Detection reagent and kit suitable for detecting EB virus positive DLBCL immune microenvironment by imaging mass spectrometer

Abstract

The invention discloses a detection reagent and a kit suitable for detecting EB (Epstein-Barr) virus positive DLBCL immune microenvironment by an imaging mass spectrometer. The detection reagent comprises an antibody combination and a probe combination, the antibody combination comprises an anti-alpha SMA antibody, an HLADR antibody, a CD20 antibody, a CD56 antibody, a Vimentin antibody, a CD8a antibody, a CCL17 antibody, a CCR6 antibody, an IL3CD123 antibody, a CXCL12 antibody, a BCL2 antibody, a PD1 antibody, a CD163 antibody, a CD45RO antibody, an ICOS antibody, a GranzymeB antibody, a CXCR5 antibody, a Ki67 antibody, a PDL1 antibody, a Bcl6 antibody, a CD31 antibody, a CD3 antibody, a CD45 antibody, a CD27 antibody, an LAG3 antibody, a PDL2 antibody, a FoxP3 antibody, a CD127 antibody, a CD4 antibody, an EBNA2 antibody, a All antibodies and probes are labeled with metal labels. The EBV + DLBCL immune microenvironment can be more comprehensively and efficiently identified by using the antibody combination or the kit disclosed by the invention.

Description

Technical Field

[0001] The present invention relates to the field of detection, and in particular to a detection reagent and a kit suitable for detecting the immune microenvironment of Epstein-Barr virus-positive DLBCL by imaging mass spectrometry flow cytometer. Background Art

[0002] Diffuse large B cell lymphoma (DLBCL) is the most common type of malignant lymphoma in China. In recent years, the role of EBV in the pathogenesis of DLBCL has attracted much attention. Epstein–Barr virus (EBV), which is carried by about 90-95% of adults, is the first human tumor-causing virus recognized by the World Health Organization (WHO), and can cause a variety of malignant lymphoproliferative diseases. In the 2016 WHO classification of lymphoid tumors, EBV positive diffuse large B cell lymphoma (EBV+DLBCL) has been listed as a subtype of DLBCL. Studies have shown that EBV+DLBCL is highly invasive, with clinical stages mainly in stages III-IV and poor response to treatment. The previous treatment regimen was chemotherapy based on anthracyclines. With the addition of CD20 monoclonal antibodies, patient survival has increased to more than 50%. Despite this, the efficacy of EBV+DLBCL is still significantly lower than that of EBV-DLBCL, suggesting that EBV+DLBCL has other immune escape mechanisms.

[0003] As the effector site of the body's immune anti-tumor, the immune microenvironment has been proven to play an important role in the occurrence and development of EBV+DLBCL. Many studies have shown that the number, phenotype and function of immune cells in the lymph nodes and peripheral blood of EBV+DLBCL patients are significantly correlated with progression-free survival and overall survival. The components of the immune microenvironment include tumor cells, CD8+T cells, follicular helper T cells (Tfh), regulatory T cells (Tregs), tumor-associated macrophages (TAMs), etc. TAMs are the main participants in the tumor microenvironment, with high heterogeneity, and complex and extensive interactions with tumor cells. Previous reports have shown that in lymphoma and other solid tumors, the interaction of immune cells with specific phenotypes in the immune microenvironment can not only reflect the intrinsic mechanism of action of the microenvironment, but also affect the prognosis of the tumor. The traditional method for studying the immune microenvironment of EBV+DLBCL is mainly immunofluorescence, but in multiple fluorescent immunohistochemistry technology, if the emission spectra of the fluorescent dyes used are similar, signal overlap may occur, resulting in the inability to accurately interpret the results. Furthermore, histological detection of EBER in situ hybridization on tissue biopsy sections is currently the gold standard for diagnosing EBV infection, but the chemical reagents used to perform immunofluorescence and EBER in situ hybridization may be incompatible. Some RNA in situ hybridization reagents may destroy or mask the antigenic sites of proteins, and vice versa.

[0004] Imaging mass cytometry (IMC) is a new molecular imaging technology that combines the advantages of high throughput and exploration of spatial distribution characteristics. Through high-dimensional analysis, IMC can show the localization and relative quantification of different cell subsets in the tumor microenvironment, thereby achieving an in-depth analysis of the number, spatial localization and interaction of each cell subset in the tumor immune microenvironment. The use of IMC can accurately present the composition and spatial distribution of each cell subset in the EBV+DLBCL immune microenvironment, which is of great significance for finding the key cell subsets that induce the immunosuppressive microenvironment, in-depth exploration of the molecular mechanism that induces the formation of the inhibitory immune microenvironment of EBV+DLBCL, and improving the prognosis of EBV+DLBCL. Summary of the invention

[0005] The purpose of the present invention is to provide a protein RNA co-staining combination and a kit suitable for detecting the immune microenvironment of EBV-positive diffuse large B-cell lymphoma by imaging mass spectrometry flow cytometry, which can more comprehensively and efficiently identify the immune microenvironment of EBV+DLBCL.

[0006] To achieve the above-mentioned purpose, a detection reagent suitable for detecting the immune microenvironment of Epstein-Barr virus-positive diffuse large B-cell lymphoma by imaging mass spectrometry flow cytometry is provided, characterized in that the detection reagent comprises an antibody combination and a probe combination, wherein the antibody combination is α_SMA, HLA_DR, CD20, CD56, Vimentin, CD8a, CCL17, CCR6, IL3_CD123, CXCL12, BCL2, PD1, CD163, CD45RO, ICOS, GranzymeB, CXCR5, Ki_67, PDL1, Bcl_6, CD31, CD3, CD45, CD27, LAG_3, PDL2, FoxP3, CD127, CD4, EBNA2, CCL21, LMP1, CD68, IDO antibodies, and the probe ... The needle combination is an EBER1 / 2 probe; all antibodies and probes are labeled with metal tags; preferably, the metal tags are lanthanide metal tags; more preferably, the lanthanide metal tags are 141Pr, 142Nd, 143Nd, 144Nd, 145Nd, 146Nd, 147Sm, 148Nd, 149Sm, 150Nd, 151Eu, 152Sm, 153Eu , 154Sm, 155Gd, 156Gd, 157Gb, 158Gd, 159Tb, 160Gd, 161Dy, 162Dy, 163Dy, 164Dy, 165Ho, 166Er, 167Er, 168Er, 169Tm, 170Er, 171Yb, 172Yb, 173Yb, 174Yb, 175Lu or 176Yb.

[0007] Further, the antibody combination is an α_SMA antibody labeled with 141Pr, recorded as 141Pr_α_SMA; and the same is true for 160Gd_HLA_DR, 142Nd_CD20, 161Dy_CD56, 143Nd_Vimentin, 162_Dy_CD8a, 144Nd_CCL17, 163Dy_CCR6, 145Nd_IL3_CD123, 164Dy_CXCL12, 146Nd_BCL2, 165Ho_PD1, 147Sm_CD163, 166Er_CD45RO, 148Nd_ICOS, 167Er_Granzyme B, 149Sm_CXCR5, 168Er_Ki_67, 150Nd_PDL1, 169Tm_Bcl_6, 151Eu_CD31, 170Er_CD3, 152Sm_CD45, 171Yb_CD27, 153Eu_LAG_3, 172Yb_PDL2, 155Gd_FoxP3, 173Yb_CD127, 156Gd_CD4, 174Yb_EBNA2, 158Gd_CCL21, 175Lu_LMP1, 159Tb_CD68, 176Yb_IDO; the probe combination is 154Sm_EBER1 / 2 labeled with 154Sm.

