Primer and method for rapidly detecting heterostipes griseofulva

Abstract

The invention relates to the field of biological detection, in particular to a primer for rapidly detecting heterostipes griseofulva, the sequence of an upstream primer of a specific primer pair is as shown in SEQ ID NO.13, and the sequence of a downstream primer of the specific primer pair is as shown in SEQ ID NO.14; based on the primer pair, the invention provides a method for detecting and quantifying the heterostipes griseofulva. The invention provides a primer and a method for rapidly detecting heterostipes griseofulva, aims at solving the problems that in the prior art, the detection efficiency of reticulostipe is low, and a sample cannot be rapidly screened, provides a primer with specificity, and establishes a method which is rapid, high in specificity and capable of quantitatively detecting the heterostipes griseofulva in the sample.

Description

Technical Field

[0001] The invention relates to the technical field of biological detection, and in particular to a primer and a method for rapidly detecting Heterostigmus grisea. Background Art

[0002] Dictyostelid, the full name of Dictyostelid cellular slimemolds, is a common protozoan in the soil and is closely related to bacteria. Most bacteria in the soil environment can be preyed on by Dictyostelium. Dictyostelium discoideum is currently the most widely used Dictyostelium, and its research areas include biomedicine, ecological environment, and cytogenetics. Heterostelium pallidum also belongs to the Dictyostelium class, but its morphological structure shows regular whorled branches, which is significantly different from Dictyostelium discoideum. Compared with Dictyostelium discoideum, from a research perspective, there are few studies and applications on Heterostelium pallidum, and there are deficiencies in technical exploration. Dictyostelium and pathogens have been proven to have a "symbiotic" relationship, escaping predation under selection pressure or surviving in the body of the preyed Dictyostelium. Dictyostelium has also been found and reported in urban domestic water, posing a potential threat to public health. Existing research results in the laboratory have shown that there are differences in prey species between Heterosceles and Dictyostelium, and that they have relationships with different bacteria. Therefore, there is great potential for studying Heterosceles.

[0003] The commonly used Dictyostelium detection technology is a conventional PCR amplification technology based on 18S rDNA. The relatively stable gene fragments in Dictyostelium are amplified and then sequenced to obtain the sequence results of the sample. In the early stage, the operation steps of sample separation, sample acquisition, sample purification, and DNA extraction are required. The DNA fragments amplified by this method are generally applicable within the Dictyostelium class, but if you want to obtain a certain type of Dictyostelium, you need to go through a lot of repetitive work, and you can't quickly screen samples, so the efficiency is low.

[0004] Real-time fluorescence quantitative PCR (Quantitative Real-time PCR) technology, referred to as qPCR technology, is a recognized rapid quantitative detection technology. There are currently two methods, namely DNA binding dye method and probe-based chemical method. In the dye method, SYBR Green I is a widely used fluorescent dye. It has high requirements for primer specificity. In the reaction system, SYBR fluorescent dye can specifically bind to the DNA double strand to produce a strong fluorescent signal, and almost no fluorescent signal is produced when it is not bound to the DNA double strand, thereby ensuring that the increase in fluorescent signal is completely synchronized with the increase in PCR products. The probe method is to add a pair of primers to the PCR system and add a specific probe at the same time. The probe is labeled with a fluorescent reporter group at the 5' end and a fluorescent quencher group at the 3' end. When the probe is complete, the fluorescent signal emitted by the reporter group is absorbed by the quencher group, and the fluorescent signal cannot be detected. When the probe binds to the complementary sequence of the target gene, it is cut by the Taq enzyme, the 5' end and the 3' end are dispersed, and the reporter group is no longer quenched. Compared with the probe method, the dye method has better versatility and low price. During the real-time fluorescence quantitative PCR process, the fluorescence signal increases with the accumulation of amplification products. The instrument receives and detects the fluorescence signal in real time to generate an amplification curve. The amplification results are sensitive and the results obtained are highly accurate. By analyzing the amplification curve, quantitative analysis of the template can be achieved. Summary of the invention

[0005] In order to overcome the shortcomings of the prior art, the present invention provides a primer and method for quickly detecting Dictyostelium, which is used to solve the problems in the prior art that the detection efficiency of Dictyostelium is low and samples cannot be quickly screened. A specific primer is provided to establish a quantitative detection method that is rapid, highly specific, and can simply detect the relative expression level of Dictyostelium in environmental samples.

