACCGAA

[0113] CTGGACTGCCAGCAGGGTACTCGCGCGCTGCTGCAGACCCTGGGTGATCTGGG

[0114] CTACCGCGCTAGCGCAAAAAAAGCTCAGATCTGTCAGAAACAGGTGAAGTACC

[0115] TGGGCTACCTGCTGAAAGAAGGTCAGCGCTGGCTGACTGAAGCTCGTAAAGAG

[0116] ACCGTCATGGGTCAGCCGACTCCGAAAACTCCGCGTCAGCTGCGCGAGTTCCT

[0117] GGGTAAAGCGGGCTTTTGTCGCCTGTGGATCCCGGGTTTTGCGGAAATGGCTGC

[0118] GCCGCTGTATCCACTGACGAAAAGCGGTACCCTGTTCAACTGGGGTCCGGACC

[0119] AGCAGAAAGCATACCAGGAGATCAAGCAAGCTCTGCTGACCGCACCAGCCCTG

[0120] GGTCTGCCTGACCTGACCAAACCGTTTGAACTGTTCGTTGACGAAAAACAGGG

[0121] TTACGCCAAGGGCGTACTGACCCAGAAACTGGGTCCGTGGCGTCGCCCGGTAG

[0122] CGTATCTGTCTAAAAAACTGGACCCTGTTGCTGCAGGTTGGCCTCCGTGTCTGC

[0123] GTATGGTAGCAGCGATCGCTGTGCTGACCAAGGACGCCGATAAGCTGACTATGG

[0124] GCCAGCCACTGGTTATCCGTGCTCCGCACGCCGTCGAAGCACTGGTCAAACAG

[0125] CCTCCGGGTCGTTGGCTGAGCAATGCTCGTATGACCCATTACCAGGCGCTGCTG

[0126] CTGGATACGGATCGTGTACAGTTCGGCCCGGTTGTTGCTCTGAACCCGGCGACT

[0127] CTGCTGCCTCTGCCTGAAGAGGGTCTGCAGCACAACTGTCTGGACATTCTGGCT

[0128] GAAGCCCACGGTACCCGTCCGGATCTGACCGATCAACCGCTGCCTGACGCGGA

[0129] CCATACCTGGTACACCGGCGGTTCTTCCCTGCTGCAGGAAGGTCAGCGCAAAGC

[0130] TGGTGCAGCGGTCACTACTGAAACCGAAGTTATTTGGGCGAAAGCCCTGCCTGC

[0131] CGGTACCTCTGCTCAGCGTGCCCAGCTGATCGCACTGACCCAGGCGCTGAAGAT

[0132] GGCCGAGGGCAAAAAGCTGAACGTGTACACCGACAGCCGCTACGCTTTCGCGA

[0133] CGGCACACATCCACGGCGAAATCTACCGTCGTCGCGGTCTGCTGACCTCCGAAG

[0134] GTAAGGAAATCAAAAACAAAGATGAGATTCTGGCACTGCTGAAAGCACTGTTC

[0135] CTGCCGAAACGTCTGAGCATCATCCACTGCCCGGGTCACCAGAAAGGCCACTC

[0136] CGCAGAAGCGCGTGGTAACCGCATGGCAGATCAGGCAGCTCGTAAAGCAGCGA

[0137] TCACTGAAACCCCGGACACTTCCACCCTGCTGATTGAAAACTCTTCCCCGAATA

[0138] GCCGCCTGATTAAC

[0139] SEQ ID NO.6 (Amino acid sequence of MMLV-M3 mutant)

[0140] TLNIEDEYRLHETSKEPDVSLGSTWLSDFPQAWAETGGMGLAVRQAPLIIPLKATSTPVSIKQYPMSQEARLGIKPHIQRLLDQGILVPCQSPWNTPLLPVKKPGTNDYRPVQDLREVNKRVEDIHPTVPNPYNLLSGPPPSHQWYTVLDLKDAFFCLRLHPKSQPLFAFEWRDPEMGISGQLTWTRLPQGFKNSPALFDEALRRDLADFRIQHPDLILLQYVDDLLLAATTELDCQQGTRALLQTLGDLGYRASAKKAQICQKQVKYLGYLLKEGQRWLTEARKETVMGQPTPKTPRQLREFLGKAGNCRLWIPGFAEMAAPLYPLTKSGTLFNWGPDQQKAYQEIKQALLTAPALGLPDLTKPFELFVDEKQGYAKGVLTQKLGPWRRPVAYLSKKLDPVAAGWPPCLRMVAAIAVLTKDADKLTMGQPLVIRAPHAVEALVKQPPGRWLSNARMTHYQALLLDTDRVQFGPVVALNPATLLPLPEEGLQHNCLDILAEAHGTRPDLTDQPLPDADHTWYTGGSSLLQEGQRKAGAAVTTETEVIWAKALPAGTSAQRAQLIALTQALKMAEGKKLNVYTDSRYAFATAHIHGEIYRRRGLLTSEGKEIKNKDEILALLKALFLPKRLSIIHCPGHQKGHSAEARGNRMADQAARKAAITENPDTSTLLIENSSPNSRLINSEQ ID NO.7 (Nucleotide sequence of MMLV-M3 mutant)

[0141]

