Reagent for detecting African swine fever virus gene type II and application thereof

Abstract

The invention discloses a reagent for detecting African swine fever virus gene type II and application of the reagent. The reagent comprises a primer group, the primer group comprises a forward primer with a sequence as shown in SEQ ID NO: 2 and a reverse primer with a sequence as shown in SEQ ID NO: 3. Compared with other similar kits, the kit for detecting the African swine fever gene type II, provided by the invention, has the advantages that the sensitivity can be remarkably improved through the design of the primers, the specificity is high, the sensitivity is high, the amplification efficiency is high, the detection time is short and the like; according to the kit provided by the invention, a user does not need to carry out reagent split charging, the extracted sample nucleic acid is directly added into the pre-split freeze-dried reagent to be detected in a fluorescent PCR instrument, and the operation is simple and rapid.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a reagent for detecting African swine fever virus gene type II and an application thereof. Background Art

[0002] African swine fever (ASF) is a highly contagious, extensive hemorrhagic disease of pigs caused by infection with African swine fever virus (ASFV), with a mortality rate of up to 100%. It first broke out in Kenya, Africa in the 1820s, and spread from Africa to Asia via Europe over nearly 100 years, causing unpredictable economic losses to pig farming and related industries. Due to the lack of safe and effective vaccines, as well as frequent trade and personnel flows around the world, the prevention, control and eradication of ASF are extremely difficult. Therefore, it is urgent to develop a vaccine with good protection and safety to prevent the disease. Fluorescence quantitative PCR detection method plays a very important role in the early diagnosis of ASF in the laboratory.

[0003] ASF is a serious threat to the pig farming industry, and there are no safe and effective vaccines and therapeutic drugs available. Therefore, it is urgent to develop comprehensive prevention and control technologies and vaccine research and development. At this stage, the prevention and control of ASF can only rely on strengthening biosafety measures, early detection and strict culling. Since the clinical symptoms of ASF are very similar to those of various viral and bacterial diseases. Therefore, its diagnosis must be confirmed with the help of laboratory tests. The detection technologies for ASF mainly include indirect immunofluorescence test, red blood cell adsorption test, virus isolation, polymerase chain reaction (PCR), real-time fluorescence quantitative PCR, etc. Real-time fluorescence quantitative PCR has extremely high sensitivity and specificity, and is widely used in the detection of various pathogens including ASFV. At present, the PCR and fluorescence quantitative PCR detection of ASF are mainly aimed at the ASFVB646L (p72) gene, and the diagnostic target is relatively single. Summary of the invention

[0004] The present invention aims to solve at least one of the technical problems existing in the prior art. To this end, the present invention provides a reagent for detecting African swine fever virus genotype II, which can accurately identify African swine fever virus genotype II with good sensitivity and specificity.

[0005] The present invention also provides a kit containing the above reagent.

[0006] The present invention also provides the application of the above reagent or kit.

[0007] The present invention also provides a method for detecting African swine fever virus gene type II.

[0008] According to a first aspect of the present invention, a reagent for detecting African swine fever virus genotype II is proposed, the reagent comprising a primer set; the primer set comprises a forward primer whose sequence is shown in SEQ ID NO:2 and a reverse primer whose sequence is shown in SEQ ID NO:3.

[0009] In some embodiments of the present invention, the reagent further comprises a probe having a sequence as shown in SEQ ID NO:4.

[0010] In some embodiments of the present invention, the 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a fluorescent quenching group.

[0011] In some embodiments of the present invention, the fluorescent group includes any one of FAM, HEX, ROX, Cy3 and Cy5.

[0012] In some embodiments of the present invention, the fluorescence quenching group includes any one of BHQ1, BHQ2 and TAMRA.

[0013] According to a second aspect of the present invention, a kit is provided, wherein the kit contains the reagent as described in the first aspect of the present invention.

[0014] In some embodiments of the present invention, the kit further comprises a fluorescent PCR reaction solution.

[0015] In some embodiments of the present invention, the kit further comprises a positive control and a negative control.

[0016] In some embodiments of the present invention, the positive control comprises pUC57-EP402R plasmid.

[0017] In some embodiments of the present invention, the negative control comprises DEPC water.

[0018] In some embodiments of the present invention, the primer set, probe and fluorescent PCR reaction liquid in the kit are mixed in proportion to prepare a freeze-dried powder product, which can be directly added to the sample solution to be tested and dissolved before testing.