[0006] The specific technical solutions are as follows:

[0007] The present application provides a primer for rapid detection of Heterostigmus griseus, comprising the following steps:

[0008] Step S1, preparing multiple groups of strain samples containing Heterosceles glaucoides;

[0009] Step S2, extracting genomic DNA of the strain to be tested;

[0010] Step S3, using Primer 6 software to design primers specific to the genome of Heterostigmus griseus;

[0011] Step S4: Using the genome of Heterostigmus griseus as a template, conventional PCR was used to perform gradient amplification to preliminarily screen for qualified primer pairs:

[0012] Step S5: according to the amplification results, the specific primer pairs obtained by conventional PCR and the multiple groups of strain genomes are used as templates for specific amplification of conventional PCR, and the specific amplification products of conventional PCR are taken for detection to obtain the optimal specific primer pairs;

[0013] The upstream primer sequence of the specific primer pair is shown in SEQ ID NO. 13: TGTTCTCATACGATTCAGTTC;

[0014] The downstream primer sequence of the specific primer pair is shown in SEQ ID NO. 14: AGATGGAGCAGAGATGATG.

[0015] Preferably, the strain samples include Heterostelium pallidum, Dictyostelium discoideum, Dictyostelium giganteum, Cavenderia aureostipes, and Polysphondylium violaceum.

[0016] As a further elaboration of the scheme, the present application also provides a method for detecting and quantifying Heterostigmus griseus, comprising the following steps:

[0017] Step 1, obtaining the target fragment: using the Heterostigma genome-specific primers SEQ ID NO.13-14 to perform PCR amplification on the Heterostigma genome to obtain the target fragment, and then cutting and recovering the fragment;

[0018] Step 2, target gene connected to plasmid vector: Use cloning kit to connect the target fragment to the plasmid vector;

[0019] Step 3, transforming and screening recombinants;

[0020] Step 4: Extract the plasmid using the kit:

[0021] Step 5: Prepare a standard curve;

[0022] Step 6. Sample preparation: Prepare liquid-suspended Heterosceles cells and use a hemocytometer to prepare 1×10 8 cells / mL of bacterial solution was used as the mother solution and diluted to 2×10 7 cells / mL,1×10 7 cells / mL,5×10 6 cells / mL,2×10 6 cells / mL,1×10 6cells / mL concentration of cell suspension, and then 200 μL was taken to extract genomic DNA;

[0023] Step 7, extracting the genomic DNA of the strain to be tested, and then preparing a real-time fluorescence quantitative PCR reaction system;

[0024] Step 8, Fluorescence quantitative PCR reaction: A two-step method is used to perform fluorescence quantitative PCR reaction, and the amplification results and melting curves of different concentrations are obtained;

[0025] Step 9: Use the copy number (copies / μL) = [(ng number × 10 -9 )×(6.02×10 23 )]÷(number of bases × 660) The CT value obtained can be calculated according to the standard curve formula, and the CT value can be corresponded to the copy concentration to achieve the quantification of the standard sample strain.

[0026] Technical effects and advantages of the present invention:

[0027] Using the dye method, a pair of specific primers for Heterosceles coryneformis was designed, and real-time fluorescence quantitative PCR technology was used to achieve relatively accurate and rapid detection effects, effectively shortening the repetitive steps of screening the target Dictyostelium, and to a certain extent, effectively quantifying Heterosceles coryneformis in the sample, so as to provide feasible technical methods in environmental sample analysis, public health threats, and interactions between Dictyostelium and bacteria. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is the result of the primer gradient amplification gel imaging in Example 1;

[0029] Figure 2 is a graph showing the results of primer-specific conventional PCR amplification in Example 1;

[0030] Figure 3 is a schematic diagram of the construction of the standard plasmid in Example 2;

[0031] Figure 4 is a plasmid standard amplification curve and a standard curve diagram of Heterostigmus griseus in Example 2;

[0032] Figure 5 : is the amplification curve and dissolution curve of different concentrations of Heterostigmus griseus samples in Example 2;

[0033] Figure 6 This is a graph showing the amplification results of random samples of Heterostigmus griseus provided in Example 3.

[0034] in, Figure 1 The legend AL is the gel imaging results of different primer sequences. Figure 1 A is SEQ ID NO. 1-2; Figure 1 B is: SEQ ID NO.3-4; Figure 1 C is: SEQ ID NO.5-6; Figure 1 D is: SEQ ID NO.7-8; Figure 1 E is: SEQ ID NO. 9-10; Figure 1 F is: SEQ ID NO.11-12; Figure 1 G is: SEQ ID NO. 13-14; Figure 1 H is: SEQ ID NO.15-16; Figure 1 I is: SEQ ID NO.17-18; Figure 1 J is: SEQ ID NO. 19-20; Figure 1 K is: SEQ ID NO. 21-22; Figure 1 L is: SEQ ID NO.23-24.

