Application of rice OsLVN6 gene in improvement of spike neck large vascular bundle number and yield

Abstract

The invention discloses application of a rice OsLVN6 gene in improving the number of large vascular bundles of spike necks and increasing the yield, and relates to the technical field of plant genetic engineering. The key points of the technical scheme are as follows: a nucleotide sequence of a coding region of the OsLVN6 gene is shown as SEQ ID NO.4; or a nucleotide sequence which is obtained by replacing, deleting and inserting one or more nucleotides in the nucleotide sequence as shown in SEQ ID NO.5 and expresses protein with the same function. The OsLVN6 excellent allele is introduced into japonica rice which does not carry the gene, so that the spike neck large vascular bundle number, the primary branch number and the secondary branch number of the japonica rice can be improved, and the grain number per spike and the yield are further improved.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and more specifically to the application of rice OsLVN6 gene in improving the number of large vascular bundles at the panicle neck and increasing yield. Background Art

[0002] The level of rice yield is mainly determined by the strength of the source, sink, and flow and the degree of coordination between them. Among them, the panicle neck vascular bundle is usually regarded as a "flow" trait for transporting assimilates from leaves to panicles. Its number, size, and function directly affect the transfer of photosynthetic products to grains, and it is the anatomical basis for a large sink and smooth flow. The number of large vascular bundles at the panicle neck is significantly positively correlated with the number of primary branches, the number of grains on primary branches, the number of secondary branches, the number of grains on secondary branches, and the number of grains per panicle, indicating that the number of large vascular bundles at the panicle neck is the basis for the formation of large panicles. For most japonica rice varieties, the large vascular bundles at the panicle neck are directly connected to the primary branches, resulting in a ratio of the number of large vascular bundles to the number of primary branches close to 1.0. Since japonica rice has fewer large vascular bundles at the panicle neck, the upper limit of the number of primary branches is relatively low. Therefore, northern japonica rice varieties with large panicles generally rely on increasing the number of grains on secondary branches to increase yield. However, compared with primary branch grains, the empty rate of secondary branch grains is generally high, which often results in a low fruit set rate in large panicle japonica rice varieties. This may be the anatomical basis for the small number of large panicle japonica rice varieties in the past. Therefore, discovering the gene for the number of large vascular bundles at the panicle neck and applying it to japonica rice breeding is an important part of breeding high-yield japonica rice varieties with smooth "flow" and more primary branches.

[0003] In recent years, some quantitative trait loci (QTLs) affecting the number of large vascular bundles at the panicle neck of rice have been located using recombinant inbred lines and DH populations constructed from both parents. At the same time, some genes regulating the number of large vascular bundles at the panicle neck have been cloned, such as OsNAC2, APO1, qLVB9 and NAL1. The cloning of these vascular bundle genes helps to deepen the understanding of vascular bundle-related traits and is conducive to achieving the goal of increasing yield through genetic regulation of the number of large vascular bundles at the panicle neck.

[0004] However, there is no detailed report on the application of superior alleles for improving the number of large vascular bundles at the panicle neck to increase yield; therefore, the present invention aims to provide an application of rice OsLVN6 gene in improving the number of large vascular bundles at the panicle neck and increasing yield. Summary of the invention

[0005] The purpose of the present invention is to provide an application of the rice OsLVN6 gene in improving the number of large vascular bundles at the panicle neck and increasing yield. The present invention can improve the number of large vascular bundles at the panicle neck, the number of primary branches and the number of secondary branches by introducing the OsLVN6 superior allele into japonica rice that does not carry the gene, thereby increasing the number of grains per panicle and the yield.

[0006] The above technical purpose of the present invention is achieved through the following technical scheme: a rice OsLVN6 gene, the nucleotide sequence of the coding region of the OsLVN6 gene is a nucleotide sequence shown in SEQ ID NO.4, which is replaced, deleted, or inserted with one or more nucleotides and expresses a nucleotide sequence of a protein with the same function.

[0007] The present invention also provides a protein, the coding gene of the protein is the OsLVN6 gene, and the amino acid sequence of the protein is shown in SEQ ID NO.5.

[0008] The invention also provides application of rice OsLVN6 gene or protein in regulating the number of large vascular bundles at the panicle neck of rice and yield.

