Application of benzenesulfonamide in preparation of medicine for treating peripheral nerve adhesion diseases

Abstract

The invention provides an application of benzenesulfonamide in preparation of drugs for treating peripheral nerve adhesion diseases, and relates to the technical field of biomedicine, the technical scheme is as follows: the application of benzenesulfonamide in preparation of drugs for treating peripheral nerve adhesion diseases is proved through specific verification experiments, and specifically, the application of benzenesulfonamide in preparation of drugs for treating peripheral nerve adhesion diseases has a good application prospect. According to the application, the influence of benzenesulfonamide on mouse nerve adhesion is systematically evaluated by various technical means such as direct observation, electrophysiological recording and behavioral testing on nerve adhesion and muscle atrophy, and the positive effects of benzenesulfonamide on the aspects of promoting adhesion nerve recovery, improving movement balance ability and increasing nerve conduction rate are successfully proved. The research results not only provide a solid scientific basis for the benzenesulfonamide as a potential therapeutic drug, but also open up a new research direction for the treatment of peripheral nerve adhesion diseases.

Description

Technical Field

[0001] The invention relates to the field of biomedical technology, and in particular to application of benzenesulfonamide in preparing medicines for treating peripheral nerve adhesion diseases. Background Art

[0002] Peripheral nerve injury adhesion is a complex medical condition, usually caused by trauma, inflammation, long-term compression or surgical complications. When nerves are damaged, if timely and effective intervention is not carried out, the damaged nerve fibers may abnormally adhere to the surrounding connective tissue, leading to a series of serious health problems. These hazards include but are not limited to a significant decline in motor function. Patients may face challenges such as difficulty in limb movement and loss of fine motor skills; impaired sensory function, such as weakened or lost sensory abilities such as touch and pain, seriously affects patients' daily life and self-protection ability; in addition, long-term illness may also bring a heavy psychological burden, leading to the emergence of psychological problems such as inferiority and depression, and even in some cases, may cause permanent disability, greatly reducing the quality of life of patients.

[0003] There are many treatment options for this condition. On the one hand, general treatments, such as adjusting diet and maintaining moderate exercise, can assist in the recovery of nerve function; on the other hand, drug treatments such as neurotrophic drugs and non-steroidal anti-inflammatory drugs can promote nerve repair, reduce inflammation and adhesions to a certain extent. Physical therapy and rehabilitation therapy further promote the recovery of nerve function and the enhancement of muscle strength through specific instruments and training methods. In extreme cases, surgery such as neurolysis and neurosuturing is also a necessary treatment method. However, despite the diversity of treatment methods, there is still a lack of effective therapeutic drugs in the existing technology that can directly target the pathological mechanism of nerve injury adhesion, efficiently promote nerve regeneration and reduce the formation of adhesions. This is an important direction for future medical research and development. Summary of the invention

[0004] The purpose of the present invention is to solve the technical problem that there is a lack of effective therapeutic drugs in the prior art that can directly target the pathological mechanism of nerve injury adhesion.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] Application of benzenesulfonamide in the preparation of drugs for treating peripheral nerve adhesion diseases.

[0007] Preferably, the peripheral nerve adhesion disease includes sciatic nerve adhesion.

[0008] Preferably, the drug is in the form of an injection or an oral dosage form.

[0009] Preferably, the drug is used to improve peripheral nerve adhesion in the body, and promote motor balance ability and nerve conduction rate, thereby promoting the recovery of adhered nerves.

[0010] The present application also provides a drug for treating peripheral nerve adhesion diseases, wherein the drug includes benzenesulfonamide.

[0011] Preferably, the medicine also includes pharmaceutically acceptable excipients.