[0035] in, Figure 2 Figures AE show the conventional PCR amplification results of different primer sequences. Figure 2 A is: SEQ ID NO.13-14; Figure 2 B is: SEQ ID NO.15-16; Figure 2 C is: SEQ ID NO.3-4; Figure 2 D is: SEQ ID NO. 5-6; Figure 2 In E: 1-6: SEQ ID NO. 17-18, 7-12: SEQ ID NO. 1-2; 13-18: SEQ ID NO. 9-10; 19-24: SEQ ID NO. 11-12.

[0036] in, Figure 3 A is the target fragment of PCR amplification of the Heterostigmus griseus genome by specific primers SEQ ID NO.13-14; Figure 3 B is the target fragment amplified by PCR using universal detection primers of plasmid; Figure 3 C is the sequence alignment result.

[0037] in, Figure 4 A is the amplification curve of the plasmid standard of Heterostigmus griseus. Figure 4 B is its standard curve.

[0038] in, Figure 5 A is the amplification curve of samples of Heterostigmus griseus with different concentrations. Figure 5 B is its dissolution curve. DETAILED DESCRIPTION

[0039] The present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments. The embodiments of the present invention are provided for the purpose of illustration and description, and are not intended to be exhaustive or to limit the present invention to the disclosed forms. Many modifications and variations will be apparent to those of ordinary skill in the art. The embodiments are selected and described in order to better illustrate the principles and practical applications of the present invention, and to enable those of ordinary skill in the art to understand the present invention and thereby design various embodiments with various modifications suitable for specific uses.

[0040] Embodiment 1:

[0041] See also Figure 1 The present invention provides a specific primer pair for nucleic acid detection of Heterostigmus griseus, and retrieves and screens the specific primer pair using the Heterostigmus griseus genome as a target gene, wherein the specific amplification primers include an upstream primer and a downstream primer;

[0042] The following steps are involved:

[0043] Step S1, preparing multiple groups of strain samples containing Heterosceles glaucoides, as shown in Table 1;

[0044] All strains were from Dictyostelium cultured at the Engineering Research Center for Edible and Medicinal Fungi, Ministry of Education, Jilin Agricultural University.

[0045] Table 1 Test strains

[0046]

[0047] Step S2, extracting genomic DNA of the strain to be tested;

[0048] DNA extraction was performed using a column-based universal genomic DNA extraction kit, model TaKaRa MiniBESTBacteria Genomic DNA Extraction Kit, which specifically included the following steps:

[0049] S2.1: Take 5 mL of bacterial culture medium, centrifuge at 12000 rpm for 2 min, and discard the supernatant;

[0050] S2.2: Add 180 μL of Buffer GL, 20 μL of Proteinase K, and 10 μL of RNase A to the tube, mix well, and incubate in a 56 ℃ water bath for 10 min;

[0051] S2.3: Add 200 μL of Buffer GB and 200 μL of anhydrous ethanol, and mix thoroughly by pipetting;

[0052] S2.4: Transfer the above liquid to the adsorption column, centrifuge at 12000 rpm for 2 min, and then discard the filtrate;

[0053] S2.5: Add 500 μL of Buffer WA, centrifuge at 12,000 rpm for 1 min, and discard the filtrate;

[0054] S2.6: Add 700 μL of Buffer WB, centrifuge at 12,000 rpm for 1 min, and discard the filtrate;

[0055] S2.7: Centrifuge the empty adsorption column at 12,000 rpm for 2 min, then place it in a new 1.5 mL centrifuge tube and let it stand for 10 min. Add 30 μL of sterile water to the center of the adsorption column and let it stand at room temperature for 5 min.

[0056] S2.8: Centrifuge at 12000 rpm for 2 min to elute DNA;

[0057] S2.9: Use a spectrophotometer to measure the genomic DNA concentration and store it in a -40 ℃ refrigerator for later use.

[0058] Step S3, using Primer 6 software to design genome-specific primers for Heterosceles glaucus, a total of 12 pairs of primers were designed, as shown in Table 2;

[0059] Table 2 Primer sequence list

[0060]

[0061] like Figure 1 As shown, the preliminary screening results of gradient amplification by conventional PCR using primers designed based on the genome of Heterosceles coryneformis were obtained. A total of 8 primer pairs were qualified, namely A, B, C, E, F, G, H, and L.