[0009] The present invention is further configured as follows: the application is to reduce the number and yield of large vascular bundles at the ear neck by knocking out the OsLVN6 gene, or to increase the number and yield of large vascular bundles at the ear neck by overexpressing the nucleotide sequence of the protein encoding the OsLVN6 gene.

[0010] The invention also provides application of rice OsLVN6 gene or protein in rice breeding.

[0011] The present invention also provides a method for breeding rice varieties with more large vascular bundles at the panicle neck and higher yield, which is characterized by: using genetic engineering means or conventional hybridization means to introduce the rice OsLVN6 gene into japonica rice that does not carry the gene to improve its large vascular bundles at the panicle neck, the number of primary branches and the number of secondary branches, thereby increasing the number of grains per panicle and the yield.

[0012] In summary, the present invention has the following beneficial effects:

[0013] The present invention discloses for the first time the function of the OsLVN6 gene on the number of large vascular bundles at the panicle neck and the yield of rice. After knocking out the gene in rice, the number of large vascular bundles at the panicle neck, the number of primary peduncles, the number of secondary peduncles, the number of grains per panicle and the yield are significantly reduced; after overexpressing the gene, the number of large vascular bundles at the panicle neck, the number of primary peduncles, the number of secondary peduncles, the number of grains per panicle and the yield are significantly increased; and introducing the OsLVN6 gene into japonica rice that does not carry the gene by conventional hybridization means can improve the number of large vascular bundles at the panicle neck, the number of primary peduncles and the number of secondary peduncles, thereby increasing the number of grains per panicle and the yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1Schematic diagram of the mining results of the gene OsLVN6 for the number of large vascular bundles at the ear neck in the embodiment of the present invention ((A) is a Manhattan plot and a QQ plot of the whole genome association analysis to locate the QTL related to the number of large vascular bundles at the ear neck; (B) is a diagram of the interval range of qLVN6 delineated by linkage disequilibrium analysis; (C) is a schematic diagram of the candidate gene association analysis for the candidate interval to locate the gene OsLVN6 for the number of large vascular bundles at the ear neck);

[0015] Figure 2 Schematic diagram of the results of mining excellent haplotypes of the OsLVN6 gene in the spike neck large vascular bundle number trait in the embodiment of the present invention ((A) is a diagram of the typing results of the OsLVN6 gene in 423 germplasm resources; (B) is a schematic diagram of haplotype analysis mining of excellent alleles affecting OsLVN6);

[0016] Figure 3 Schematic diagram of the phenotypic results of wild-type G209 and knockout transgenic lines in the embodiment of the present invention in terms of the number of large vascular bundles at the ear neck and yield-related traits ((A) is a schematic diagram of constructing wild-type G209 and knockout transgenic homozygous lines; (BC) is a phenotypic diagram of the number of large vascular bundles at the ear neck of wild-type G209 and knockout transgenic lines; (DF) is a schematic diagram of the performance of wild-type G209 and knockout transgenic lines in terms of the number of primary branches (D), the number of secondary branches (D), the number of grains per ear (E) and the yield (F));

[0017] Figure 4 Schematic diagram of the phenotypic results of wild-type C616 and overexpression transgenic lines in the embodiment of the present invention in terms of the number of large vascular bundles at the ear neck and yield-related traits ((A) is a schematic diagram of the construction of wild-type C616 and overexpression transgenic homozygous lines; (B) is an identification diagram of the expression level of the OsLVN6 gene in C616 and overexpression transgenic lines; (CD) is a phenotypic diagram of the number of large vascular bundles at the ear neck of wild-type C616 and overexpression transgenic lines; (EG) is a schematic diagram of the performance of wild-type C616 and overexpression transgenic lines in terms of the number of primary branches (E), the number of secondary branches (E), the number of grains per ear (F) and the yield (G));

[0018] Figure 5 It is a phenotypic result diagram of the control variety Zhongnongjing 11 in the embodiment of the present invention and the number of large vascular bundles at the neck of the ear, the number of primary branches and stalks, the number of secondary branches and stalks, the number of grains per ear and the yield per plant after the OsLVN6 gene was introduced. DETAILED DESCRIPTION

[0019] The following is combined with Figure 1-5 The present invention is described in further detail.

