Pyrosequencing primer, kit and method for evaluating methylation state of SKAP gene

Abstract

The invention relates to pyrosequencing primers, a kit and a method for evaluating the methylation state of an SKAP gene. The method comprises the following steps: (1) treating a DNA sample; (2) treating the DNA sample with sulfite; (3) designing an SKAP gene PCR (Polymerase Chain Reaction) and pyrosequencing primer; (4) carrying out PCR (Polymerase Chain Reaction) amplification; (5) pyrosequencing: performing pyrosequencing by using a reagent matched with pyrosequencing and an amplification product, and analyzing a sequencing result by applying methylation detection software matched with an instrument, so as to obtain methylation states of 12 CpG loci in the methylation sequencing fragment of the SKAP gene. By designing a specific PCR primer sequence and combining a tuberculosis pyrosequencing technology, the methylation state of the SKAP gene can be quickly, accurately and quantitatively reported.

Description

Technical Field

[0001] The invention relates to a primer, a kit and a method for pyrophosphate sequencing for evaluating the methylation state of a SKAP gene, and belongs to the field of in vitro amplification of nucleic acids and positioning and quantitative detection of methylation. Background Art

[0002] Small kinetochore-associated protein (SKAP) is an important protein that regulates gene expression during the cell cycle. Studies have found that SKAP plays an important role in the mitosis phase of mammalian cells. On the one hand, SKAP regulates its binding to microtubules by directly binding to the motor protein CENP-E. On the other hand, SKAP directly binds to Mis13 in the kinetochore protein Mis12 complex and anchors at the kinetochore, becoming a bridge protein connecting the outer kinetochore and the plus-end microtubules, and plays an important role in ensuring the precise separation of sister chromosomes. Knockdown of SKAP in HeLa cells can lead to many abnormal phenotypes such as delayed mitotic initiation, the appearance of lagging chromosomes and multipolar spindles, and prolonged or arrested mitosis.

[0003] Since the stable connection and precise regulation between the kinetochores and spindle microtubules are key events to ensure the average separation of chromatids, any defects in these will increase the generation of aneuploidy, ultimately leading to the occurrence and development of tumors. The dynamic localization of SKAP on the kinetochores and its regulatory function in the kinetochores-microtubule connection suggest that it may play a role in the occurrence and progression of tumors. In fact, in recent years, more and more researchers have begun to pay attention to the role of SKAP in tumorigenesis, and the results have emerged in an endless stream. It has been found that there is a high mutation rate in many tumor cell lines. In skin squamous cell carcinoma cells, the mutation rate of SKAP is only lower than that of tumor marker genes TP53 and CDKN2A. Among them, the phosphorylation mutation of serine 24 can cause chromosome separation errors by destroying the cohesion between sister chromatids, ultimately leading to genomic instability and promoting tumor development. However, it is not known what the specific kinases at these high mutation rate sites are, and what the specific molecular mechanisms involved in tumorigenesis are. At present, SKAP has been identified as an oncogene and is regarded as a marker protein for tumor cells. Our previous research results show that in the prometaphase of HeLa cells, SKAP is a phosphorylation substrate of the protein kinase GSK-3β. GSK-3β can phosphorylate SKAP at serine 232, serine 237, and threonine 294, making SKAP bind more tightly to the microtubule depolymerase Kif2b, strengthening its inhibition of Kif2b microtubule depolymerase activity, thereby stabilizing the spindle in the metaphase of mitosis and ensuring the precise separation of chromosomes. In addition, studies have shown that SKAP has a direct interaction with the microtubule protein CLASP-1. Amity L Manning et al. have previously demonstrated that the CLASP1-astrin-Kif2b complex plays an important regulatory role as a molecular switch in the maintenance and silencing of SAC during the transition from prometaphase to metaphase of mitosis, and in the stable connection and error correction of kinetochores. Based on the important functions of SKAP and its related proteins in the process of mitosis and tumor progression, we speculate that SKAP may participate in the regulation of the mitotic cycle of esophageal cancer cells through phosphorylation modification of the protein kinase GSK-3β.

[0004] SKAP has been identified as an oncogene. The degree of methylation of the SKAP gene is related to cancers such as esophageal cancer. The methylation status of the gene can be used to assess whether a person is susceptible to cancers such as esophageal cancer.

[0005] Currently, there are several conventional methods available to evaluate the methylation status of a gene:

[0006] 1. First-generation sequencing (Sanger) method: This method is mainly used to report gene sequences. Due to its low sensitivity, it requires 20-30% gene methylation to detect, which basically cannot meet the needs of scientific research or clinical practice, and is rarely used in reality.