[0012] Compared with the prior art, this application provides the application of benzenesulfonamide in the preparation of drugs for treating peripheral nerve adhesion diseases, and has been proved through specific verification experiments. Specifically, this application systematically evaluates the effect of benzenesulfonamide on mouse nerve adhesion by directly observing nerve adhesion and muscle atrophy, electrophysiological recording and behavioral testing, and successfully confirms its positive role in promoting the recovery of adhesion nerves, improving motor balance ability and increasing nerve conduction rate. These research results not only provide a solid scientific basis for benzenesulfonamide as a potential therapeutic drug, but also open up a new research direction for the treatment of peripheral nerve adhesion diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is a comparison diagram used to prove that benzenesulfonamide can effectively reduce the degree of nerve adhesion in one embodiment of the present invention;

[0014] Figure 2 This is a comparison diagram showing that benzenesulfonamide can effectively promote the motor ability of mice in one embodiment of the present invention;

[0015] Figure 3 This is a comparison diagram of benzenesulfonamide effectively improving the conduction velocity of the sciatic nerve in mice according to one embodiment of the present invention;

[0016] Figure 4 This is a comparison diagram of how benzenesulfonamide effectively promotes the motor balance ability of mice in one embodiment of the present invention;

[0017] Figure 5 This is a comparison diagram showing that benzenesulfonamide in one embodiment of the present invention promotes nerve myelin regeneration and has a significant neuroprotective effect;

[0018] Figure 6 This is a comparison diagram showing that benzenesulfonamide is beneficial to the development and repair of the myelin sheath of the sciatic nerve of mice in one embodiment of the present invention;

[0019] Figure 7 This is a diagram proving that benzenesulfonamide in one embodiment of the present invention inhibits the expression of inflammatory factors and has a significant anti-inflammatory effect. DETAILED DESCRIPTION

[0020] The present invention is further described in detail below in conjunction with specific embodiments.

[0021] Since the sciatic nerve is the most important and intuitive material for studying peripheral nerve adhesion, the sciatic nerve is used in the subsequent experiments in this application.

[0022] Experimental Materials:

[0023] Benzene sulfonamide (CAS: 98-10-2), bovine serum albumin, glutaraldehyde, and DMSO were purchased from Sigma, real-time quantitative PCR dyes were purchased from Roche Biotechnology, and primers were from Shanghai Bio-Technology Co., Ltd.

[0024] Experiment 1: Construction of sciatic nerve adhesion model:

[0025] Eight-week-old ICR mice were purchased from the Experimental Animal Center of Nanjing University. The process of establishing the sciatic nerve adhesion model is as follows: anesthesia is performed by subcutaneous injection of 3% sodium pentobarbital (1 ml / kg). The skin below the buttocks was cut open, and the muscle was bluntly cut with fine surgical scissors and forceps to expose the right sciatic nerve in the middle of the thigh. 20 μL of the adhesive (45% bovine serum albumin + 12% glutaraldehyde) was dropped between the sciatic nerve and the muscle to construct the sciatic nerve adhesion model. Drug experimental group: intraperitoneal injection of 50 μg / g of benzenesulfonamide for 7 consecutive days; control group: intraperitoneal injection of 30 μL DMSO for 7 consecutive days. All animal experimental protocols were approved by the Animal Care and Utilization Committee of Nantong University and the Animal Protection Ethics Committee of Jiangsu Province. The establishment of the mouse sciatic nerve adhesion model was carried out in accordance with the approved guidelines.

[0026] Experiment 2: Observation of nerve adhesion and muscle atrophy in mice:

[0027] Six weeks after the model was established, the adhesion and muscle atrophy of the sciatic nerve of the control group mice and the drug experimental group mice were compared to clarify the effect of benzenesulfonamide on nerve adhesion in mice. 3% sodium pentobarbital (1 ml / kg) was injected subcutaneously for anesthesia. The skin below the buttocks was cut, the skin and muscle tissue were separated, and the phenotypic differences between the two groups of mice were directly observed.

[0028] Experiment 3: Animal behavior testing:

[0029] In order to clarify the effect of benzenesulfonamide on the motor recovery of mice with sciatic nerve adhesion, the present application used rotarod test, electrophysiological test and gait test.