[0008] Furthermore, the method for preparing the antibody in the antibody combination is:

[0009] A1. Preparation of lanthanide-loaded polymers:

[0010] Preloading: Resuspend the Maxpar polymer with Maxpar L-Buffer; then add the corresponding lanthanide metal solution, preferably, the final concentration of the lanthanide metal solution is 2.5mM; mix and incubate, preferably at 37°C for 30-40 minutes; Maxpar polymer is X8 Antibody Labeling Kit,142Nd—4Rxn, X8 AntibodyLabeling Kit,144Nd—4Rxn, X8 Antibody Labeling Kit,145Nd—4Rxn, X8 Antibody Labeling Kit,149Sm—4Rxn, X8 Antibody Labeling Kit,154Sm—4Rxn, X8 Antibody Labeling Kit,158Gd—4Rxn, X8 Antibody LabelingKit,160Gd—4Rxn, X8 Antibody Labeling Kit,161Dy—5Rxn, X8Antibody Labeling Kit,164Dy—4Rxn, X8 Antibody Labeling Kit,166Er—4Rxn, X8 Antibody Labeling Kit,169Tm—4Rxn, X8 Antibody LabelingKit,173Yb—4Rxn, X8 Antibody Labeling Kit,174Yb—4Rxn, X8Antibody Labeling Kit,175Lu-4Rxn and X8 Antibody Labeling Kit,176Yb—4Rxn;

[0011] Purification: adding the above-obtained product to a filter containing Maxpar L-Buffer, centrifuging, preferably, centrifuging at 12,000 x g for 25 minutes at room temperature; discarding the waste liquid in the collection tube; adding Maxpar C-Buffer to the filter, centrifuging, preferably centrifuging at 12,000 x g for 30 minutes at room temperature; discarding the waste liquid in the collection tube; obtaining the lanthanide-loaded polymer;

[0012] A2. Preparation of the corresponding partially reduced antibody:

[0013] Add Maxpar R-Buffer and antibody to a 50kDa filter, centrifuge at room temperature; preferably, centrifuge at 12,000xg for 10 minutes; discard the liquid after centrifugation; then add 4mM TCEP-R-buffer, mix thoroughly and incubate, preferably, incubate at 37°C for 30 minutes; add Maxpar C-Buffer, centrifuge, preferably, centrifuge at 12,000xg for 10 minutes at room temperature; discard the waste liquid, then add Maxpar C-Buffer; centrifuge at 12,000xg for 10 minutes at room temperature; discard the waste liquid; obtain the corresponding partially reduced antibody;

[0014] The order of the above steps A1 and A2 can be swapped or performed simultaneously, with no order requirement.

[0015] A3. Coupling of antibodies with lanthanide-loaded polymers:

[0016] Resuspend the product obtained in A1 in Maxpar C-Buffer and add it to the product obtained in A2, mix well and incubate, preferably, incubate at 37° C. for 60-120 minutes to obtain an antibody coupling mixture;

[0017] A4. Washing of metal-coupled antibodies:

[0018] Add Maxpar W-Buffer to the product obtained in A3, centrifuge, preferably, centrifuge at 12,000 x g for 10 minutes at room temperature; discard the waste liquid; and then rinse repeatedly with Maxpar W-Buffer for multiple times; preferably, repeat the rinsing 1-5 times;

[0019] A5. Recycling of metal-conjugated antibodies:

[0020] Add Maxpar W-Buffer to the 50kDa filter and mix with a pipette to rinse the filter wall; then invert the 50kDa filter into a new collection tube and centrifuge the inverted filter / collection tube assembly, preferably at 1000xg for 2 minutes; remove the inverted filter from the collection tube, rinse the filter wall with Maxpar W-Buffer, and place the inverted filter back into the collection tube; centrifuge the inverted filter / collection tube assembly to collect the precipitate, preferably at 1000xg for 2 minutes.

[0021] The present invention also provides a kit, characterized in that it contains the detection reagent.

[0022] The present invention also provides a method for detecting the immune microenvironment of EB virus-positive diffuse large B-cell lymphoma, characterized in that the detection reagent or the kit is used.

[0023] The present invention also provides a method for detecting the immune microenvironment of EB virus-positive diffuse large B-cell lymphoma using an imaging mass spectrometer, which is characterized by comprising the following steps:

[0024] B1. Pre-treatment of formalin-fixed stone-embedded tissue sections:

[0025] The paraffin tissue sections to be tested were dried at room temperature, and then baked in an oven at 65±5℃ for 30-60min; the sections were taken out and immersed in xylene at room temperature for 10±1min respectively, and the sections were moved up and down from time to time to ensure sufficient dewaxing; the sections were immersed in 100%, 100%, 95%, 95%, and 75% ethanol in turn, each for 5±1min; they were washed with ultrapure water 5±1 times; the sections were slowly immersed in a vertical staining bottle containing preheated 1xAntigen Retrieval buffer and incubated at 97℃ for 30±5min, then cooled to 70±5℃ at room temperature, and then transferred to a vertical staining bottle containing ddH2O and washed for 10 minutes. After the sections were dried, a hydrophobic circle was drawn around the tissue using an immunohistochemistry pen; after the hydrophobic circle was dried, Wash Buffer was added, and the solution was discarded after standing for 10±1sec, and repeated several times; 4±1% PFA was added to the hydrophobic circle, and the solution was allowed to stand for 10±1min, and the liquid in the hydrophobic circle was aspirated and added to Wash Buffer. Buffer, let it stand for 10±1sec and then discard the liquid, repeat several times, and keep the last Wash Buffer; aspirate the Wash Buffer in the hydrophobic circle and add 0.3±0.1mg / mL pepsin solution diluted with 0.7±0.1MHCL; place in a wet box and permeabilize in a 42±2℃ constant temperature incubator for 30-60min; after permeabilization, aspirate the liquid in the hydrophobic circle, add Wash Buffer, let it stand for 10±1sec and then discard the liquid, repeat several times, and keep the last Wash Buffer;

[0026] B2. Probe hybridization:

[0027] Aspirate the liquid in the hydrophobic circle, then immediately add the first reaction solution, place in a wet box, and hybridize in a 42±2℃ constant temperature incubator for 4h; after the reaction is completed, aspirate the liquid in the hydrophobic circle, then immediately add Wash Buffer, let it stand for 10±1sec and then discard the liquid, repeat the washing several times, and keep the last Wash Buffer;

[0028] The first reaction solution is prepared as follows: based on a 50 μL system, 15 μL of Nuclease-free Water, 25 μL of Hyb Buffer 1, 5 μL of PG, 2.5 μL of FISH Probe-Hsa-EBER1, and 2.5 μL of FISH Probe-Hsa-EBER2;

[0029] B3. Post-hybridization cleaning:

[0030] Vortex and centrifuge the Hyb Wash Buffer, aspirate the liquid in the hydrophobic circle, immediately add Hyb Wash Buffer, place in a wet box, incubate in a constant temperature incubator at 42±2℃ for 5±1min, and repeat the wash several times; after the reaction is completed, aspirate the liquid in the hydrophobic circle, immediately add Wash Buffer, let it stand for 10±1sec, then discard the liquid, repeat the wash several times, and keep the last Wash Buffer; B4. Probe ringing:

[0031] Vortex and mix well, centrifuge; aspirate the liquid in the hydrophobic circle and immediately add the second reaction solution, place in a wet box, and react in a 42±2℃ constant temperature incubator for 0.5±0.1h; after the reaction, aspirate the liquid in the hydrophobic circle and immediately add Wash Buffer, let it stand for 10±1sec and then discard the liquid, repeat the washing several times, and keep the last Wash Buffer;

[0032] The second reaction solution was prepared as follows: based on a 50 μL system, 12.5 μL of Nuclease-free Water, 25 μL of B1, 5 μL of PG, 2.5 μL of ST, and 5 μL of E1;

[0033] B5. Rolling circle amplification:

[0034] Vortex and mix well, centrifuge; aspirate the liquid in the hydrophobic circle and immediately add the third reaction solution, place in a wet box, and react in a 42±2℃ constant temperature incubator for 2±0.5h; after the reaction, aspirate the liquid in the hydrophobic circle and immediately add Wash Buffer, let it stand for 10±1sec, then discard the liquid, repeat the washing several times, and keep the last Wash Buffer;

[0035] The third reaction solution is prepared as follows: based on a 50 μL system, 23 μL of Nuclease-free Water, 25 μL of B2, and 2 μL of E2;

[0036] B6. Metal tag probe hybridization:

[0037] Vortex and mix well, centrifuge; suck out the liquid in the hydrophobic circle and immediately add the fourth reaction solution, place in a wet box, and react in a 42±2℃ constant temperature incubator for 0.5±0.1h; after the reaction, suck out the liquid in the hydrophobic circle and immediately add WashBuffer, let it stand for 10±1sec, then discard the liquid, and repeat the washing several times;

[0038] The fourth reaction solution is prepared as follows: based on a 50 μL system, 22.5 μL of Nuclease-free Water, 25 μL of Hyb Buffer 2, and 2.5 μL of metal-labeled detection probe;

[0039] The metal-labeled detection probe is obtained by first modifying the EBER1 / 2 detection probe and then labeling it with a metal tag; more preferably, the modification method is to use 5' Thiol-Modifier C6 SS is modified; the metal tag is 141Pr, 142Nd, 143Nd, 144Nd, 145Nd, 146Nd, 147Sm, 148Nd, 149Sm, 150Nd, 151Eu, 152Sm, 153Eu, 154Sm, 155Gd, 156Gd, 158Gd, 159Tb, 160Gd, 161Dy, 162Dy, 163Dy, 164Dy, 165Ho, 166Er, 167Er, 168Er, 169Tm, 170Er, 171Yb, 172Yb, 173Yb, 174Yb, 175Lu or 176Yb;

[0040] B7.IMC Antibody Incubation

[0041] Block with blocking buffer at room temperature for 45±5 minutes; remove the blocking solution, drip the combined antibody onto the tissue section area, and incubate at 4±2°C overnight; wash several times with DPBS containing 0.2% Triton-X and shake slowly on a shaker; repeat the washing and shaking steps several times; drip the diluted dye onto the tissue section area, stain at room temperature in a wet box, rinse, and dry for detection on an imaging mass spectrometer.

[0042] The detection reagent of the present invention can detect 36 indicators at the same time, and is a protein RNA co-staining combination suitable for detecting the immune microenvironment of EB virus-positive diffuse large B-cell lymphoma by imaging mass spectrometry flow cytometer, and can identify the immune microenvironment of EBV+DLBCL more comprehensively and efficiently. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 It is one of the detection index diagrams of Example 1.

[0044] Figure 2 This is the second detection index diagram of Example 1.

[0045] Figure 3 This is the third detection index diagram of Example 1.

[0046] Figure 4 It is one of the detection index diagrams of Example 2.

[0047] Figure 5 This is the second detection index diagram of Example 2.

[0048] Figure 6 This is the third detection index diagram of Example 2. DETAILED DESCRIPTION

[0049] Embodiments of the present invention are described in detail below, and the examples of the embodiments are shown in the accompanying drawings, wherein the same or similar reference numerals represent the same or similar elements or elements with the same or similar functions from beginning to end. The embodiments described below by reference to the accompanying drawings are exemplary, are intended to be used to explain the present invention, and are not to be construed as limitations of the present invention. Those who do not indicate specific techniques or conditions in the embodiments are carried out according to the techniques or conditions described in the documents in this area or according to the product specification. Those who do not indicate the manufacturer of reagents or instruments used are all conventional products that can be obtained commercially.

[0050] See Table 1 for some reagents:

[0051] Table 1 List of some reagents

[0052]

[0053]

[0054] And homemade antibodies:

[0055] 142Nd_CD20, 144Nd_CCL17, 145Nd_CD123, 149Sm_CXCR5, 158Gd_CCL21, 160Gd_HLA_DR, 161Dy_CD56, 164Dy_CXCL12, 166Er_CD45RO, 169Tm_Bcl_6, 173Yb_CD127, 174Yb_EBNA2, 175Lu_LMP1, 176Yb_IDO. (The preparation methods of these antibodies are shown in the "Antibody Preparation Steps" below, except that the metals therein are selected to correspond to the antibodies. For example, in 142Nd_CD20, the antibody is CD20, which is labeled with 142Nd, and the lanthanide metal is 142Nd; in 144Nd_CCL17, the antibody is CCL17, which is labeled with 144Nd, and the lanthanide metal is 144Nd, ...).

[0056] Table 2 List of reagents required for homemade antibodies

[0057]

[0058]

[0059] Maxpar polymers include those listed in Table 2: X8 Antibody Labeling Kit,142Nd—4Rxn, X8 Antibody Labeling Kit,144Nd—4Rxn, X8 Antibody Labeling Kit,145Nd—4Rxn, X8 Antibody Labeling Kit,149Sm—4Rxn, X8 AntibodyLabeling Kit,154Sm—4Rxn, X8 Antibody Labeling Kit,158Gd—4Rxn, X8 Antibody Labeling Kit,160Gd—4Rxn, X8 Antibody Labeling Kit,161Dy—5Rxn, X8 Antibody Labeling Kit,164Dy—4Rxn, X8 Antibody LabelingKit,166Er—4Rxn, X8 Antibody Labeling Kit,169Tm—4Rxn, X8Antibody Labeling Kit,173Yb—4Rxn, X8 Antibody Labeling Kit,174Yb—4Rxn, X8 Antibody Labeling Kit,175Lu—4Rxn, X8 Antibody LabelingKit,176Yb—4Rxn.