[0062] A: SEQ ID NO.1-2; B: SEQ ID NO.3-4; C: SEQ ID NO.5-6; D: SEQ ID NO.7-8; E: SEQ ID NO.9-10; F: SEQ ID NO.11-12; G: SEQ ID NO.13-14; H: SEQ ID NO.15-16; I: SEQ ID NO.17-18; J: SEQ ID NO.19-20; K: SEQ ID NO.21-22; L: SEQ ID NO.23-24. M: DNA marker 2000bp, wherein the conventional PCR annealing temperatures of AK lanes 1-8 are 60°C, 59.7°C, 59.1°C, 58.1°C, 57°C, 56.2°C, 55.5°C, 55°C; the conventional PCR annealing temperatures of L lanes 1-6 are 60°C, 59°C, 58°C, 57°C, 56°C, 55°C.

[0063] Step S4: Using the genome of Heterostigmus griseus as a template, conventional PCR was used to perform gradient amplification to preliminarily screen for qualified primer pairs:

[0064] SEQ ID NO.1-2 ( Figure 1 A), SEQ ID NO.3-4 ( Figure 1 B), SEQ ID NO.5-6 ( Figure 1 C), SEQ ID NO.9-10 ( Figure 1 E), SEQ ID NO.11-12 ( Figure 1 F), SEQ ID NO.13-14 ( Figure 1 G), SEQ ID NO.15-16 ( Figure 1 H), SEQ ID NO.17-18 ( Figure 1 L). The conventional PCR reaction system is shown in Table 3.

[0065] Table 3 Conventional PCR reaction system

[0066]

[0067] The PCR reaction procedure is as follows:

[0068] Pre-denaturation: 95 ℃, 3 min; 35 cycles: denaturation: 95 ℃, 30 sec; annealing: 60~55 ℃, 30 sec; extension: 72 ℃, 1 min; final extension: 72 ℃, 5 min.

[0069] Step S5: Based on the amplified gel imaging results ( Figure 1), the specific primer pairs obtained by conventional PCR were used with water, D5, K3, G2-BB, AX2, and HA-1 as templates for specific amplification by conventional PCR ( Figure 2 ), and finally a better specific primer pair was obtained. The preferred primer sequence is SEQ ID NO.13-14 ( Figure 2 A).

[0070] like Figure 2 The figure shows the results of conventional PCR amplification of primer specificity for initial screening, and A is the preferred specific primer pair.

[0071] A: SEQ ID NO.13-14; B: SEQ ID NO.15-16; C: SEQ ID NO.3-4; D: SEQ ID NO.5-6; E: 1-6: SEQ ID NO.17-18, 7-12: SEQ ID NO.1-2; 13-18: SEQ ID NO.9-10; 19-24: SEQ ID NO.11-12.

[0072] AE: M: DNA marker 2000bp, AD lanes 1-6 are different templates: water, D5, K3, G2-BB, AX2, HA-1. E: Lanes 1, 7, 13, 19 are water templates, lanes 2, 8, 14, 20 are D5, lanes 3, 9, 15, 21 are K3, lanes 4, 10, 16, 22 are G2-BB, lanes 5, 11, 17, 23 are AX2, and lanes 6, 12, 18, 24 are HA-1.

[0073] The upstream primer sequence of the specific primer pair is shown in SEQ ID NO. 13: TGTTCTCATACGATTCAGTTC; the downstream primer sequence of the specific primer pair is shown in SEQ ID NO. 14: AGATGGAGCAGAGATGATG.

[0074] Embodiment 2:

[0075] This embodiment provides a method for rapid detection of Heterostigmus griseus, comprising the following steps:

[0076] Step 1, obtaining the target fragment: using the specific primers of the Heterostigma genome SEQ ID NO.13-14 to perform PCR amplification on the Heterostigma genome to obtain the target fragment ( Figure 3 A), rubber cutting and recycling;

[0077] Step 2, target gene connected to plasmid vector: Use pEASY-T&B Zero Cloning Kit universal gene cloning kit to connect the target fragment to the pEASY-T&B Zero Cloning Vector plasmid vector. The cloning reaction system is shown in Table 4;

[0078] Table 4 Cloning reaction system

[0079]

[0080] The connection ratio of pEASY-T&B Zero Cloning Vector to the target fragment was 1:7. After mixing, the mixture was placed in a PCR instrument at 25°C for 10 min. After completion, the centrifuge tube was placed on ice.