[0007] 2. qPCR and MSP are the most commonly used methods. However, the essence of these two methods is PCR. Their results only report qualitative gene methylation data and cannot achieve accurate quantification. In addition, the methylation sites covered by PCR primers or probes are relatively small, making it difficult to objectively reflect the true methylation status of genes.

[0008] 3. Next-generation sequencing (NGS) method: This method can give relatively quantitative results, but its experimental process is cumbersome and requires steps such as adding connectors and constructing sequencing libraries. The experimental cycle is long and requires biological experimenters responsible for specific experimental operations and professional data analysts responsible for big data analysis. The professional knowledge backgrounds required by the two are quite different, and the hardware and labor costs required are high. It is quite difficult for a single department to run an experimental platform.

[0009] 4. Pyrosequencing is a technique that couples each dNTP binding to a fluorescent signal under the catalytic action of DNA polymerase, ATP sulfurylase, luciferase, and diphosphatase. If paired with a template, the polymerase can react to produce a fluorescent signal. C is converted to T under Na2SO3 treatment, while 5-mC does not. Therefore, pyrosequencing can be used to observe the C / C+T ratio, indirectly reflecting the ratio of C methylation and unmethylation at the site, and obtaining accurate data on the degree of methylation of each CpG site. Pyrosequencing has a large detection throughput and high sensitivity. It can achieve quantitative analysis of the methylation levels of multiple CpG sites on the amplicon at one time, and can set quality control to monitor whether the DNA sample is completely converted to avoid false positive results. Therefore, it is another "gold standard" for detecting gene methylation.

[0010] The accuracy of pyrophosphate sequencing results is usually affected by multiple factors such as template DNA purity and concentration, amplification primer specificity, sequencing primers and sequencing procedures. There is no pyrophosphate sequencing technology related to the SKAP gene in the prior art. Therefore, it is of great significance to design a suitable pyrophosphate sequencing technology related to the SKAP gene. Summary of the invention

[0011] The present invention provides primers, a kit and a method for pyrophosphate sequencing for evaluating the methylation status of the SKAP gene, which can quickly, accurately and quantitatively report the methylation status of the SKAP gene

[0012] In order to solve the above technical problems, the technical solution adopted by the present invention is:

[0013] A pyrosequencing primer for evaluating the methylation status of a SKAP gene comprises two sets of PCR amplification primers and a pyrosequencing primer combination, wherein the first set of primer combinations is as follows:

[0014] The PCR amplification primers are:

[0015] F1: TGGTTAAGATAGTGTATAGTTTGTAGT (SEQ ID NO: 1),

[0016] R1: Biotin-CCCATCATAAACTACATAACCTAATT (SEQ ID NO: 2);

[0017] The pyrophosphate sequencing primers are:

[0018] S1: GGTGAGGGTTTAAGT (SEQ ID NO: 3);

[0019] The second set of primers is as follows:

[0020] The PCR amplification primers are:

[0021] F1: TGGTTAAGATAGTGTATAGTTTGTAGT (SEQ ID NO: 4),

[0022] R2: Biotin-TCCCATCATAAACTACATAACCTAATT (SEQ ID NO: 5);

[0023] The pyrophosphate sequencing primers are:

[0024] S2: GGTAGGTGAGGGTTTAA (SEQ ID NO: 6).

[0025] Furthermore, preferably, the 5' ends of R1 and R2 are labeled with biotin.

[0026] Further, preferably: the gene target sequence for sulfite conversion of the SKAP gene is the following sequence or a sequence with a repetition rate similarity of 80% or more to the following sequence:

[0027] TGGTTAAGATAGTGTATAGTTTGTAGTTTTTTTTGYGTTGAGYGGYGGTTAGTYGGTAGGTGAGGGTTTAAGTTAYGTTYGGGGTTATTGYGGTTTTGGTYGGGGATGGTTTYGGGAGTGGAGATYGAATGGGTGGYGYGGGTAYGGGGAAGGGYGTTTYGTYGGTTTTGAAAATTTGTGAGTTTTTTATAATTAGGTTATGTAGGTTTATGATGGG(SEQ ID NO: 7).

[0028] Further, preferably: the sequencing sequence of the methylation detection site is:

[0029] TAYGTTYGGGGTATTGYGGTTTGGTYGGGGATGGTTTYGGGAGTGTGGAGATY GAATGGGTGGYGYGGGTAYGGGGAAGGGYGTTTYGTYGGTTTTGAAAATTTGTGAG TTTTTT (SEQ ID NO: 8);

[0030] or:

[0031] GTTAYGTTYGGGGTATTGYGGTTTGGTYGGGGATGGTTTYGGGAGTGTGGAGAT YGAATGGGTGGYGYGGGTAYGGGGAAGGGYGTTTYGTYGGTTTTGAAAATTTGTGA GTTTTTT (SEQ ID NO: 9);

[0032] Each letter Y represents a variable site, and Y represents C or T.