[0060] The steps for making antibodies (142Nd_CD20, 144Nd_CCL17, 145Nd_IL3_CD123, 149Sm_CXCR5, 158Gd_CCL21, 160Gd_HLA_DR, 161Dy_CD56, 164Dy_CXCL12, 166Er_CD45RO, 169Tm_Bcl_6, 173Yb_CD127, 174Yb_EBNA2, 175Lu_LMP1, 176Yb_IDO) are as follows:

[0061] 1. Preparation of lanthanide-loaded polymers:

[0062] 1.1. Preloading of lanthanides in polymers:

[0063] Resuspend the Maxpar polymer in 95 μL Maxpar L-Buffer (spin the Maxpar polymer tube in a microcentrifuge for 10 seconds to ensure the reagent is at the bottom of the tube) (5 μL per Maxpar polymer tube and 95 μL Maxpar L-Buffer for each lanthanide metal); mix thoroughly with a pipette; then add 5 μL of the corresponding lanthanide metal solution to the test tube (see X8 Antibody Labeling Kit) (final concentration 2.5 mM); mix thoroughly with a pipette and incubate at 37°C for 30-40 minutes.

[0064] 1.2. Purification of polymers preloaded with lanthanides:

[0065] 1.2.1 Add 200 μL Maxpar L-Buffer (see X8 Antibody Labeling Kit); then add the lanthanide-loaded polymer mixture (i.e., obtained in step 1.1) to the filter containing Maxpar L-Buffer; centrifuge at 12,000 x g for 25 minutes at room temperature, and discard the waste liquid in the collection tube;

[0066] 1.2.2 Add 300 μL Maxpar C-Buffer (see X8 Antibody Labeling Kit), centrifuge at 12,000 x g for 30 minutes at room temperature, and discard the waste liquid in the collection tube. Take out the 3 kDa filter containing the lanthanide polymer (i.e., obtained in step 3), discard the waste liquid; and obtain the lanthanide polymer.

[0067] 2. Preparation of the corresponding partially reduced antibody:

[0068] 2.1. Buffer exchange and partial reduction of antibodies:

[0069] 2.1.1 Add 300 μL Maxpar R-Buffer (see X8 AntibodyLabeling Kit); then add up to 200 μL of antibody (choose the antibody here according to the antibody to be prepared, for example, CD20 for 142Nd_CD20, CCL17 for 144Nd_CCL17, etc.); centrifuge at room temperature at 12,000xg for 10 minutes; discard the liquid after centrifugation;

[0070] 2.1.2 Add 100 μL of 4 mM TCEP-R-buffer to each antibody (dilute 0.5 M TCEP stock solution to 4 mM with Maxpar R-Buffer. Each labeled antibody requires 100 μL of 4 mM TCEP-R-buffer;), mix thoroughly with a pipette and incubate at 37°C for 30 minutes;

[0071] 2.2. Purification of partially reduced antibodies:

[0072] Add 300 μL Maxpar C-Buffer to each 50 kDa filter; centrifuge at 12,000 x g for 10 minutes at room temperature and discard the waste liquid; add 400 μL Maxpar C-Buffer to the filter; centrifuge at 12,000 x g for 10 minutes at room temperature; discard the waste liquid; and obtain the corresponding partially reduced antibody.

[0073] The order of step 1 and step 2 can be swapped or performed simultaneously. There is no requirement for the order.

[0074] 3. Coupling of antibodies and lanthanide-loaded polymers:

[0075] Using a pipette, resuspend the lanthanide polymer (i.e., obtained in step 1) in 60 μL Maxpar C-Buffer; transfer the resuspended liquid to the corresponding 50 kDa filter of partially reduced antibody (i.e., obtained in step 2); mix well and incubate at 37°C for at least 60 minutes (maximum 2 hours) to obtain an antibody coupling mixture.

[0076] 4. Washing of metal-coupled antibodies:

[0077] Add 300 μL of Maxpar W-Buffer (see X8 Antibody Labeling Kit); centrifuge at 12,000 xg for 10 minutes at room temperature, discard the waste liquid; repeat three times with 400 μL Maxpar W-Buffer (a total of four washes).

[0078] 5. Recovering metal-coupled antibodies:

[0079] 5.1 Add 50 μL Maxpar W-Buffer to the 50 kDa filter and use a pipette to mix and rinse the filter wall;

[0080] 5.2 Invert the 50 kDa filter into a new collection tube;

[0081] 5.3 Centrifuge the inverted filter / collection tube assembly at 1000 x g for 2 minutes;

[0082] 5.4 Remove the inverted filter from the collection tube, rinse the filter wall with an additional 50 μL Maxpar W-Buffer, and place the inverted filter back into the collection tube;

[0083] 5.5 Centrifuge the inverted filter / collection tube assembly at 1000xg for 2 minutes; collect the precipitate.

[0084] 6. Yield determination and storage of metal-coupled antibodies:

[0085] 6.1 Using Maxpar W-Buffer as blank control, quantify the labeled antibody by measuring the absorbance at 280 nm.

[0086] 6.2 Dilute the antibody to a final concentration of 0.5 mg / mL using Antibody Stabilizer PBS and store at 4°C.

[0087] Preparation of FISH DP-154Sm-EBER1 / 2:

[0088] EBER1 / 2 labeled probe (i.e. FISH-DP-EBER1 / 2 probe): obtained by modifying the EBER1 / 2 detection probe using 5'Thiol-Modifier C6 SS;

[0089] EBER1 detection probe (FISH Prob-Hsa-EBER1), the sequence is:

[0090] TGCCGTCTTCGGTCAAGTACCAGCTGGTGGTC SEQ ID NO: 1;

[0091] EBER2 detection probe (FISH Prob-Hsa-EBER2), the sequence is:

[0092] CCTAGAGCATTTGCAAGTCAGGATTCTCTAAT SEQ ID NO:2;

[0093] FISH DP-154Sm-EBER1 / 2: obtained by labeling the above EBER1 / 2 labeled probes with 154Sm labels. The metal labels of the EBER1 / 2 bands of the present invention may also be other metals.

[0094] The rest of the reagents were from Deyun Kangrui Products in FISH RNA Fluorescence in situ hybridization kit (SP1003-T).

[0095] The preparation method of FISH DP-154Sm-EBER1 / 2 (abbreviated as 154Sm-EBER1 / 2) is as follows:

[0096] The main reagents and consumables required are:

[0097] 1. Metal label kit: X8 Antibody Labeling Kit, 154Sm—4Rxn (Fluidigm, 201154A);

[0098] 2. Centrifugal filter: μLtra filter, 3 kDa MWCO (Merck Millipore, UFC5003);

[0099] 3. Centrifugal filter: Centrifugal ultrafiltration tube, NMWCO 30 kDa (Merck Millipore, MRCF0R030);

[0100] 4.0.5M TCEP:Bond-Breaker TM TCEP solution (Pierce Cat#77720).

[0101] The first step is the reduction of thiol of nucleic acid: after centrifuging the FISH-DP-EBER1 / 2 probe at 2000r / 2min, add 100μL of 50mM TCEP-DEPC water to make a 250μM solution, and react at room temperature for 30min; then add 2 times the volume (200μL) of pre-cooled ethanol to mix thoroughly, and place at 4℃ for 30min; centrifuge again at 12,000g for 10min, remove the supernatant, add 500μL of 70% ethanol, centrifuge at 12000g for 2min, and remove the supernatant again; after the residual liquid evaporates to dryness, resuspend the dried oligonucleotide in 50μL Maxpar C-Buffer. The specific operation steps can be:

[0102] Required reagents: Preparation of 250 μM TCEP-DEPC water: Add 20 μL 0.5 M TCEP to 180 μL DEPC water.