[0081] Step 3: transformation and screening of recombinants, including:

[0082] 3.1: Thaw the competent DH5α on ice;

[0083] 3.2: Add the ligation product, mix gently and place on ice for 30 min;

[0084] 3.3: Place the centrifuge tube in a 42°C water bath for 45 seconds, then quickly place on ice for 2 minutes;

[0085] 3.4: Add 700 μL of pure LB medium, mix gently, and incubate at 37 °C, 180 rpm for 1 h;

[0086] 3.5: Spread the transformed bacterial solution evenly on the LB plate containing antibiotics and culture it upside down at 37℃ overnight;

[0087] 3.6: Pick a single clone to expand the culture and perform preliminary verification by conventional PCR ( Figure 3 B) Conventional PCR was further performed using plasmid universal detection primers (forward primer: GTTGTAAAACGACGGCCAG; reverse primer: CAGGAAACAGCTATGAC) ( Figure 3 B) Preliminary verification, the results after testing showed that ( Figure 3 C), the full length of the sequence is 406 bp, and the standard plasmid was successfully constructed.

[0088] like Figure 3 As shown, the target fragment amplification results, standard plasmid construction and sequence comparison results are provided. The length of the target fragment and the plasmid standard is correct. The sequencing result is compared with the sequence. The length is correct and the plasmid is successfully constructed.

[0089] Among them, A: M: DNA marker 2000bp, lane 1 is the result of amplifying the genome of Heterosceles griseus with specific primers HA7R / F. B: M: DNA marker 2000bp, lane 5 is the verification result of the plasmid. C: standard plasmid sequence alignment result.

[0090] Step 4: Extract the plasmid using the kit:

[0091] The kit used to extract the plasmid was the BBI EZ-10 Spin Column Plasmid Mini-Preps Kit from Sangon Biotech Co., Ltd., which specifically includes:

[0092] 4.1: Take 5 mL of bacterial solution and add it to a centrifuge tube; centrifuge at 12000 rpm for 1 min to collect the bacteria. Discard the supernatant;

[0093] 4.2: Add 200 μL of buffer S1 (with RNase A added) to the bacterial pellet and shake thoroughly to mix;

[0094] 4.3: Add 200 μL of Buffer S2 to the centrifuge tube; gently invert the centrifuge tube upside down 10 times;

[0095] 4.4: Add the specified amount of neutralization buffer Buffer S3; gently turn the centrifuge tube upside down 10 times to mix thoroughly;

[0096] 4.5: Centrifuge at 12000 rpm for 10 min;

[0097] 4.6: Carefully transfer the supernatant to the adsorption column; add 500 μL of 75% ethanol to the adsorption column; centrifuge at 8000 rpm for 1 min, and then discard the filtrate; repeat the washing step once.

[0098] 4.7: Place the adsorption column in a new centrifuge tube and let it stand at room temperature for 10 minutes to completely evaporate the alcohol residue;

[0099] 4.8: Add ddH2O to the center of the adsorption film. 2 O; place at room temperature for 5 min, then centrifuge at an appropriate speed for 2 min to collect the plasmid solution into a centrifuge tube.

[0100] Step 5: Prepare a standard curve;

[0101] The high-concentration plasmid was extracted to a plasmid concentration of 1000 ng / μL, and this was used as the mother solution for 10-fold dilution to obtain 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, and 1 pg / μL concentrations as standard test samples. Fluorescence quantitative PCR reaction was performed to obtain a standard curve, and the amplification curve was "S" shaped ( Figure 4 A), repeated three times, the repeatability is good. According to the linear relationship between the logarithm of DNA amount (x) and the corresponding CT value (y), Y = -4.963x + 12.947, R 2 =0.993( Figure 4 B).

[0102] like Figure 4 As shown, a plasmid standard amplification curve and a standard curve of Heterostigmus griseus are provided, R 2 =0.993, the linear fit is good.

[0103] A: Amplification curve of standard sample, the concentrations of 1-6 are 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL; B: Standard curve of Heterostigmus glaucus.

[0104] Step 6: Preparation of samples to be tested:

[0105] Prepare a liquid suspension of Heterosceles cells and count 1 × 10 8 cells / mL of bacterial solution was used as the mother solution and diluted to 2×10 7 cells / mL,1×10 7 cells / mL,5×10 6 cells / mL,2×10 6 cells / mL,1×10 6 cells / mL concentration of cell suspension, and then 200 μL was taken to extract genomic DNA;

[0106] Step 7, extracting genomic DNA of the strain to be tested;

[0107] DNA extraction was performed using the TaKaRa MiniBEST Universal Genomic DNA Extraction Kit, which included:

[0108] 7.1: Take the bacterial culture medium, add 180 μL of Buffer GL, 20 μL of Proteinase K and 10 μL of RNaseA to the tube, mix well and incubate in a 56 ℃ water bath for 10 min;