[0030] Rotarod test: An accelerating rotarod apparatus (model LE8500, Pan Laboratory) was used. Before the test, mice were habituated to the test room for 30 minutes. The mice were gently placed on the rotarod by gently shaking them, and trained on the rotarod in an accelerating mode (4-40 rpm) at intervals of 3 and 5 minutes for 3 days. The training was repeated at a constant speed (16 rpm) until the mice were able to stay on the rod for at least 300 seconds. For the formal test, the mice were placed on a rotating drum and the rotarod was set to an accelerating mode, i.e., accelerating at a speed of 4 to 40 rpm within 5 minutes. The time spent moving on the rotarod was recorded before the fall was measured.

[0031] Gait experiment: The gait dynamics of quadrupeds were evaluated by footprint analysis of mice using the Digigait imaging system, and the stride length of the hind limbs was assessed at a speed of 8 cm / s. The footprints were analyzed by the following four measurements: distance to the contralateral foot, footprint length, maximum toe extension between the first and fifth toes, and paw extension between the center of the second and fourth toes.

[0032] Electrophysiological experiments: In this study, mice were anesthetized with a combined anesthetic. Then, the conduction velocity (NCV) was measured using an electromyographic device (NeuropackS1 MEB-9402, Nihon-Kohden, Tokyo, Japan). A needle electrode was inserted into the gastrocnemius muscle of the mouse, and the ground electrode was clamped on the exposed skin. The stimulus intensity was gradually increased from 0.1 mA to 3.0 mA to trigger the waveform. Stimulation was performed at a frequency of 1 Hz for 1 ms. The corresponding data were recorded for further analysis. The body temperature of the mice was maintained at 37 °C ± 0.5 °C using a heating lamp throughout the experiment.

[0033] Experiment 4: Electron microscopic observation of sciatic nerve tissue

[0034] Three mice with sciatic nerve adhesion for 6 weeks were randomly selected from different groups (benzenesulfonamide treatment group and control group). Under deep anesthesia, the sciatic nerve tissue at the adhesion site was taken and cut into electron microscope specimen size (1.2mm x1 mmx1 mm), immersed in 4% glutaraldehyde solution for fixation, and fixed with 1% osmium acid for secondary fixation, uranyl acetate staining, gradient ethanol dehydration, epoxy resin embedding, semi-thin section positioning, ultra-thin section counterstained with lead citrate, and transmission electron microscope selection for observation. The obtained photos were used to measure the myelinated nerve diameter and axon diameter on the instrument's built-in image analysis system, and the axon diameter / myelinated nerve diameter value (g-ratio) was used to measure the myelin sheath thickness, so as to infer the protective effect of benzenesulfonamide on damaged nerves.

[0035] Experiment 5: Detection of immune factor expression

[0036] Total RNA from sciatic nerve tissue was extracted using Invitrogen's Trizol reagent, and the first-strand cDNA was synthesized using Roche's reverse transcription kit. Gene expression analysis was performed using Roche's SYBR Green Supermix, and the instrument was Bio-Rad's iQ5 Multicolor Real-Time PCR Detection System. The analysis results were analyzed using 2 -△△Ct mRNA levels were calculated using the 18S housekeeping gene. The primer sequences used were as follows:

[0037] 18S rRNA forward primer: AGCTCCAATAGCGTATATTAAAG

[0038] 18S rRNA negative primer: CGGTCCTATTCCATTATTCCTA

[0039] IL1α forward primer: GTGTTGCTGAAGGAGTTG

[0040] IL1α negative primer: ATCTGGAAGTCTGTCATAGAG

[0041] IL1β forward primer: GCAACCACTTACCTATTTATTTATG

[0042] IL1β negative primer: TTCATACTCATCAAAGCAATGT

[0043] CD68 forward primer: TTGCTGCCTCTCATCATT

[0044] CD68 negative primer: ACAGAGAAGGAAGGTAACTG

[0045] The above experimental results are as follows:

[0046] In order to study whether benzenesulfonamide can improve the degree of peripheral nerve adhesion in vivo, the sciatic nerve adhesion model was constructed using ICR mice in this application, and the differences in the degree of nerve adhesion and muscle atrophy between the drug experimental group and the control group were observed. The results showed that benzenesulfonamide can effectively reduce the degree of nerve adhesion ( Figure 1 ).