[0103] 1. After centrifugation at 2000r / 2min, add 100μL of 50mM TCEP-DEPC water (10μL 0.5MTCEP added to 90μL DEPC water) to detect the concentration, prepare a 250μM solution, and react at room temperature for 30min;

[0104] 2. Add 2 times the volume (200 μL) of pre-cooled ethanol, mix thoroughly, and place at 4°C for 30 min;

[0105] 3. Centrifuge at 12,000 g for 10 min, carefully remove the supernatant, and remove all droplets on the tube wall;

[0106] 4. Add 500 μL of 70% ethanol to the precipitate, centrifuge at 12000 g for 2 min, carefully remove the supernatant, and remove all droplets on the tube wall;

[0107] 5. Place the opened centrifuge tube on the laboratory table at room temperature to allow the remaining liquid to evaporate to dryness;

[0108] 6. Resuspend the dried oligonucleotide in 50 μL Maxpar C-Buffer and measure the concentration.

[0109] The second step is to preload the polymer with 154Sm element: use 95 μL Maxpar L-Buffer (see X8Antibody Labeling Kit) to resuspend Maxpar Polymer and mix well; then add 5μL Maxpar 154Sm (see X8 Antibody Labeling Kit) solution (final concentration is 2.5mM), mix well; incubate at 37℃ for 30-40 minutes; the specific operation steps can be:

[0110] 1. Spin the Maxpar Polymer in a microcentrifuge (see X8 Antibody Labeling Kit) tube for 10 seconds to ensure that the reagent is at the bottom of the tube;

[0111] 2. Resuspend Maxpar Polymer with 95 μL Maxpar L-Buffer and mix well with a pipette;

[0112] 3. Add 5 μL of Maxpar 154Sm solution (final concentration 2.5 mM) to the test tube and mix well with a pipette;

[0113] Incubate at 437°C for 30-40 min.

[0114] The third step is to purify the polymer loaded with 154Sm: add 200μL Maxpar L-Buffer to the 3kDa filter; then continue to add the polymer mixture loaded with 154Sm; centrifuge at 12,000g for 25 minutes at room temperature; add 300μL Maxpar C-Buffer to the filter, and centrifuge at 12,000g for 30 minutes at room temperature. The specific operation steps can be:

[0115] 1. Add 200 μL Maxpar L-Buffer to the 3 kDa filter;

[0116] 2. Add the 154Sm-loaded polymer mixture obtained in the second step to the filter containing Maxpar L-Buffer;

[0117] 3. Centrifuge at 12,000 g for 25 minutes at room temperature and discard the waste liquid in the collection tube;

[0118] 4. Add 300 μL Maxpar C-Buffer (see X8 Antibody Labeling Kit), centrifuge at 12,000g for 30 minutes at room temperature.

[0119] Step 4: Couple nucleic acid with lanthanide polymer: Resuspend the polymer loaded with 154Sm in 50μL Maxpar C-Buffer; transfer it to the oligonucleotide resuspended in 50μL Maxpar C-Buffer in the first step, mix well, and incubate at room temperature for 2h; then add 1μL 0.5M TCEP to a final concentration of 5mM, incubate for 30min to reduce unconjugated oligonucleotides; then add 500μL DEPC water and centrifuge in a 30kda centrifugal filter device, 14000g for 12 minutes, repeat twice. Dissolve it with DEPC water, adjust the concentration to 1μM and store at 4 degrees. The specific operation steps can be:

[0120] 1. Use a pipette to resuspend the 154Sm-loaded polymer in 50 μL Maxpar C-Buffer;

[0121] 2. Transfer the resuspended 154Sm polymer to the oligonucleotide resuspended in 50 μL Maxpar C-Buffer in the first step;

[0122] 3. Pipette mix well and incubate at room temperature for 2 hours;

[0123] 4. Add 1 μL 0.5 M TCEP to a final concentration of 5 mM and incubate for 30 min to reduce unconjugated oligonucleotides;

[0124] 5. Add 100 μL of the incubated conjugate to a 30 kDa centrifugal filter device, add 500 μL of DEPC water, centrifuge at 14000 g for 12 minutes, and repeat twice;

[0125] 6. Dissolve in DEPC water, adjust the concentration to 1uM and store at 4 degrees.

[0126] S1. Pretreatment of Formalin-Fixed Stone Embedded Tissue Sections

[0127] 1. Baking: restore the paraffin tissue sections to room temperature and dry them, then bake them in a 65°C oven for 30-60 minutes;

[0128] 2. Preheat 1x Antigen Retrieval Buffer: Dilute 100× Antigen Retrieval Buffer to 1× with ddH2O, pour the diluted buffer into a plastic vertical staining bottle, the height must be completely covered; set the water bath to 97℃, place the vertical staining bottle in it to preheat for later use;

[0129] 3. Dewaxing: Take out the paraffin sections (4um), immerse them in two cylinders of xylene at room temperature, and dewax for 10 minutes respectively. Move the sections up and down from time to time to ensure sufficient dewaxing;

[0130] 4. Rehydration: Soak the sections in a series of ethanol concentrations (100%, 100%, 95%, 95%, 75%) for 5 minutes each time;

[0131] 5. Rinse the slides with ddH2O for 5 minutes (place the staining bottle on a horizontal shaker);

[0132] 6. Place the sections in a vertical staining bottle containing preheated 1x Antigen Retrieval buffer and incubate at 97°C for 30 minutes. Do not tighten the lid to maintain internal and external pressure balance.

[0133] 7. After incubation, place the vertical staining bottle at room temperature and cool it naturally to 70 degrees Celsius in 10 minutes;

[0134] 8. Transfer the slices into a vertical staining bottle containing ddH2O and wash for 10 minutes;

[0135] 9. Draw the hydrophobic circle: After the slices are dry, use ImmEdge TM Pen draws a hydrophobic circle around the tissue;

[0136] 10. Preheat hydrochloric acid: add 900 μL 0.1M HCI into a 15 mL centrifuge tube and preheat in a 42°C constant temperature incubator for later use;

[0137] 11. Washing: After the hydrophobic circle is dry, add 50L Wash Buffer, let it stand for 10 seconds and then discard the liquid, repeat 3 times;

[0138] 12. Fixation: Add 50μL 4% PFA to the hydrophobic circle, let stand for 10 minutes, aspirate the liquid in the hydrophobic circle and add 50μL Wash Buffer, let stand for 10 seconds and then discard the liquid, repeat 3 times, and keep the last Wash Buffer;

[0139] 13. Permeabilization: Add 10 μL of 3 mg / mL pepsin stock solution to 990 μL of preheated 0.7 M HCI to make the final concentration of pepsin 0.03 mg / mL, vortex and centrifuge; aspirate the Wash Buffer in the hydrophobic circle and add the permeabilization solution; place in a wet box (covered) and permeabilize in a 42°C constant temperature incubator for 30-60 minutes; (Due to tissue heterogeneity, the pepsin treatment time varies, you can adjust it according to the actual situation, but too long / too short digestion time may cause problems such as changes in cell morphology or reduced signal points. It is recommended that you use 30 minutes for the first experiment).

[0140] 14. Washing: After permeabilization is completed, aspirate the liquid in the hydrophobic circle, add 50μL Wash Buffer, let it stand for 10 seconds and then discard the liquid. Repeat 3 times and keep the last Wash Buffer.