[0019] According to the third aspect of the present invention, the use of the reagent described in the first aspect of the present invention or the kit described in the second aspect of the present invention in detecting African swine fever virus type II is proposed.

[0020] According to a fourth aspect of the present invention, a method for detecting African swine fever virus genotype II is proposed, wherein the reagent described in the first aspect of the present invention or the kit described in the second aspect of the present invention is used to detect the sample to be tested.

[0021] In some embodiments of the present invention, the detection is performed using fluorescent quantitative PCR.

[0022] In some embodiments of the present invention, the amplification reaction system of the fluorescent quantitative PCR is:

[0023]

[0024] In some embodiments of the present invention, the amplification procedure of the fluorescent quantitative PCR is:

[0025] Treat at 35-39°C for 1-3 min; denature at 94-96°C for 1-3 min; denature at 94-96°C for 3-7 s, anneal and extend at 54-58°C for 28-32 s, for 38-45 cycles, and collect fluorescence data.

[0026] The present invention has at least the following beneficial effects:

[0027] 1) Compared with other similar kits, the kit for detecting African swine fever genotype II provided by the present invention can significantly improve the sensitivity through the design of primers, and has the advantages of strong specificity, high sensitivity, high amplification efficiency, short detection time, etc.;

[0028] 2) The kit provided by the present invention does not require the user to perform reagent aliquoting. The extracted sample nucleic acid is directly added to the pre-packaged freeze-dried reagent and tested on a fluorescent PCR instrument, which is simple and quick to operate;

[0029] 3) The detection method provided by the present invention is a closed tube reaction during the detection process, and the addition of UNG enzyme treatment reduces the possibility of contamination, and the operation is simple and fast;

[0030] 4) The kit and the corresponding detection method provided by the present invention are highly safe, the entire system does not contain toxic or hazardous substances, does not require the opening of the tube of the PCR product, and is harmless to the test personnel and the environment.

[0031] Additional aspects and advantages of the present invention will be set forth in part in, and in part will be apparent from, the description which follows. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0033] Figure 1 is an amplification curve diagram of specific detection in the test example of the present invention;

[0034] Figure 2 The standard curve diagram is obtained by measuring the reaction system of 100 nM upstream and downstream primers and 50 nM probe in the test example of the present invention;

[0035] Figure 3The standard curve diagram is obtained by using a reaction system of 150 nM upstream and downstream primers and 75 nM probe in the test example of the present invention;

[0036] Figure 4 The standard curve diagram is obtained by measuring the reaction system of 200 nM of upstream and downstream primers and 100 nM of probe in the test example of the present invention;

[0037] Figure 5 This is a standard curve diagram measured by the reaction system of 300 nM upstream and downstream primers and 150 nM probe in the test example of the present invention. DETAILED DESCRIPTION

[0038] Embodiments of the present invention are described in detail below, examples of which are shown in the accompanying drawings, wherein the same or similar reference numerals throughout represent the same or similar elements or elements having the same or similar functions. The embodiments described below with reference to the accompanying drawings are exemplary and are only used to explain the present invention, and cannot be understood as limiting the present invention.

[0039] In the description of the present invention, the description with reference to the terms "one embodiment", "some embodiments", "illustrative embodiments", "examples", "specific examples", or "some examples" means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner.

[0040] Example 1 Design of primer probes for detecting African swine fever virus genotype II

[0041] According to the relevant published literature, EP402R was selected as the target gene to design the corresponding primer set and probe; the target gene fragment of EP402R was a typing-specific gene fragment obtained by genome alignment, and the sequence of the target gene fragment of EP402R was: TACATGCGTCCCTCAACACAACCACTCAACCCATTTCCCTTACCTAAACCGTGTCCTCCACCCAAACCATGTCCGCCACCCAAACCATGTCCTCCACCTAAACCATGTCCTTCAGCTGAATCCTATTCTCCACCCAAACCACTACCTAGTATCCCGCTACTACCCAATATCCCGCCATTATCTACCCAAAATATTTCGCTTATTCACGTAGATAGAATTATTTAA (SEQ ID NO: 1);

[0042] Primer design software was used to design and screen the primer probe set with the best performance such as amplification efficiency. The specific sequence is as follows:

[0043] EP402R-F: 5'-CCACCCAAACCACTACCTA-3' (SEQ ID NO: 2);

[0044] EP402R-R: 5'-ACGTGAATAAGCGAAATATTTTGG-3' (SEQ ID NO: 3);

[0045] EP402R-P: 5'-ROX-CCGCTACTACCCAATATCCCGCC-BHQ2-3' (SEQ ID NO: 4).

