Multiplex fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) method for detecting three pigeon diarrhea viruses

Abstract

The invention aims to provide a multiple fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) method for detecting three pigeon diarrhea viruses, namely a fluorescent quantitative RT-PCR detection method capable of simultaneously detecting a pigeon Newcastle disease virus, a pigeon rotavirus and a pigeon adenovirus in one reaction so as to realize safe, specific, sensitive, rapid and convenient detection on pigeon diarrhea virus diseases. Through screening of the primer pair and the probe group, three common pigeon diarrhea diseases, namely the pigeon Newcastle disease virus, the pigeon rotavirus and the pigeon adenovirus, can be safely, specifically, quickly, sensitively, simply and quickly detected with high flux, so that the defects of the existing traditional detection technology are overcome.

Description

Technical Field

[0001] The invention belongs to the technical field of gene detection of pathogenic microorganisms, and specifically relates to a multiplex fluorescent RT-PCR method for detecting three pigeon diarrhea viruses. Background Art

[0002] At present, pigeon farming has become the fourth largest poultry industry after chickens, ducks and geese. Pigeon diarrhea is an important disease affecting my country's pigeon farming industry. This type of disease can cause clinical symptoms such as growth and development stagnation, body system decline, gradual weight loss, and even cause a considerable number of deaths, affecting the economic benefits of the pigeon farming industry. Clinically, pigeons with the disease show depression, loss of appetite, yellow, green, gray-green loose stools or dark brown coal tar-like loose stools, etc.

[0003] Pigeon diarrhea virus disease is relatively complicated in the pigeon breeding process, and there are many types of diseases. Among them, the main ones that cause more serious diseases and higher incidence rates are pigeon Newcastle disease, pigeon rotavirus disease and pigeon adenovirus disease. These three diseases are important viral infectious diseases that affect the development of my country's pigeon breeding industry, and their occurrence often brings huge economic losses to the pigeon breeding industry.

[0004] Newcastle disease in pigeons, commonly known as pigeon plague, is an acute, highly contagious disease caused by pigeon paramyxovirus type I. It is characterized by gastrointestinal symptoms such as enteritis and severe diarrhea, and neurological symptoms such as head twisting, neck twisting, and paralysis. It occurs throughout the year and is most serious in winter. Pigeons of different ages and breeds are susceptible, and the incidence and mortality rates of young pigeons are higher than those of adult pigeons, causing serious economic losses to the pigeon industry.

[0005] Pigeon rotavirus disease is a viral diarrheal infectious disease caused by pigeon rotavirus, with symptoms such as vomiting, diarrhea, dehydration, etc. It mainly occurs in autumn, winter and early spring, especially under stress factors such as cold and humidity, or when it is co-infected with other pathogens, it causes a high mortality rate in pigeons, affecting the healthy development of the pigeon industry.

[0006] Pigeon adenovirus disease is an infectious disease of the pigeon digestive system caused by pigeon adenovirus infection. The disease is susceptible to infection all year round, but is most common in spring and summer, with the main epidemic season from February to July each year. Pigeon adenovirus is divided into two types: pigeon adenovirus A and pigeon adenovirus B. Pigeon adenovirus A mainly infects pigeons aged 3 to 5 months, and clinically, pigeons can show symptoms of vomiting, acute watery diarrhea and weight loss. Pigeon adenovirus B mainly affects young pigeons under 1 year old, while some have no obvious symptoms, occasionally accompanied by vomiting and yellow watery feces. Some infected pigeons will die quickly in a short period of time.

[0007] Newcastle disease virus, rotavirus and adenovirus are the most common viruses that cause diarrhea in pigeons. They can spread widely in pigeons and cause serious economic losses to the pigeon industry. However, the high similarity of these three pathogens in clinical practice makes it difficult to make differential diagnosis based solely on clinical and pathological examinations. Therefore, it is of great significance to establish a method that can quickly and accurately identify multiple diarrhea-causing viruses in pigeons. Summary of the invention

[0008] The purpose of the present invention is to provide a multiplex fluorescent RT-PCR method for detecting three pigeon diarrhea viruses, that is, a fluorescent quantitative RT-PCR detection method that can simultaneously detect pigeon Newcastle disease virus, pigeon rotavirus, and pigeon adenovirus in one reaction, so as to achieve safe, specific, sensitive, rapid and convenient detection of pigeon diarrhea virus diseases.