[0109] 7.2: Add 200 μL of Buffer GB and 200 μL of anhydrous ethanol, and mix thoroughly by pipetting;

[0110] 7.3: Transfer the above liquid to the adsorption column, centrifuge at 12000 rpm for 2 min, and then discard the filtrate;

[0111] 7.4: Add 500 μL of Buffer WA, centrifuge at 12000 rpm for 1 min, and discard the filtrate;

[0112] 7.5: Add 700 μL of Buffer WB, centrifuge at 12000 rpm for 1 min, and discard the filtrate;

[0113] 7.6: Centrifuge the empty adsorption column at 12000 rpm for 2 min, then place it in a new 1.5 mL centrifuge tube and let it stand for 10 min. Add 30 μL of sterile water to the center of the adsorption column and let it stand at room temperature for 5 min.

[0114] 7.7: Centrifuge at 12000 rpm for 2 min to elute DNA; store the obtained genome in a -40 ℃ refrigerator for later use. Then prepare the real-time fluorescence quantitative PCR reaction system.

[0115] Step 8, Fluorescence quantitative PCR reaction:

[0116] The fluorescence quantitative PCR reaction was carried out in two steps, with 10 μM and 5 μM set as primer reaction concentration variables, and 60°C and 55°C set as cycle reaction annealing temperature variables. The final preferred fluorescence quantitative PCR reaction system primer concentration was 5 μM, and the cycle reaction annealing temperature was 55°C. The reaction system is shown in Table 5 below:

[0117] Table 5 Fluorescence quantitative PCR reaction system

[0118]

[0119] The reaction program is as follows: pre-deformation: 95 ℃, 30 sec; 40 cycles: 95 ℃, 10 sec, 55 ℃, 30 sec; enter the default program reaction. The amplification results and melting curves of different concentrations are shown in Figure 2. Figure 5 shown.

[0120] like Figure 5 , provides an amplification curve and dissolution curve of samples of different concentrations of Heterostigmus griseus. The amplification curve is "S" shaped and the dissolution curve has a strong single peak.

[0121] A: 1-5 concentration is 2×10 7 cells / mL,1×107 cells / mL,5×10 6 cells / mL,2×10 6 cells / mL,1×10 6 cells / mL. B: Dissolution curves of samples of Heterostigmus griseus at different concentrations.

[0122] Step 9: Use the copy number (copies / μL) = [(ng number × 10 -9 )×(6.02×10 23 )]÷(number of bases × 660) The CT value obtained can be calculated according to the standard curve formula, and the CT value can be corresponded to the copy concentration to achieve the quantification of the standard sample strain.

[0123] The bacterial concentration and copy concentration of the sample to be tested were converted, and the results are shown in Table 6 below.

[0124] Table 6 Bacterial concentration and copy concentration

[0125]

[0126] The corresponding relationship of the result is calculated and the average value is 1×10 6 The average copy concentration corresponding to the bacterial concentration of cells / mL is 4.3×10 5 copies / μL.

[0127] Embodiment 3:

[0128] A random sample test of Heterostigma grisea is provided:

[0129] By random sampling, genomic DNA was extracted from the samples according to Example 2, and then fluorescent quantitative PCR was performed ( Figure 6 ), according to the formula, copy concentration (copies / μL) / average copy concentration ≈ bacterial concentration (cells / mL), the obtained sample CT value results are used to calculate the copy concentration, and the bacterial concentration in the random sample is further obtained. The corresponding results are as follows:

[0130] Table 7 Bacterial concentration and copy concentration

[0131]

[0132] refer to Figure 6 The random sample amplification results of Heterostigmus griseus provided, the random sample can be amplified and the corresponding CT value can be obtained.

[0133] Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field and related fields without creative work should fall within the scope of protection of the present invention. The structures, devices and operating methods not specifically described and explained in the present invention are implemented according to the conventional means in the field unless otherwise specified and limited.

Claims

1. A primer for rapid detection of Heterostigmus glaucus, characterized in that: The following steps are involved: Step S1, preparing multiple groups of strain samples containing Heterosceles glaucoides; Step S2, extracting genomic DNA of the strain to be tested; Step S3, using Primer 6 software to design primers specific to the genome of Heterostigmus griseus; Step S4: Using the genome of Heterostigmus griseus as a template, conventional PCR was used to perform gradient amplification to preliminarily screen for qualified primer pairs: Step S5: according to the amplification results, the specific primer pairs obtained by conventional PCR and the multiple groups of strain genomes are used as templates for specific amplification of conventional PCR, and the specific amplification products of conventional PCR are taken for detection to obtain the optimal specific primer pairs; The upstream primer sequence of the specific primer pair is shown in SEQ ID NO.13: TGTTCTCATACGATTCAGTTC; The downstream primer sequence of the specific primer pair is shown in SEQ ID NO.14: AGATGGAGCAGAGATGATG.