[0141] S2. Probe Hybridization

[0142] Configuration of the first reaction solution of the 50μL system: Nuclease-free Water (15μL) (see FISH RNA fluorescence in situ hybridization kit), Hyb Buffer 1 (vortex and centrifuge, 25 μL) (see FISH RNA fluorescence in situ hybridization kit), PG (thawed thoroughly and centrifuged by vortexing, 5 μL) (see FISH RNA Fluorescence in situ hybridization kit), FISH Probe-Hsa-EBER1 (thawed thoroughly and centrifuged by vortexing, 2.5 μL) (see FISH RNA fluorescence in situ hybridization kit), FISH Probe-Hsa-EBER2 (thawed thoroughly and centrifuged by vortexing, 2.5 μL) (see FISH RNA fluorescence in situ hybridization kit);

[0143] 1. Vortex and centrifuge; aspirate the liquid in the hydrophobic circle, immediately add the prepared system reaction solution, place in a wet box (close the lid tightly), and hybridize in a 42°C constant temperature incubator for 4 hours;

[0144] 2. After the reaction is completed, aspirate the liquid in the hydrophobic circle in the pre-treatment step of the formalin-fixed stone embedded tissue section, immediately add 50μL Wash Buffer, let it stand for 10sec and then discard the liquid, wash 3 times in total, and keep the last Wash Buffer.

[0145] S3. Post-hybridization washing

[0146] 1. Add Hyb Wash Buffer (see FISH RNA Fluorescence in situ hybridization kit) was vortexed and centrifuged, the liquid in the hydrophobic circle was aspirated, and 50 μL Hyb Wash Buffer was immediately added, and the sample was placed in a wet box (with a cover, no need to cover tightly), and incubated in a 42°C constant temperature incubator for 5 minutes, and washed 3 times in total;

[0147] 2. After the reaction is completed, aspirate the liquid in the hydrophobic circle and immediately add 50 μL Wash Buffer (see FISH RNA Fluorescence in situ hybridization kit), let it stand for 10 seconds and then discard the solution, wash 3 times in total, and keep the last wash buffer.

[0148] S4. Probe Circling

[0149] Preparation of the second reaction solution of the 50 μL system: Nuclease-free Water (12.5 μL), B1 (thawed and vortexed, centrifuged, 25 μL) (see FISH RNA fluorescence in situ hybridization kit), PG (after full thawing, vortex and centrifuge, 5 μL), ST (after full thawing, vortex and centrifuge, 2.5 μL) (see FISH RNA fluorescence in situ hybridization kit), E1 (flash centrifugation after full thawing, 5 μL) (see FISH RNA fluorescence in situ hybridization kit);

[0150] 1. Vortex and mix well; aspirate the liquid in the hydrophobic circle (in the post-hybridization washing step) and immediately add the second reaction solution, place in a wet box (close the lid tightly), and react in a 42°C constant temperature incubator for 0.5h;

[0151] 2. After the reaction is completed, aspirate the liquid in the hydrophobic circle and immediately add 50μL Wash Buffer. Let it stand for 10 seconds and then discard the liquid. Wash 3 times in total and keep the last Wash Buffer.

[0152] S5. Rolling circle amplification

[0153] Preparation of the third reaction solution of the 50 μL system: Nuclease-free Water (23 μL), B2 (thawed and vortexed, centrifuged, 25 μL) (see FISH RNA fluorescence in situ hybridization kit), E2 (flash centrifugation after full thawing, 2 μL) (see FISH RNA fluorescence in situ hybridization kit);

[0154] 1. Vortex and mix thoroughly by centrifugation; aspirate the liquid in the hydrophobic circle (in the probe ring formation step) and immediately add the third reaction solution, place in a wet box (close the lid tightly), and react in a 42°C constant temperature incubator for 2 hours;

[0155] 2. After the reaction is completed, aspirate the liquid in the hydrophobic circle and immediately add 50μL Wash Buffer. Let it stand for 10 seconds and then discard the liquid. Wash 3 times in total and keep the last Wash Buffer.

[0156] This can be used as a pause point for the experiment. While retaining the Wash Buffer in the hydrophobic circle, the slices can be placed in a humidified box (with the lid tightly closed) and stored at 4°C for about a week.

[0157] S6. Metal-labeled probe hybridization

[0158] Preparation of the fourth reaction solution of the 50 μL system: Nuclease-free Water (22.5 μL), Hyb Buffer 2 (vortex centrifugation, 25 μL) (see FISH RNA fluorescence in situ hybridization kit), FISH DP-154Sm-EBER1 / 2 (vortex and centrifuge, equal amounts of both, a total of 2.5 μL);

[0159] 1. Vortex and mix thoroughly by centrifugation; aspirate the liquid in the hydrophobic circle (in the rolling ring expansion step) and immediately add the fourth reaction solution, place in a wet box (close the lid tightly), and react in a 42°C constant temperature incubator for 0.5h;

[0160] 2. After the reaction is completed, aspirate the liquid in the hydrophobic circle and immediately add 50μL Wash Buffer. Let it stand for 10 seconds and then discard the liquid. Wash 3 times in total.

[0161] S7.IMC Antibody Incubation

[0162] 1.Use SuperBlock at room temperature TM Block with blocking buffer for 45 min;

[0163] 2. Use SuperBlock TM Prepare antibody mix with blocking buffer and estimate the total volume of mix. 100 μL system is enough to stain 1 cm 2 The antibody was centrifuged at 13000g for 2 minutes and the antibody was aspirated from the top of the liquid to avoid antibody aggregation. When preparing the mix, SuperBlock was first added to the EP tube. TM Blocking buffer, then add antibodies, the antibody dilution ratio is shown in Table 3 below:

[0164] Table 3 Dilution ratio of each antibody in Antibody Mix

[0165] Antibody Dilution ratio Antibody Dilution ratio 141Pr_α_SMA 1:200 160Gd_HLA_DR 1:400 142Nd_CD20 1:200 161Dy_CD56 1:100 143Nd_Vimentin 1:200 162Dy_CD8a 1:200 144Nd_CCL17 1:100 163Dy_CCR6 1:100 145Nd_CD123 1:100 164Dy_CXCL12 1:100 146Nd_BCL2 1:200 165Ho_PD1 1:100 147Sm_CD163 1:200 166Er_CD45RO 1:200 148Nd_ICOS 1:200 167Er_GZMB 1:200 149Sm_CXCR5 1:100 168Er_Ki67 1:200 150Nd_PDL1 1:100 169Tm_Bcl_6 1:100 151Eu_CD31 1:200 170Er_CD3 1:200 152Sm_CD45 1:100 171Yb_CD27 1:200 153Eu_LAG_3 1:100 172Yb_PDL2 1:100 155Gd_FoxP3 1:200 173Yb_CD127 1:100 156Gd_CD4 1:200 174Yb_EBNA2 1:100 158Gd_CCL21 1:200 175Lu_LMP1 1:100 159Tb_CD68 1:200 176Yb_IDO 1:200

[0166] 3. Aspirate the blocking solution, drop the antibody onto the tissue section (if the antibody cannot be spread, apply it horizontally with the tip of the gun, being careful not to scratch the section), and incubate overnight at 4°C;

[0167] 4. Wash twice with DPBS containing 0.2% Triton-X for 8 minutes, and shake slowly on a shaker;

[0168] 5. Wash with DPBS for 8 minutes × 2 times, and shake slowly on a shaker;

[0169] 6. Dilute Cell-ID with DPBS at room temperature TM Intercalator-Ir (i.e., 191 / 3Ir_DNA1 / 2 1:400), drop the diluted dye onto the area of ​​the tissue section and stain in a humidified box at room temperature for 30 min;

[0170] 7. Rinse with ddH2O for 5 minutes;

[0171] 8. Air-dry the slides at room temperature for at least 20 minutes before testing on an imaging mass spectrometer.