[0046] Example 2 A kit for detecting African swine fever virus genotype II

[0047] In this example, a kit for detecting African swine fever virus genotype II was prepared, and the kit included the following components: the primer probe set prepared in Example 1 (the primer probe sets whose sequences are shown in SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, respectively), fluorescent PCR reaction solution 2×FastAmpli Premix-UNG IV (purchased from Zhuhai Baorui Biotechnology Co., Ltd., product number FM2181-4), DEPC water (which can be used as a negative standard) and a positive control.

[0048] The positive standard is pUC57-EP402R plasmid. The EP402R target gene fragment is shown in SEQ ID NO: 1. After the target gene fragment is connected to the pUC57 vector, the recombinant plasmid standard pUC57-EP402R is obtained by sequencing verification.

[0049] The PCR reaction solution (5 μL) system is as follows:

[0050] 2×FastAmpli Premix-UNG IV 2.5μL;

[0051] EP402R-F (final concentration 100 nM) 0.125 μL;

[0052] EP402R-R (final concentration 100 nM) 0.125 μL;

[0053] EP402R-P (final concentration 50 nM) 0.125 μL;

[0054] 2.125 μL of DEPC water.

[0055] The method of using the kit is as follows:

[0056] The above PCR reaction system (5 μL) was prepared, added to a MEMS chip (purchased from Huachuang Core Technology (Shenzhen) Co., Ltd.), and lyophilized. The nucleic acid sample of the sample to be tested was extracted, and 4 μL of the nucleic acid sample was added to the well of the MEMS chip with lyophilized powder. The MEMS chip was placed in a fluorescent quantitative PCR instrument (purchased from Huachuang Core Technology (Shenzhen) Co., Ltd., model Q3 Plus V2) for amplification, and the corresponding Ct value was read by the software provided by the fluorescent quantitative PCR instrument.

[0057] Example 3 A method for detecting African swine fever virus genotype II

[0058] This embodiment provides a method for detecting African swine fever virus genotype II, which is based on the kit provided in Example 2 and comprises the following steps:

[0059] The sample to be tested was resuspended in DEPC water to 4 μL and added into the sample chamber of the MEMS chip and mixed thoroughly to obtain an amplification reaction system;

[0060] The amplification procedure of fluorescent PCR is as follows:

[0061] Treatment at 37°C for 2 min, 1 cycle; pre-denaturation at 95°C for 2 min, 1 cycle; denaturation at 95°C for 5 s, annealing and extension at 56°C for 30 s, 45 amplification cycles.

[0062] Judging criteria:

[0063] If the positive control Ct value is ≤35, and the negative control and blank control Ct values ​​are >35, the experiment is valid;

[0064] The Ct value of the test sample was <38, which was judged as positive;

[0065] No typical “S” type amplification or Ct value >40, judged as negative;

[0066] 38≤Ct value≤40, it is judged as a suspicious result and needs to be retested.

[0067] Test example

[0068] This test example evaluates the detection performance of the detection method provided in Example 3 for African swine fever virus genotype II. The specific test method and results are as follows:

[0069] 1. Sensitivity:

[0070] The sensitivity of the primer probe of African swine fever virus gene type II of Chinese patent CN113122655A was compared using the detection reaction system provided in Example 2 and the detection method provided in Example 3. The results are shown in Table 1; the plasmid concentration shown in the table was determined by Qubit and then diluted with TE buffer).

[0071] Table 1 Sensitivity

[0072]

[0073] As can be seen from Table 1, the detection method provided by the present invention has a high detection rate and good sensitivity, and performs well in detection of templates with lower concentrations; stable detection can be achieved at 30 cp / μL, and the minimum detection limit is 1 cp / μL.

[0074] 2. Specificity:

[0075] The kit prepared in Example 2 and the detection method provided in Example 3 were used for specific detection.

[0076] DNA detection template: nucleic acid extracted from type II African swine fever virus samples, porcine reproductive and respiratory syndrome virus samples, porcine pseudorabies virus samples, porcine circovirus samples, porcine parvovirus, porcine rotavirus and other viruses (RNA needs to be reverse transcribed into cDNA and stored for later use);

[0077] The above samples come from the China Animal Disease Prevention and Control Center.

[0078] The above DNA template was used to perform specific detection using the kit prepared in Example 2 and the detection method provided in Example 3. The results were as follows: Figure 1 shown.