[0033] The present invention also provides a pyrophosphate sequencing kit for evaluating the methylation status of the SKAP gene, comprising the primers of the present invention.

[0034] The present invention also provides a method for evaluating the methylation status of the SKAP gene by pyrosequencing, using the primers designed by the present invention, comprising the following steps:

[0035] (1) DNA sample processing: extract nucleic acid from tissue or blood samples to obtain DNA samples with high purity;

[0036] (2) Bisulfite treatment of DNA samples: The DNA samples obtained in the nucleic acid purification step are treated with bisulfite to convert unmethylated cytosine into uracil, while methylated cytosine is not affected;

[0037] (3) SKAP gene PCR and pyrophosphate sequencing primers: PCR primer sequences and sequencing primers were designed according to the SKAP gene sequence, and specific positions of the PCR primers were biotin-labeled;

[0038] (4) PCR amplification: Using the primers in step (3) as templates, amplify the DNA fragment containing the target methylation site, and use the treated DNA as a template for PCR amplification to obtain sufficient DNA products for subsequent sequencing;

[0039] (5) Pyrophosphate sequencing: Pyrophosphate sequencing was performed using the supporting reagents and amplified products of pyrophosphate sequencing, and the sequencing results were analyzed using methylation detection software to obtain the methylation status of the 12 CpG sites in the methylation sequencing fragment of the SKAP gene.

[0040] Beneficial effects of the present invention:

[0041] 1. The detection speed is fast, and the results can be obtained in as fast as 12 hours, saving time;

[0042] 2. High detection sensitivity, methylation detection zero sensitivity of 5%, which is conducive to detecting low-level methylation sites;

[0043] 3. The experimental results include both gene sequencing results and methylation quantitative results, and the data is highly reliable;

[0044] 4. The experimental method is relatively simple. For experimental personnel who can do PCR, they can do pyrophosphate sequencing with a little training, and 5. They can quickly learn data analysis. The technology is easy to popularize, which is conducive to the promotion of the technology;

[0045] 6. The experimental cost is relatively low, economical and affordable, and has benefits for later market promotion. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0047] Figure 1 It is an agarose gel electrophoresis diagram of the SKAP gene CpG island PCR amplification fragment of the present invention;

[0048] Figure 2 The CpG island analysis of the promoter and first exon of the SKAP gene;

[0049] Figure 3This is the result of CpG island pyrophosphate sequencing in the promoter region of SKAP gene. DETAILED DESCRIPTION

[0050] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0051] The present invention designs a set of highly specific amplification primers and sequencing primers, and then detects the methylation ratio of 12 CpGs in the methylation sequencing fragment of the SKAP gene through DNA sulfite conversion, PCR amplification and pyrophosphate sequencing technology, which can be used to locate and quantitatively evaluate the methylation level of the SKAP gene, and has the characteristics of high specificity, accurate quantification, high throughput, low cost, etc.

[0052] Example 1

[0053] A method for evaluating the methylation status of the SKAP gene by pyrosequencing, comprising the following steps:

[0054] 1. DNA sample processing: extract nucleic acid from tissue or blood samples to obtain DNA samples with higher purity;

[0055] This example uses the human esophageal mucosal epithelial cell line Het-1A (Shanghai Hongshun Biotechnology Co., Ltd.) to conduct the experiment. The specific steps are as follows:

[0056] The human esophageal mucosal epithelial cell line Het-1A was cultured in RPMI1640 nutrient solution containing 10% fetal bovine serum at 37°C, 5% CO2 and saturated humidity until the logarithmic growth phase, digested with trypsin, transferred into a centrifuge tube, centrifuged at 1000 rpm for 5 minutes, and washed 23 times with PBS. Then the whole genome DNA was extracted.

[0057] Extraction of whole genome DNA The whole genome DNA of tissues was extracted using QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) DNA extraction kit, and the concentration of the obtained DNA was detected by NanoDrop 2000 ultra-micro spectrophotometer (Thermo Fisher Scientific, USA) for the detection of SKAP gene methylation level.

[0058] 2. DNA sample methylation treatment:

[0059] The EZ DNA Methylation GoldTM Kit (Zymo research, USA) was used and the operation was performed strictly according to the instructions of the kit. After this step, the unmethylated cytosine (C) in the DNA sequence was converted to uracil (U).