[0020] Example 1: Mining of the rice panicle neck large vascular bundle number gene OsLVN6

[0021] The planting materials of this embodiment are 423 germplasm resources from different countries with relatively close heading periods, which were selected from the resequencing 3K germplasm resources taking into account the genetic diversity of the germplasm resource materials, including 301 indica rice, 79 japonica rice, 17 intermediate rice, 10 Basmati and 16 Aus.

[0022] In the phenotypic identification of the number of large vascular bundles at the panicle neck, samples were taken at the heading stage of rice growth. The main stems of 5 plants with consistent growth were taken from each material. The sections were cut manually 2 cm above the nodes of the panicle neck and preserved in the FAA fixative prepared in advance. The number of large vascular bundles at the panicle neck was observed and counted under a microscope.

[0023] In the process of genotype screening and analysis, this example retrieved 27K high-quality SNP genotype data of 423 test materials from the Rice SNP-Seek Database constructed by the 3K rice resequencing project and used Tassel 5 to perform quality control on the selected genotypes (MAF>5%, GENO<20%). Finally, 26,097 high-quality SNPs were retained for subsequent analysis, including principal component analysis (PCA) and kinship matrix analysis (Kinship) using Tassel 5.

[0024] In the process of mining the gene OsLVN6 for the number of large vascular bundles at the spike neck, this example uses the calculated PCA and Kinship as covariates, and uses a mixed linear model (MLM) to perform a genome-wide association study (GWAS) between SNP markers and phenotypic values. A major QTL qLVN6 ( Figure 1 A), and the QTL was delineated within a 370 kb interval by linkage disequilibrium block plot analysis ( Figure 1 B), the gene related to the number of large vascular bundles in the neck of the panicle has not been cloned in this interval. In this example, the high-density SNPs located in the CDS region of all candidate genes in this interval were retrieved, and the main effect candidate gene LOC_Os06g47150 affecting the number of large vascular bundles in the neck of the panicle in this interval was screened based on the association analysis of the candidate genes. This gene was named Number of Large Vascular Bundles 6 (OsLVN6) in this example. Figure 1 C).

[0025] Example 2: Mining excellent haplotypes of OsLVN6 gene

[0026] In this example, 423 germplasms were typed by genotyping using differential non-synonymous SNPs on the gene. The gene had 7 haplotypes. Haplotype Hap1 was mainly found in indica rice, haplotypes Hap2 and Hap3 were mainly found in japonica rice, and the number of individuals with other haplotypes was relatively small ( Figure 2 A).

[0027] In the variance analysis of the phenotypic values ​​of different haplotypes in japonica rice, the average phenotypic value of japonica rice Hap2 was significantly higher than that of Hap3. The results showed that OsLVN6 is likely to be the major gene regulating the number of large vascular bundles at the panicle neck in the japonica rice subpopulation, and haplotype Hap2 is its superior haplotype ( Figure 2 B).

[0028] Example 3: The number of large vascular bundles at the spike neck was significantly reduced after knocking out the OsLVN6 gene

[0029] In the construction of knockout transgenic materials, in order to verify the function of the gene on the number of large vascular bundles at the panicle neck, the temperate japonica rice G209 carrying the dominant haplotype Hap2 was selected as the knockout receptor, and the reference genome nucleotide sequence of the rice large vascular bundle number gene OsLVN6 (SEQ ID NO.1) was searched:

[0030]

[0031] Primers were designed based on the reference genome sequence (G209-F: cagtGGTCTCatgcagcaccacctccacgctctag, SEQ ID NO.2; G209-R: cagtGGTCTCaaaaccgcgattctgcgcaagcctc, SEQ ID NO.3), and the superior allele sequence of OsLVN6 in the G209 material carrying the superior haplotype was specifically amplified (SEQ ID NO.4):

[0032]

[0033] The protein sequence translated from this nucleotide is shown below (SEQ ID NO.5):