2. A primer for rapid detection of Heterostigmus griseus according to claim 1, characterized in that: The strain samples include Heterostigmus griseus ( Heterostelium pallidum )、Dictyostelium discoideum( Dictyostelium discoideum )、Dictyostelium maxima( Dictyostelium giganteum )、Michipodiophora chrysanthemi( Cavenderia aureostipes )、Purple Trichoderma( Polysphondylium violaceum ).

3. A primer for rapid detection of Heterostigmus griseus according to claim 1, characterized in that: In S2, DNA is extracted using a column-based universal genomic DNA extraction kit, model TaKaRa MiniBEST BacteriaGenomic DNA Extraction Kit, which specifically includes the following steps: S2.1: Take 5 mL of bacterial culture solution, centrifuge at 12000 rpm for 2 min, and discard the supernatant; S2.2: Add 180 μL of Buffer GL, 20 μL of Proteinase K and 10 μL of RNase A to the tube, mix well and incubate in a 56°C water bath for 10 min; S2.3: Add 200 μL of Buffer GB and 200 μL of anhydrous ethanol, and mix thoroughly by pipetting; S2.4: Transfer the above liquid to the adsorption column, centrifuge at 12000 rpm for 2 min, and then discard the filtrate; S2.5: Add 500 μL of Buffer WA, centrifuge at 12000 rpm for 1 min, and discard the filtrate; S2.6: Add 700 μL of Buffer WB, centrifuge at 12,000 rpm for 1 min, and discard the filtrate; S2.7: Centrifuge the empty adsorption column at 12000 rpm for 2 min, then place it in a new 1.5 mL centrifuge tube and let it stand for 10 min. Add 30 μL of sterile water to the center of the adsorption column and let it stand at room temperature for 5 min. S2.8: Centrifuge at 12000 rpm for 2 min to elute DNA; S2.9: Use a spectrophotometer to detect the concentration of genomic DNA and store it in a -40℃ refrigerator for later use.

4. A primer for rapid detection of Heterostigmus griseus according to claim 1, characterized in that: The conventional PCR reaction system in step S4 comprises: Upstream primer 1 μL, Downstream primer 1 μL, DNA template 1 μL, 2×Magic Green Taq SuperMix 12.5μL, ddH2O 9.5μL; The PCR reaction procedure is as follows: Pre-denaturation: 95℃, 3min; 35 cycles: denaturation: 95℃, 30sec; annealing: 60~55℃, 30sec; extension: 72℃, 1min; final extension: 72℃, 5min.

5. A method for detecting and quantifying Heterostigmus griseus using the primers according to any one of claims 1 to 4, characterized in that: The following steps are involved: Step 1, obtaining the target fragment: using the Heterostigma genome-specific primers SEQ ID NO.13-14 to perform PCR amplification on the Heterostigma genome to obtain the target fragment, and then cutting and recovering the fragment; Step 2, target gene connected to plasmid vector: Use cloning kit to connect the target fragment to the plasmid vector; Step 3, transforming and screening recombinants; Step 4: Extract the plasmid using the kit: Step 5: Prepare a standard curve; Step 6. Sample preparation: Prepare liquid-suspended Heterosceles cells and use a hemocytometer to prepare 1×10 8 cells / mL of bacterial solution was used as the mother solution and diluted to 2×10 7 cells / mL,1×10 7 cells / mL,5×10 6 cells / mL,2×10 6 cells / mL,1×10 6 cells / mL concentration of cell suspension, and then 200 μL was taken to extract genomic DNA; Step 7, extracting the genomic DNA of the strain to be tested, and then preparing a real-time fluorescence quantitative PCR reaction system; Step 8, Fluorescence quantitative PCR reaction: A two-step method is used to perform fluorescence quantitative PCR reaction, and the amplification results and melting curves of different concentrations are obtained; Step 9: Use the copy number (copies / μL) = [(ng number × 10 -9 )×(6.02×10 23 )]÷(number of bases × 660) The CT value obtained can be calculated according to the standard curve formula, and the CT value can be corresponded to the copy concentration to achieve the quantification of the standard sample strain.