[0142] TLNIEDEYRLHETSKEPDVSLGSTWLSDFPQVWAETGGMGLAVRQAPLIIPLKATATPVSIKQYPMSQEARLGIKPHIQRLLDQGILVPCQSPWNTPLLPVKKPGTNDYRPVQDLREVNKRVEDIHPTVPNPYNLLSGLPPSHQWYTVLDLKDAFFCLRLHPTSQPLFAFEWRDPEMGISGQLTWTRLPQGFKNSPTLFDEALRRDLADFRIQHPDLILLQYVDDLLLAATTELDCQQGTRALLQTLGDLGYRASAKKAQICQKQVKYLGYLLKEGQRWLTEARKETVMGQPTPKTPRQLREFLGKAGNCRLWIPGFAEMAAPLYPLTKTGTLFNWGPDQQKAYQEIKQALLTAPALGLPDLTKPFELFVDEKQGYAKGVLTQKLGPWRRPVAYLSKKLDPVAAGWPPCLRMVAAIAVLTKDADKLTMGQPLVIRAPHAVEALVKQPPGRWLSNARMTHYQALLLDTDRVQFGPVVALNPATLLPLPEEGLQHNCLDILAEAHGTRPDLTDQPLPDADHTWYTGGSSLLQEGQRKAGAAVTTETEVIWAKALPAGTSAQRAELIALTQALKMAEGKKLNVYTNSRYAFATAHIHGEIYRRRGWLTSEGKEIKNKDEILALLKALFLPKRLSIIHCPGHQKGDSAEARGNRMADQAARKAAITENPDTSTLLIENSSPNSRLINSEQ ID NO.9 (Nucleotide sequence of MMLV-M4 mutant)

[0143]

[0144] TLNIEDEYRLHETSKEPDVSLGSTWLSDFPQVWAETGGMGLAVRQAPLIIPLKATATPVSIKQYPMSQKARLGIKPHIQRLLDQGILVPCQSPWNTPLLPVKKPGTNDYRPVQDLREVNKRVEDIHPTVPNPYNLLSGPPPSHQWYTVLDLKDAFFCLRLHPKSQPLFAFEWRDPEMGISGQLTWTRLPQGFKNSPALFDEALRRDLADFRIQHPDLILLQYVDDLLLAATTELDCQQGTRALLQTLGDLGYRASAKKAQICQKQVKYLGYLLKEGQRWLTEARKETVMGQPTPKTPRQLREFLGKAGNCRLWIPGFAEMAAPLYPLTKSGTLFNWGPDQQKAYQEIKQALLTAPALGLPDLTKPFELFVDEKQGYAKGVLTQKLGPWRRPVAYLSKKLDPVAAGWPPCLRMVAAIAVLTKDADKLTMGQPLVIRAPHAVEALVKQPPGRWLSNARMTHYQALLLDTDRVQFGPVVALNPATLLPLPEEGLQHNCLDILAEAHGTRPDLTDQPLPDADHTWYTGGSSLLQEGQRKAGAAVTTETEVIWAKALPAGTSAQRAQLIALTQALKMAEGKKLNVYTNSRYAFATAHIHGEIYRRRGWLTSEGKEIKNKDEILALLKALFLPKRLSIIHCPGHQKGDSAEARGNRMADQAARKAAITENPDTSTLLIENSSPNSRLINSEQ ID NO.11 (Nucleotide sequence of MMLV-M5 mutant)

[0145]

Claims

1. A MMLV reverse transcriptase mutant, characterized in that: The MMLV reverse transcriptase mutant has a mutation / mutation combination at one or more amino acid residues A32, S56, E69, L139, T163, T197, H204, S232, N249, T306, F309, T330, G424, L435, D449, D524, E562, D583, L603, H642, and T664, wherein the amino acid residues correspond to the numbers shown in the amino acid sequence SEQ ID NO.

1.

2. The MMLV reverse transcriptase mutant according to claim 1, characterized in that: The mutation combinations of multiple sites of the MMLV reverse transcriptase all include the D524G site.

3. The MMLV reverse transcriptase mutant according to claim 1, characterized in that: The MMLV reverse transcriptase mutant comprises amino acid substitutions at sites A32V, S56A, E69K, L139P, T163K, T197A, H204R, S232T, N249D, T306K, F309N, T330S, G424D, L435R, D449G, D524G, E562Q, D583N, L603W, H642D, and T664N, and the corresponding amino acid sequence of the mutant is shown in SEQ ID NO.

10.

4. A polynucleotide molecule, characterized in that The polynucleotide molecule encodes the nucleotide sequence of the MMLV reverse transcriptase mutant according to claim 1.

5. A recombinant expression vector, characterized in that: The vector comprises the nucleotide sequence of the MMLV reverse transcriptase mutant according to claim 1.

6. A recombinant expression vector according to claim 5, characterized in that: The vector is one of a prokaryotic expression vector, a pET series vector, and a pET-28b*.

7. A recombinant host bacterium, characterized in that: The host bacteria comprises the recombinant expression vector as claimed in claim 5.

8. A method for preparing the MMLV reverse transcriptase mutant according to claim 1, characterized in that: include: Cultivating the host bacteria according to claim 7 under suitable conditions and inducing at 18° C. for 16 h, thereby expressing the MMLV reverse transcriptase mutant; The MMLV reverse transcriptase mutant is isolated and purified.

9. Use of the MMLV reverse transcriptase mutant according to claim 1 in a reverse transcription reaction.

10. A kit, characterized in that: The kit comprises the MMLV reverse transcriptase mutant according to claim 1.

Images