[0034] MITFVDSAAKERERESDKCLDPQLWHACAGGMVQMPPVSSKVYYFPQGHAEHAQGHGPVEFPGGRVPALVLCRVAGVRFMADPDTDEVFAKIRLVPVRANEQGYAGDADDGIGAAAAAAAQEEKPASFAKTLTQSDANNGGGFSVPRYCAETIFPRLDYSADPPVQTVLAKDVHGVVWKFRHIYRGTPRRHLLTTGWSTFVNQKKLVAGDSIVFMRTENGDLCVGIRRAKKGGVGGPEFLPPPPPPPPTPAAGGNYGGFSMFLRGDDDGNKMAAAARGKVRARVRPEEVVEAANLAVSGQPFEVVYYPRASTPEFCVKAGAVRAAMRTQWFAGMRFKMAFETEDSSRISWFMGTVSAVQVADPIRWPNSPWRLLQVSWDEPDLLQNVKRVSPWLVELVSNMPAIHLAPFSPPRKKLCVPLYPELPIDGQFPTPMFHGNPLARGVGPMCYFPDGTPAGIQGARHAQFGISLSDLHLNKLQSSLSPHGLHQLDHGMQPRIAAGLIIGHPAARDDISCLLTIGSPQNNKKSDGKKAPAQMMLFGKPILTEQQISLGDAASVDVKKSSSDGNAENTVNKSNSDVSSPRSNQNGTTDNLSCGGVPLCQDNKVLDVGLETGHCKVFMQSEDVGRTLDLSVVGSYEELYRRLADMFGIEKAELMSHVFYRDAAGALKHTGDEPFSEFTKTARRLNILTDTSGDNLAR*(SEQ ID NO.5).

[0035] The knockout target was designed based on the sequence, and the target was ccaaggtgtactacttcccgcaa (SEQ ID NO.6). The knockout transgenic vector of OsLVN6 was constructed and the knockout vector of the gene OsLVN6 was transferred into G209 by Agrobacterium-mediated genetic transformation. After selective culture, differentiation, rooting and cultivation, T0 generation transgenic plants were obtained. All transgenic materials were propagated to obtain homozygous mutation stable inheritance T1 generation materials, and finally two homozygous transgenic lines were selected for subsequent analysis ( Figure 3 A).

[0036] Investigation of wild-type and knockout transgenic materials to verify gene function: DNA was extracted from leaves at the seedling stage. Primers OsLVN6-F and OsLVN6-R were used for polymerase chain reaction, and the amplified product size was 384 bp. The obtained PCR products were sequenced to analyze the editing of the target site of gene OsLVN6. The PCR program was as follows: 94℃ pre-denaturation for 5min; 35 cycles (94℃ denaturation for 15s; 56℃ annealing for 15s; 72℃ extension for 20s), 72℃ extension for 10min.

[0037] The primer sequences used are as follows:

[0038] OsLVN6-F: 5'-CTTCACCTTGTGGTAGTGG-3' (SEQ ID NO.7);

[0039] OsLVN6-R: 5'-TGTCCGGATCGGCCATGAA-3' (SEQ ID NO. 8).

[0040] The sequencing result of wild-type G209 is shown in SEQ ID NO.9:

[0041] CTTCACCTTGTGGTAGTGGTAAAAGCTGTGGGAAATTTCATCCATAAAGATCGCCGTGGCGCTCGAATTCCGCTGAATTTTGTTTGTGCTCGAGCTGATCGGTGGAGGTGAAAGATTTTTGCGTCGAAGAGATGATAACTTTCGTGGATTCCGCGGCGAAGGAGCGGGAGCGGGAGAGTGACAAGTGCTTGGACCCGCAGCTGTGGCACGCCTGCGCCGGCGGCATGGTCCAGATGCCGCCGGTGAGCTCCAAGGTGTACTACTTCCCGCAAGGCCACGCCGAGCACGCGCAGGGGCATGGCCCCGTCGAGTTCCCGGGCGGGCGCGTCCCGGCGCTCGTGCTCTGCCGCGTCGCGGGCGTCAGGTTCATGGCCGATCCGGACA(SEQ ID NO.9).