6. The method for detecting and quantifying Heterostigmus grisea according to claim 5, characterized in that: In step 2, the cloning kit is used pEASY -T&B Zero Cloning Kit universal gene cloning kit, the plasmid vector is pEASY -T&B Zero Cloning Vector plasmid vector, cloning reaction system is as follows: PCR target fragment 0.5 μL; pEASY -T&B Zero Cloning Vector 1μL; pEASY -The connection ratio of T&B Zero Cloning Vector to the target fragment is 1:7; after mixing, place in PCR instrument at 25℃ for 10 minutes; after completion, place the centrifuge tube on ice.

7. The method for detecting and quantifying Heterostigmus griseus according to claim 5, characterized in that: The step 3 specifically includes: 3.1: Thaw the competent DH5α on ice; 3.2: Add the ligation product, mix gently and place on ice for 30 minutes; 3.3: Place the centrifuge tube in a 42°C water bath for 45 seconds, then quickly place it on ice for 2 minutes; 3.4: Add 700 μL of pure LB medium, mix gently, and culture at 37°C and 180 rpm for 1 hour; 3.5: Spread the transformed bacterial solution evenly on the LB plate containing antibiotics and culture it upside down at 37℃ overnight; 3.6: Pick a single clone for expansion and further perform preliminary verification by conventional PCR using universal plasmid detection primers. The universal plasmid detection primers are: forward primer: GTTGTAAAACGACGGCCAG; reverse primer: CAGGAAACAGCTATGAC, with a total sequence length of 406 bp. The standard was successfully constructed.

8. The method for detecting and quantifying Heterostigma grisea according to claim 5, characterized in that: The kit in step 4 is a BBI EZ-10 Spin Column Plasmid Mini-Preps Kit, and extracting the plasmid specifically includes the following steps: 4.1: Take 5 mL of bacterial solution and add it to a centrifuge tube; centrifuge at 12000 rpm for 1 min, collect the bacteria and discard the supernatant; 4.2: Add 200 μL of buffer S1 to the bacterial pellet and shake thoroughly to mix; 4.3: Add 200 μL of Buffer S2 to the centrifuge tube; gently invert the centrifuge tube upside down 10 times; 4.4: Add the specified amount of neutralization buffer Buffer S3; gently turn the centrifuge tube upside down 10 times to mix thoroughly; 4.5: Centrifuge at 12000 rpm for 10 min; 4.6: Carefully transfer the supernatant to the adsorption column; add 500 μL of 75% ethanol to the adsorption column; centrifuge at 8000 rpm for 1 min, and then discard the filtrate; repeat the washing step once; 4.7: Place the adsorption column in a new centrifuge tube and let it stand at room temperature for 10 minutes to completely evaporate the alcohol residue; 4.8: Add ddH2O to the center of the adsorption film; leave it at room temperature for 5 minutes, then centrifuge it at an appropriate speed for 2 minutes and collect the plasmid solution into a centrifuge tube.

9. The method for detecting and quantifying Heterostigma grisea according to claim 5, characterized in that: In step 7, DNA extraction is performed using TaKaRa MiniBEST Universal Genomic DNA Extraction Kit, which specifically includes: 7.1: Take the bacterial culture medium, add 180μL of Buffer GL, 20μL of Proteinase K and 10μL of RNase A to the tube, mix well and incubate in a 56℃ water bath for 10min; 7.2: Add 200 μL of Buffer GB and 200 μL of anhydrous ethanol, and mix thoroughly by pipetting; 7.3: Transfer the above liquid to the adsorption column, centrifuge at 12000rpm for 2min, and then discard the filtrate; 7.4: Add 500 μL of Buffer WA, centrifuge at 12000 rpm for 1 min, and then discard the filtrate; 7.5: Add 700 μL of Buffer WB, centrifuge at 12000 rpm for 1 min, and then discard the filtrate; 7.6: Centrifuge the empty adsorption column at 12000rpm for 2min, then place it in a new 1.5mL centrifuge tube and let it stand for 10min. Add 30μL of sterile water to the center of the adsorption column and let it stand at room temperature for 5min. 7.7: Centrifuge at 12000rpm for 2min to elute the DNA; store the obtained genome in a -40℃ refrigerator for later use.

10. The method for detecting and quantifying Heterostigma grisea according to claim 5, characterized in that: In step S8, the primer concentration of the fluorescence quantitative PCR reaction system is 5 μM, and the annealing temperature of the cycle reaction is 55° C. The reaction system includes: 10 μM upstream primer 0.2 μL; 10 μM downstream primer 0.2 μL; DNA template 1 μL; 2×Q5 SYBR qPCR Master Mix 10μL; ddH2O 8.6μL; The reaction program includes: pre-deformation: 95°C, 30sec; 40 cycles: 95°C, 10sec, 55°C, 30sec; enter the default program reaction.

Images