[0079] Depend on Figure 1 It can be seen that the detection method provided by the present invention can specifically amplify type II African swine fever virus samples and accurately detect type II African swine fever virus from a variety of pathogen samples.

[0080] 3. Stability:

[0081] The detection stability was tested by an accelerated test using the detection method provided in Example 3; the accelerated test was performed under conditions of 37°C ± 2°C and 60% ± 5% relative humidity for 15 and 30 days, and then the positive standard pUC57-EP402R plasmid was tested using the detection kit that had been placed for 15 and 30 days, respectively, and the results are shown in Table 2. As can be seen from Table 2, the detection method provided by the present invention has good stability.

[0082] Table 2 Detection after acceleration

[0083]

[0084] 4. Optimization of amplification system and amplification conditions:

[0085] 1) Optimization of primer and probe dosage

[0086] This test example sets different concentration ratios of primers and probes. Based on the detection method provided in Example 3, the gradient dilution (1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 The positive standard pUC57-EP402R plasmid was tested with 1000 copies / μL and 1000 copies / μL. The results are shown in Table 3 and Figures 2 to 5 shown.

[0087] Table 3 Optimization of primer and probe dosage

[0088] Primer probe dosage E (amplification efficiency) <![CDATA[R 2 (Correlation coefficient)]]> 100nM each of upstream and downstream primers + 50nM of probe 120.5 0.999 150nM each of upstream and downstream primers + 75nM of probe 114.8 0.995 200nM each of upstream and downstream primers + 100nM of probe 110.9 0.998 300nM each of upstream and downstream primers + 150nM of probe 110.8 0.997

[0089] From Table 3 and Figures 2 to 5 The results show that the amplification efficiency is highest and the repeatability is good when the final concentration of the upstream primer is 100 nM, the final concentration of the downstream primer is 100 nM and the final concentration of the probe is 50 nM.

[0090] 2) Optimization of annealing temperature

[0091] In this test example, different annealing temperatures were set. Based on the detection method provided in Example 3, the gradient dilution (1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 The positive standard pUC57-EP402R plasmid with 100 copies / μL and 100 copies / μL was tested, and the results are shown in Table 4.

[0092] Table 4 Optimization of annealing temperature

[0093] Annealing temperature E (amplification efficiency) <![CDATA[R 2 (Correlation coefficient)]]> 56℃ 116.5 0.997 58℃ 109.9 1 60℃ 111.9 1

[0094] As shown in Table 4, the best annealing temperature is 56°C, at which time the amplification efficiency is the highest.

[0095] The above is a detailed description of the embodiments of the present invention in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A reagent for detecting African swine fever virus genotype II, characterized in that: The reagents include a primer set; the primer set includes a forward primer whose sequence is shown in SEQ ID NO:2 and a reverse primer whose sequence is shown in SEQ ID NO:

3.

2. The reagent according to claim 1, characterized in that The reagents also include a probe whose sequence is shown in SEQ ID NO:

4.

3. The reagent according to claim 2, characterized in that The 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a fluorescent quenching group; Preferably, the fluorescent group includes any one of FAM, HEX, ROX, Cy3 and Cy5; Preferably, the fluorescence quenching group includes any one of BHQ1, BHQ2 and TAMRA.

4. A kit, characterized in that: The kit contains the reagent according to any one of claims 1 to 3.

5. The kit according to claim 4, characterized in that The kit also includes a fluorescent PCR reaction solution; Preferably, the kit further comprises a positive control and a negative control.

6. Use of the reagent according to any one of claims 1 to 3 or the kit according to any one of claims 4 to 5 in detecting African swine fever virus genotype II.

7. A method for detecting African swine fever virus genotype II, characterized in that: The detection method comprises the following steps: using the reagent described in any one of claims 1 to 3 or the kit described in any one of claims 4 to 5 to detect the sample to be detected.

8. The detection method according to claim 7, characterized in that: The detection is performed using fluorescent quantitative PCR.

9. The detection method according to claim 8, characterized in that: The amplification reaction system of the fluorescent quantitative PCR is: Add DEPC water to make up to 5 μL.

10. The detection method according to claim 8, characterized in that: The amplification procedure of the fluorescent quantitative PCR is: Treat at 35-39°C for 1-3 min; denature at 94-96°C for 1-3 min; denature at 94-96°C for 3-7 s, anneal and extend at 54-58°C for 28-32 s, perform 43-47 cycles, and collect fluorescence data.

Images