[0042] Compared with the wild type, the knockout line 1 (KO1) has a base deletion (T) at position +125 (starting from ATG). The specific sequencing results are shown in SEQ ID NO.10:

[0043] CTTCACCTTGTGGTAGTGGTAAAAGCTGTGGGAAATTTCATCCATAAAGATCGCCGTGGCGCTCGAATTCCGCTGAATTTTGTTTGTGCTCGAGCTGATCGGTGGAGGTGAAAGATTTTTGCGTCGAAGAGATGATAACTTTCGTGGATTCCGCGGCGAAGGAGCGGGAGCGGGAGAGTGACAAGTGCTTGGACCCGCAGCTGTGGCACGCCTGCGCCGGCGGCATGGTCCAGATGCCGCCGGTGAGCTCCAAGGGTACTACTTCCCGCAAGGCCACGCCGAGCAC GCGCAGGGGCATGGCCCCGTCGAGTTCCCGGGCGGGCGCGTCCCGGCGCTCGTGCTCTGCCGCGTCGCGGGCGTCAGGTTCATGGCCGATCCGGACA(SEQ ID NO.10).

[0044] Compared with the wild type, knockout strain 2 (KO2) has two base deletions (TG) at positions +125 and +126 (ATG start), and the specific sequencing results are shown in SEQ ID NO.11:

[0045] CTTCACCTTGTGGTAGTGGTAAAAGCTGTGGGAAATTTCATCCATAAAGATCGCCGTGGCGCTCGAATTCCGCTGAATTTTGTTTGTGCTCGAGCTGATCGGTGGAGGTGAAAGATTTTTGCGTCGAAGAGATGATAACTTTCGTGGATTCCGCGGCGAAGGAGCGGGAGCGGGAGAGTGACAAGTGCTTGGA CCCGCAGCTGTGGCACGCCTGCGCCGGCGGCATGGTCCAGATGCCGCCGGTGAGCTCCAAGGTACTACTTCCCGCAAGGCCACGCCGAGCACGCGCAGGGGCATGGCCCCGTCGAGTTCCCGGGCGGGCGCGTCCCGGCGCTCGTGCTCTGCCGCGTCGCGGGCGTCAGGTTCATGGCCGATCCGGACA(SEQ ID NO.11).

[0046] When the plants grew to the full heading stage, the wild type and knockout transgenic materials were sampled to investigate the phenotype of the number of large vascular bundles at the ear neck. The phenotypic identification results showed that compared with the wild type, the number of large vascular bundles in the knockout strains was significantly reduced ( Figure 3 BC).

[0047] Effects of OsLVN6 gene on yield-related traits in knockout transgenic materials:

[0048] In order to clarify the effect of this gene on yield-related traits, this example further examined the yield-related traits of the wild type and knockout transgenic lines. Compared with the wild type, the number of primary branches, secondary branches, number of grains per ear and yield of the knockout transgenic lines were significantly reduced ( Figure 3 DF). The results showed that the OsLVN6 gene not only regulates the number of vascular bundles, but also affects the number of primary and secondary branches and the number of grains per panicle, ultimately affecting the yield of rice.

[0049] Example 4: Overexpression of the OsLVN6 gene significantly increased the number of large vascular bundles at the spike neck

[0050] In the construction of overexpression transgenic materials, the rice large vascular bundle number gene OsLVN6 was used as a template (SEQ ID NO.4), and primers G209-F (SEQ ID NO.2) and G209-R (SEQ ID NO.3) were used for polymerase chain reaction. The OsLVN6 gene fragment separated by PCR amplification was connected to the pBWA(V)HU-ccdB vector after double digestion with BsaI and Eco31I by homologous recombination. After sequencing and comparison, it was transformed into Agrobacterium EHA105 to obtain the overexpression vector of the gene OsLVN6.

[0051] The OsLVN6 overexpression vector was transferred into the japonica rice material C616 carrying the inferior haplotype through Agrobacterium-mediated genetic transformation. After selective culture, differentiation, rooting, and seedling hardening, T0 generation transgenic plants were obtained. All transgenic materials were propagated to obtain stable genetic T1 generation materials. Planting continued until the T2 generation to obtain two homozygous overexpression transgenic lines ( Figure 4 A). The wild type and overexpressed transgenic materials were sampled at the seedling stage, total RNA was extracted, and cDNA was obtained by reverse transcription. Real-time fluorescence quantitative PCR was performed using actin as the internal reference gene.