[0172] Embodiment 1:

[0173] Samples: Lymph node samples were collected from patients with Epstein-Barr virus-positive diffuse large B-cell lymphoma and prepared into paraffin tissue sections.

[0174] Detection method:

[0175] The pretreatment of formalin-fixed stone embedded tissue sections, probe hybridization, post-hybridization washing, probe circularization, rolling circle amplification, metal label probe hybridization, and IMC antibody incubation were performed in sequence.

[0176] Result analysis: The detection results were analyzed using MCDviewer software, with different pseudo colors given to the above markers. Figure 1-3 The method of the present invention can detect 36 indicators simultaneously.

[0177] Embodiment 2:

[0178] Samples: Lymph node samples were collected from patients with Epstein-Barr virus-positive diffuse large B-cell lymphoma and prepared into paraffin tissue sections.

[0179] Detection method:

[0180] The pretreatment of formalin-fixed stone embedded tissue sections, probe hybridization, post-hybridization washing, probe circularization, rolling circle amplification, metal label probe hybridization, and IMC antibody incubation were performed in sequence.

[0181] Result analysis: The detection results were analyzed using MCDviewer software, with different pseudo colors given to the above markers. Figure 4-6 The method of the present invention can detect 36 indicators simultaneously.

[0182] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention without departing from the principles and intent of the present invention.

Claims

1. A detection reagent suitable for detecting the immune microenvironment of EB virus-positive DLBCL by imaging mass spectrometry, characterized in that: The detection reagent includes an antibody combination and a probe combination, wherein the antibody combination is α_SMA, HLA_DR, CD20, CD56, Vimentin, CD8a, CCL17, CCR6, IL3_CD123, CXCL12, BCL2, PD1, CD163, CD45RO, ICOS, GranzymeB, CXCR5, Ki_67, PDL1, Bcl_6, CD31, CD3, CD45, CD27, LAG_3, PDL2, FoxP3, CD127, CD4, EBNA2, CCL21, LMP1, CD68, IDO antibodies, and the probe combination is EBER1 / 2 probe; all antibodies and probes are labeled Metal tag; preferably, the metal tag is a lanthanide metal tag; more preferably, the lanthanide metal tag is 141Pr, 142Nd, 143Nd, 144Nd, 145Nd, 146Nd, 147Sm, 148Nd, 149Sm, 150Nd, 151Eu, 152Sm, 153Eu, 154Sm, 155Gd, 156Gd, 157Gb, 158Gd, 159Tb, 160Gd, 161Dy, 162Dy, 163Dy, 164Dy, 165Ho, 166Er, 167Er, 168Er, 169Tm, 170Er, 171Yb, 172Yb, 173Yb, 174Yb, 175Lu or 176Yb.

2. The detection reagent according to claim 1, characterized in that The antibody combination is an α_SMA antibody labeled with 141Pr, recorded as 141Pr_α_SMA; and the like are recorded as 160Gd_HLA_DR, 142Nd_CD20, 161Dy_CD56, 143Nd_Vimentin, 162_Dy_CD8a, 144Nd_CCL17, 163Dy_CCR6, 145Nd_IL3_CD123, 164Dy_CXCL12, 146Nd_BCL2, 165Ho_PD1, 147Sm_CD163, 166Er_CD45RO, 148Nd_ICOS, 167Er_GranzymeB, 149Sm_CXCR5, 168Er_Ki_67, 150Nd_PDL1, 169Tm_Bcl_6, 151Eu_CD31, 170Er_CD3, 152Sm_CD45, 171Yb_CD27, 153Eu_LAG_3, 172Yb_PDL2, 155Gd_FoxP3, 173Yb_CD127, 156Gd_CD4, 174Yb_EBNA2, 158Gd_CCL21, 175Lu_LMP1, 159Tb_CD68, 176Yb_IDO; the probe combination is 154Sm_EBER1 / 2 labeled with 154Sm.

3. The detection reagent according to claim 1, characterized in that The method for preparing the antibody in the antibody combination is as follows: A1. Preparation of lanthanide-loaded polymers: Preloading: Resuspend the Maxpar polymer with Maxpar L-Buffer; then add the corresponding lanthanide metal solution, preferably, the final concentration of the lanthanide metal solution is 2.5mM; mix and incubate, preferably at 37°C for 30-40 minutes; Maxpar polymer is X8 Antibody Labeling Kit,142Nd—4Rxn, X8 Antibody LabelingKit,144Nd—4Rxn, X8 Antibody Labeling Kit,145Nd—4Rxn, X8Antibody Labeling Kit,149Sm—4Rxn, X8 Antibody Labeling Kit,154Sm—4Rxn, X8 Antibody Labeling Kit,158Gd—4Rxn, X8 Antibody LabelingKit,160Gd—4Rxn, X8 Antibody Labeling Kit,161Dy—5Rxn, X8Antibody Labeling Kit,164Dy—4Rxn, X8 Antibody Labeling Kit,166Er—4Rxn, X8 Antibody Labeling Kit,169Tm—4Rxn, X8 Antibody LabelingKit,173Yb—4Rxn, X8 Antibody Labeling Kit,174Yb—4Rxn, X8Antibody Labeling Kit,175Lu-4Rxn and X8 Antibody Labeling Kit,176Yb—4Rxn; Purification: adding the above-obtained product to a filter containing Maxpar L-Buffer, centrifuging, preferably, centrifuging at 12,000 x g for 25 minutes at room temperature; discarding the waste liquid in the collection tube; adding Maxpar C-Buffer to the filter, centrifuging, preferably centrifuging at 12,000 x g for 30 minutes at room temperature; discarding the waste liquid in the collection tube; obtaining the lanthanide-loaded polymer; A2. Preparation of the corresponding partially reduced antibody: Add Maxpar R-Buffer and antibody to a 50kDa filter, centrifuge at room temperature; preferably, centrifuge at 12,000xg for 10 minutes; discard the liquid after centrifugation; then add 4mM TCEP-R-buffer, mix thoroughly and incubate, preferably, incubate at 37°C for 30 minutes; add Maxpar C-Buffer, centrifuge, preferably, centrifuge at 12,000xg for 10 minutes at room temperature; discard the waste liquid, then add Maxpar C-Buffer; centrifuge at 12,000xg for 10 minutes at room temperature; discard the waste liquid; obtain the corresponding partially reduced antibody; The order of the above steps A1 and A2 can be swapped or performed simultaneously, with no order requirement. A3. Coupling of antibodies with lanthanide-loaded polymers: Resuspend the product obtained in A1 in Maxpar C-Buffer and add it to the product obtained in A2, mix well and incubate, preferably, incubate at 37° C. for 60-120 minutes to obtain an antibody coupling mixture; A4. Washing of metal-coupled antibodies: Add Maxpar W-Buffer to the product obtained in A3, centrifuge, preferably, centrifuge at 12,000 x g for 10 minutes at room temperature; discard the waste liquid; and then rinse repeatedly with Maxpar W-Buffer for multiple times; preferably, repeat the rinsing 1-5 times; A5. Recycling of metal-conjugated antibodies: Add Maxpar W-Buffer to the 50kDa filter and mix with a pipette to rinse the filter wall; then invert the 50kDa filter into a new collection tube and centrifuge the inverted filter / collection tube assembly, preferably at 1000xg for 2 minutes; remove the inverted filter from the collection tube, rinse the filter wall with Maxpar W-Buffer, and place the inverted filter back into the collection tube; centrifuge the inverted filter / collection tube assembly to collect the precipitate, preferably at 1000xg for 2 minutes.