[0060] 3. SKAP primer design: Primers were designed based on the following target sequences of sulfite-converted SKAP genes or sequences with a repetition rate similarity of 80% or more to the following sequences:

[0061] TGGTTAAGATAGTGTATAGTTTGTAGTTTTTTTGYGTTGAGYGGYGGTTAGTYGGTAGGTGAGGGTTTAAGTTAYGTTYGGGGTTATTGYGGTTTTGGTYGGGGATGGTTTYGGGATGTGGAGATYGAATGGGTGGYGYGGGTAYGGGGAAGGGYGTTTYGTYGGTTTTGAAAATTTGTGAGTTTTTTATAATTAGGTTATGTAGGTTTATGATGGG;

[0062] The SKAP gene sequence was imported using genome sequence software (MethPrimer, website: http: / / www.urogene.org / methprimer) to predict the methylation islands. The results are as follows:

[0063] Select the first 5000bp (or so) of the SKAP full gene (NC_000015.10:40382721-40394288) and put it into the input box of the methylation online processing tool website (actually input 4690bp of bases, the website can process sequences not exceeding 5000bp in length).

[0064] The distribution characteristics of CpG islands and CpG sites in the promoter and first exon of SKAP gene were analyzed (under the conditions of CpG island>100bp, G+C%>50%, and Obs / Exp>0.6), and it was determined that there were two CpG islands in the promoter and first exon of SKAP gene ( Figure 1 ),

[0065] The first CpG island and its downstream region in the promoter region were selected, and a suitable position (Island 1653 bp (78-730)) was chosen in the methylation island (near the gene promoter) for primer design.

[0066] The 2000 bp sequence before and after Island 1653 bp (78-730) was placed into the primer design software PyroMark Assay Design Software dedicated to pyrophosphate sequencing. The Methylation Analysis (CpG) mode was selected in the Assay Type project. The appropriate target position was specified for primer design. The primer combination of the two sets of PCR primers and pyrophosphate sequencing primers with the highest scores was selected, as follows:

[0067] The first primer combination:

[0068] PCR amplification primers;

[0069] F1: TGGTTAAGATAGTGTATAGTTTGTAGT,

[0070] R1: Biotin-CCCATCATAAACTACATAACCTAATT,

[0071] The pyrophosphate sequencing primers are:

[0072] S1:GGTGAGGGTTTAAGT,

[0073] The second primer combination:

[0074] PCR amplification primers;

[0075] F1: TGGTTAAGATAGTGTATAGTTTGTAGT,

[0076] R2: Biotin-TCCCATCATAAACTACATAACCTAATT;

[0077] The pyrophosphate sequencing primers are:

[0078] S2:GGTAGGTGAGGGTTTAA.

[0079] And the 5 of R1 and R2 primers , Biotin labeled.

[0080] Finally, the primer combination of the first group was used for subsequent steps.

[0081] 4. PCR amplification:

[0082] The kit designed by Qiagen for PyroMark Q24 PCR was used as follows:

[0083] PCR amplification using the first set of primers:

[0084] Prepare a reaction system with an appropriate number of tubes according to Table 1 (three parallel samples and a negative control), and place them in a BioRad PCR instrument. Perform a gradient PCR amplification reaction according to the amplification program in Table 1. After the amplification is completed, perform agarose gel electrophoresis.

[0085] Table 1 PCR amplification reaction system and procedure for methylated fragments of SKAP gene

[0086]

[0087]

[0088] The results are as follows Figure 2 As shown, Figure 2 In the assay, Marker I is 600 bp, Marker II is 1200 bp, and when the annealing temperature is 55°C, the amplified band is approximately 218 bp, with a single band and high abundance, and no mixed bands or primer dimers (lanes 6-54, 6-56, and 6-57), which is suitable for the next sequencing experiment.

[0089] 5. Pyrosequencing: PyroMark Q24 instrument was used, as follows:

[0090] Take a 0.2 mL centrifuge tube, add 40 μL PyroMark binding buffer, 1 μL agarose magnetic beads (QIAGEN), and 10 μL PCR product to each tube, and add ultrapure water to a total volume of 80 μL, mix at 1500 rpm for 15 min; take a PyroMark 96-well reaction plate, add 20 μL to each well PyroMark annealing buffer and 2.5 μL sequencing primer with a concentration of 5 μM were added and mixed by blowing and suction; the vacuum pump was turned on and the 96-head electromagnetic filter washed with ultrapure water was inserted into the agarose magnetic bead mixture containing the PCR product for about 2 minutes to fully capture the agarose magnetic beads containing the sequencing template (PCR product). Then the filter was placed in 70% ethanol for 1 minute, PyroMark denaturation buffer for about 1 minute, and PyroMark cleaning buffer for about 1 minute in sequence; the filter was removed and the vacuum pump was turned off to release the agarose magnetic beads from the filter tip into the corresponding 96-well plate and fully mixed; denatured at 80°C for 2 minutes and cooled to room temperature; enzyme E, substrate S and 4 dNTP bases were added to the PyroMark Q96 reagent chamber; the 96-well plate and reagent chamber were placed in the pyrophosphate sequencer, and the sequencing program was edited to start the detection; after the detection was completed, the PyroMark Q 96 analysis software analyzes the sequencing results and outputs a sequencing report. The numbers above the fluorescence absorption peak represent the proportion of methylation at each CpG site. Blue represents the best, yellow represents basically reliable, and red represents sequencing failure. Figure 3 shown.

[0091] Depend on Figure 3 It can be seen that the corresponding sequencing program is:

[0092] TAYGTTYGGGGTATTGYGGTTTGGTYGGGGATGGTTTYGGGAGTGTGGAGATY GAATGGGTGGYGYGGGTAYGGGGAAGGGYGTTTYGTYGGTTTTGAAAATTTGTGAG TTTTTT;

[0093] Each letter Y represents a variable site, and Y represents C or T.

[0094] The experimental results include 12 methylation sites, 8 of which are blue and 4 are yellow. The sequencing results are blue and yellow when the sequencing primers and program designed by the present invention are used for sequencing, and the optimal sequencing is achieved. The read length of the blue one is longer, reaching about 60 bp, and no absorption peak is detected at the DNA conversion quality control monitoring point C (pink column), proving that the DNA is completely converted and the test result is not a false positive, indicating that a methylation detection method for CpG sites in the promoter region of the SKAP gene based on pyrophosphate sequencing technology has been successfully established.

[0095] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A primer for pyrophosphate sequencing for evaluating the methylation status of the SKAP gene, characterized in that: The primers include two sets of PCR amplification primers and pyrophosphate sequencing primer combinations, and the first set of primer combinations is as follows: The PCR amplification primers are: F1: the nucleotide sequence shown in SEQ ID NO: 1; R1: the nucleotide sequence shown in SEQ ID NO: 2; The pyrophosphate sequencing primers are: S1: the nucleotide sequence shown in SEQ ID NO: 3; The second set of primers is as follows: The PCR amplification primers are: F1: the nucleotide sequence shown in SEQ ID NO: 4, R2: the nucleotide sequence shown in SEQ ID NO: 5; The pyrophosphate sequencing primers are: S2: nucleotide sequence as shown in SEQ ID NO:

6.

2. The primer according to claim 1, characterized in that: The 5' ends of R1 and R2 are labeled with biotin.

3. The primer according to claim 1, characterized in that: The sulfite conversion gene target sequence of the SKAP gene is the following sequence or a sequence with a repetition rate similarity of 80% or more to the following sequence: The nucleotide sequence is shown in SEQ ID NO:

7.

4. The primer according to claim 1, characterized in that: The sequencing sequence of the methylation detection site is: The nucleotide sequence shown in SEQ ID NO: 8; or: The nucleotide sequence shown in SEQ ID NO: 9, Each letter Y represents a variable site, and Y represents C or T.

5. A pyrosequencing kit for evaluating the methylation status of the SKAP gene, characterized in that: The method comprises the primer according to any one of claims 1 to 4.

6. A method for evaluating the methylation status of the SKAP gene by pyrosequencing, characterized in that: Adopt the primer of claim 1, comprise the following steps: (1) DNA sample processing: extract nucleic acid from tissue or blood samples to obtain DNA samples with high purity; (2) Bisulfite treatment of DNA samples: The DNA samples obtained in the nucleic acid purification step are treated with bisulfite to convert unmethylated cytosine into uracil, while methylated cytosine is not affected; (3) SKAP gene PCR and pyrophosphate sequencing primers: PCR primer sequences and sequencing primers were designed according to the SKAP gene sequence, and specific positions of the PCR primers were biotin-labeled; (4) PCR amplification: Using the primers in step (3) as templates, amplify the DNA fragment containing the target methylation site, and use the treated DNA as a template for PCR amplification to obtain sufficient DNA products for subsequent sequencing; (5) Pyrophosphate sequencing: Pyrophosphate sequencing was performed using the supporting reagents and amplified products of pyrophosphate sequencing, and the sequencing results were analyzed using methylation detection software to obtain the methylation status of the 12 CpG sites in the methylation sequencing fragment of the SKAP gene.

Images