[0052] The primers used to detect the expression of gene OsLVN6 are:

[0053] RT-F: TGGAGGAGTTCCATTGTGCC (SEQ ID NO.12)

[0054] RT-R: AGCTTTCTCGATGCCGAACA(SEQ ID NO.13)

[0055] The results showed that the relative expression level of OsLVN6 in the overexpressing transgenic lines was significantly higher than that in the wild-type rice C616 plants ( Figure 4 B).

[0056] This embodiment preferably includes investigating the effects of wild-type and overexpressed transgenic materials on the number of large vascular bundles at the ear neck and yield-related traits, and the process is as follows:

[0057] Samples were taken at the heading stage, and the neck of the ear was sectioned and the number of large vascular bundles was observed under an optical microscope. Compared with the wild type, the number of large vascular bundles in the neck of the two overexpression lines increased significantly ( Figure 4 C; Figure 4 D), indicating that the gene positively regulates the number of large vascular bundles in the panicle neck. The results of post-harvest testing at maturity showed that the overexpression transgenic materials had more primary branches, secondary branches and grains per panicle, ultimately leading to a significant increase in yield ( Figure 4 EG).

[0058] Example 5: Effect of OsLVN6 gene on yield-related traits

[0059] In this example, the OsLVN6 gene was introduced into the japonica rice variety Zhongnongjing 11, and the number of large vascular bundles at the neck of the panicle, the number of primary branches, the number of grains per panicle and the yield were significantly increased. In order to further evaluate the effect of OsLVN6 on the number of large vascular bundles at the neck of the panicle and yield-related traits, the promoted japonica rice variety Zhongnongjing 11 (ZNG11) carrying the inferior haplotype Hap2 was selected as the recipient in this example, and the superior allele from G209 was introduced into ZNG11 through molecular marker-assisted selection. The relevant phenotypes were evaluated in the stable generation of BC3F3. Compared with Zhongnongjing 11, the number of large vascular bundles at the neck of the panicle, the number of primary branches, the number of secondary branches, and the number of grains per panicle of the introduced line were significantly increased, which ultimately increased the rice yield ( Figure 5 ).

[0060] In summary, the present invention discovered the rice panicle neck large vascular bundle number gene OsLVN6, which increases the number of rice grains per panicle and yield by regulating the number of large vascular bundles at the panicle neck and the number of primary branches.

[0061] This specific embodiment is merely an explanation of the present invention and is not a limitation of the present invention. After reading this specification, those skilled in the art may make non-creative modifications to the present embodiment as needed. However, as long as they are within the scope of the claims of the present invention, they are protected by the patent law.

Claims

1. A rice OsLVN6 gene, characterized in that: The nucleotide sequence of the coding region of the OsLVN6 gene is a nucleotide sequence in which one or more nucleotides are replaced, deleted, or inserted as shown in SEQ ID NO.4 and expresses a nucleotide sequence of a protein with the same function.

2. A protein characterized by: The gene encoding the protein is the OsLVN6 gene described in claim 1, and the amino acid sequence of the protein is shown in SEQ ID NO.

5.

3. Use of the rice OsLVN6 gene according to claim 1 or the protein according to claim 2 in regulating the number of large vascular bundles at the panicle neck and yield of rice.

4. The use of the rice OsLVN6 gene or the protein according to claim 3 in regulating the number of large vascular bundles at the panicle neck and yield of rice, characterized in that: The application is to reduce the number and yield of large vascular bundles at the ear neck by knocking out the OsLVN6 gene, or to increase the number and yield of large vascular bundles at the ear neck by overexpressing the nucleotide sequence of the protein encoding the OsLVN6 gene.

5. Use of the rice OsLVN6 gene according to claim 1 or the protein according to claim 2 in rice breeding.

6. A method for breeding rice varieties with more panicle necks, larger vascular bundles and higher yield, characterized by: The rice OsLVN6 gene as claimed in claim 1 is introduced into japonica rice that does not carry the gene by genetic engineering or conventional hybridization to improve the number of large vascular bundles at the panicle neck and the number of primary branches, thereby increasing the number of grains per panicle and the yield.

Images