4. A kit, characterized in that: Contains the detection reagent according to any one of claims 1 to 3.

5. A method for detecting the immune microenvironment of Epstein-Barr virus-positive DLBCL, characterized in that: The detection reagent according to any one of claims 1 to 3 or the kit according to claim 4 is used.

6. A method for detecting the immune microenvironment of Epstein-Barr virus-positive DLBCL using imaging mass spectrometry, characterized in that: The following steps are included: B1. Pre-treatment of formalin-fixed stone-embedded tissue sections: The paraffin tissue sections to be tested were dried at room temperature, and then baked in an oven at 65±5℃ for 30-60min; the sections were taken out and immersed in xylene at room temperature for 10±1min each, and the sections were moved up and down from time to time to ensure sufficient dewaxing; the sections were immersed in 100%, 100%, 95%, 95%, and 75% ethanol in turn, each for 5±1min; they were washed with ultrapure water 5±1 times; the sections were slowly immersed in a vertical staining bottle containing preheated 1xAntigen Retrieval buffer and incubated at 97℃ for 30±5min, then cooled to 70±5℃ at room temperature, and then transferred to a vertical staining bottle containing ddH2O and washed for 10 minutes. After the sections were dried, a hydrophobic circle was drawn around the tissue using an immunohistochemistry pen; after the hydrophobic circle was dried, Wash was added. Buffer, let it stand for 10±1sec and then discard the liquid, repeat several times; add 4±1% PFA to the hydrophobic circle, let it stand for 10±1min, aspirate the liquid in the hydrophobic circle and add WashBuffer, let it stand for 10±1sec and then discard the liquid, repeat several times, and keep the last WashBuffer; aspirate the WashBuffer in the hydrophobic circle and add 0.3±0.1mg / mL pepsin solution diluted with 0.7±0.1MHCL; Place in a wet box and permeabilize in a 42±2℃ constant temperature incubator for 30-60 minutes. After permeabilization, aspirate the liquid in the hydrophobic circle, add Wash Buffer, let it stand for 10±1sec and then discard the liquid. Repeat several times and keep the last Wash Buffer. B2. Probe hybridization: Aspirate the liquid in the hydrophobic circle, then immediately add the first reaction solution, place in a wet box, and hybridize in a 42±2℃ constant temperature incubator for 4h; after the reaction is completed, aspirate the liquid in the hydrophobic circle, then immediately add Wash Buffer, let it stand for 10±1sec and then discard the liquid, repeat the washing several times, and keep the last Wash Buffer; The first reaction solution is prepared as follows: based on a 50 μL system, 15 μL of Nuclease-free Water, 25 μL of HybBuffer 1, 5 μL of PG, 2.5 μL of FISH Probe-Hsa-EBER1, and 2.5 μL of FISH Probe-Hsa-EBER2; B3. Post-hybridization cleaning: Vortex and centrifuge the Hyb Wash Buffer, aspirate the liquid in the hydrophobic circle, immediately add Hyb Wash Buffer, place in a wet box, incubate in a constant temperature incubator at 42±2℃ for 5±1min, and repeat the wash several times; after the reaction is completed, aspirate the liquid in the hydrophobic circle, immediately add Wash Buffer, let it stand for 10±1sec, then discard the liquid, repeat the wash several times, and keep the last Wash Buffer; B4. Probe circularization: Vortex and mix well, centrifuge; aspirate the liquid in the hydrophobic circle and immediately add the second reaction solution, place in a wet box, and react in a 42±2℃ constant temperature incubator for 0.5±0.1h; after the reaction, aspirate the liquid in the hydrophobic circle and immediately add Wash Buffer, let it stand for 10±1sec and then discard the liquid, repeat the washing several times, and keep the last Wash Buffer; The second reaction solution was prepared as follows: based on a 50 μL system, 12.5 μL of Nuclease-free Water, 25 μL of B1, 5 μL of PG, 2.5 μL of ST, and 5 μL of E1; B5. Rolling circle amplification: Vortex and mix well, centrifuge; aspirate the liquid in the hydrophobic circle and immediately add the third reaction solution, place in a wet box, and react in a 42±2℃ constant temperature incubator for 2±0.5h; after the reaction, aspirate the liquid in the hydrophobic circle and immediately add Wash Buffer, let it stand for 10±1sec, then discard the liquid, repeat the washing several times, and keep the last Wash Buffer; The third reaction solution is prepared as follows: based on a 50 μL system, 23 μL of Nuclease-free Water, 25 μL of B2, and 2 μL of E2; B6. Metal tag probe hybridization: Vortex and mix well, centrifuge; suck out the liquid in the hydrophobic circle and immediately add the fourth reaction solution, place in a wet box, and react in a 42±2℃ constant temperature incubator for 0.5±0.1h; after the reaction, suck out the liquid in the hydrophobic circle and immediately add Wash Buffer, let it stand for 10±1sec, then discard the liquid, and repeat the washing several times; The fourth reaction solution is prepared as follows: based on a 50 μL system, 22.5 μL of Nuclease-free Water, 25 μL of HybBuffer 2, and 2.5 μL of metal-labeled detection probe; The metal-labeled detection probe is obtained by first modifying the EBER1 / 2 detection probe and then labeling it with a metal tag; more preferably, the modification method is to use 5' Thiol-Modifier C6 SS is modified; the metal tag is 141Pr, 142Nd, 143Nd, 144Nd, 145Nd, 146Nd, 147Sm, 148Nd, 149Sm, 150Nd, 151Eu, 152Sm, 153Eu, 154Sm, 155Gd, 156Gd, 158Gd, 159Tb, 160Gd, 161Dy, 162Dy, 163Dy, 164Dy, 165Ho, 166Er, 167Er, 168Er, 169Tm, 170Er, 171Yb, 172Yb, 173Yb, 174Yb, 175Lu or 176Yb; B7.IMC Antibody Incubation Block with blocking buffer at room temperature for 45±5 minutes; remove the blocking solution, drip the combined antibody onto the tissue section area, and incubate at 4±2°C overnight; wash several times with DPBS containing 0.2% Triton-X and shake slowly on a shaker; repeat the washing and shaking steps several times; drip the diluted dye onto the tissue section area, stain at room temperature in a wet box, rinse, and dry for detection on an imaging mass spectrometer.

Images