[0047] The results of motor behavior analysis of the changes in the motor balance ability and nerve conduction velocity of mice after 2-benzenesulfonamide treatment showed that the motor balance ability of mice treated with benzenesulfonamide was better restored and the nerve conduction velocity was faster ( Figure 2-4 ).

[0048] In order to further clarify the protective effect of benzenesulfonamide on adhesion of sciatic nerve tissue, the myelin sheath tissue of sciatic nerve in different groups of mice was observed by transmission electron microscopy in this application. The results showed that the myelin sheath structure of adhesion nerves after drug treatment was more orderly and the new myelin sheath of nerves was thicker ( Figure 5 , 6).

[0049] Imbalanced immune homeostasis of adhesion tissue and excessive expression of neuroinflammatory factors are important factors affecting the recovery of nerve adhesion. This application analyzes the effect of the drug on the expression of inflammatory factors. The results show that the drug effectively regulates the immune microenvironment, reduces the expression of proinflammatory factors, significantly inhibits the occurrence and development of inflammation, and is beneficial to nerve recovery ( Figure 7 ).

[0050] Based on the above specific verification experiments, the present application provides the use of benzenesulfonamide in the preparation of a drug for treating peripheral nerve adhesion diseases, wherein the peripheral nerve adhesion diseases include sciatic nerve adhesion. The chemical formula of the benzenesulfonamide is C6H7NO2S, and its structural formula is as follows:

[0051]

[0052] The drug is in the form of an injection or oral dosage form. In one embodiment, the drug is used to improve peripheral nerve adhesion in the body, and promote motor balance ability and nerve conduction rate, thereby promoting the recovery of adhesion nerves.

[0053] Based on the above content, the present application also provides a drug for treating peripheral nerve adhesion diseases, wherein the drug includes benzenesulfonamide.

[0054] In one embodiment, the drug further comprises a pharmaceutically acceptable excipient.

[0055] In summary, this application systematically evaluated the effect of benzenesulfonamide on nerve adhesion in mice by direct observation of nerve adhesion and muscle atrophy, electrophysiological recording, behavioral testing and other technical means, and successfully confirmed its positive role in promoting the recovery of adhesion nerves, improving motor balance and increasing nerve conduction rate. These research results not only provide a solid scientific basis for benzenesulfonamide as a potential therapeutic drug, but also open up a new research direction for the treatment of peripheral nerve adhesion diseases.

Claims

1. Application of benzenesulfonamide in the preparation of drugs for treating peripheral nerve adhesion diseases.

2. The use of the benzenesulfonamide according to claim 1 in the preparation of a drug for treating peripheral nerve adhesion diseases, characterized in that: The peripheral nerve adhesion diseases include sciatic nerve adhesion.

3. The use of the benzenesulfonamide according to claim 2 in the preparation of a drug for treating peripheral nerve adhesion diseases, characterized in that: The medicine is in the form of injection or oral dosage form.

4. Use of the benzenesulfonamide according to claim 3 in the preparation of a drug for treating peripheral nerve adhesion diseases, characterized in that: The drug is used to improve peripheral nerve adhesion in the body and promote movement balance ability and nerve conduction rate, thereby promoting the recovery of adhered nerves.

5. A drug for treating peripheral nerve adhesion diseases, characterized in that: The drugs include benzenesulfonamide.

6. A drug for treating peripheral nerve adhesion diseases according to claim 5, characterized in that: The medicine also includes pharmaceutically acceptable excipients.

Images