[0009] The present invention first provides a multiplex fluorescent RT-PCR primer pair and probe group for simultaneously detecting pigeon Newcastle disease virus, pigeon rotavirus, and pigeon adenovirus, which are respectively a primer pair NDV forward, NDV reverse and a probe NDV probe for identifying pigeon Newcastle disease virus, a primer pair RVA forward, RVA reverse and a probe RVA probe for identifying pigeon rotavirus, and a primer pair PiADV forward, PiADV reverse and a probe PiADVprobe for identifying pigeon adenovirus. The sequences of the primer pair and the probe are as follows:

[0010] 1) Pigeon Newcastle disease virus detection forward primer NDV forward:

[0011] 5′-CARACMGGGGTCAATCATAGT-3′(SEQ ID NO:4)

[0012] Pigeon Newcastle disease virus detection reverse primer NDV reverse:

[0013] 5′-GCAACCCCAAGAGCYACA-3′(SEQ ID NO:5)

[0014] Pigeon Newcastle disease virus detection probe NDV probe:

[0015] 5′-ATRAAGCGYTTYTGCCTCCTTCYTCC-3′(SEQ ID NO:6)

[0016] 2) Pigeon rotavirus detection forward primer RVA forward:

[0017] 5′-GACCAGTRTTTCCAGCWGGTATG-3′(SEQ ID NO:7)

[0018] Pigeon rotavirus detection reverse primer RVA reverse:

[0019] 5′-TCTTGCRTGGGTAGCGCAGAT-3′(SEQ ID NO:8)

[0020] Pigeon rotavirus detection probe RVA probe:

[0021] 5′-TTYACAGCAGCATCCATTCGGAGCAT-3′(SEQ ID NO:9)

[0022] 3) Pigeon adenovirus detection forward primer PIADV forward:

[0023] 5′-ACCGAATACGTCTGGAAR-3′(SEQ ID NO:10)

[0024] Pigeon adenovirus detection reverse primer PIADV reverse:

[0025] 5′-CKGCGWAAGGTTGTTGATC-3′(SEQ ID NO:11)

[0026] Pigeon adenovirus detection probe PIADV probe:

[0027] 5'-CAGAAYTACGGAGCCACMATCGATTG-3' (SEQ ID NO: 12).

[0028] Among them, the 5′ end of the pigeon Newcastle disease virus detection probe NDV probe is labeled with carboxyfluorescein FAM, and the 3′ end is labeled with the quenching group BHQ1;

[0029] The pigeon rotavirus detection probe RVA probe was labeled with carboxyfluorescein CY5 at the 5′ end and the quencher group BHQ2 at the 3′ end;

[0030] The PIADV probe for pigeon adenovirus detection was labeled with carboxyfluorescein ROX at the 5′ end and the quencher group BHQ2 at the 3′ end.

[0031] In another aspect, the present invention provides a triple fluorescence RT-PCR detection method for detecting pigeon Newcastle disease virus, pigeon rotavirus, and pigeon adenovirus in clinical samples, comprising the following steps:

[0032] (1) Preparation of fluorescent quantitative RT-PCR reaction system

[0033] The reaction solution in each tube was 20 μL, containing 2XOne Step RT-qPCR BufferⅡ(probe) 10 μL, 5U / μL ProTaq HSDNA polymerase 0.4 μL, Evo M-MLV RTase Enzyme Mix 0.4 μL, 10 pmol / μL NDVforward 0.6 μL, NDV reverse 0.6 μL and NDV probe 0.4 μL, 10 pmol / μL RVA forward 0.5 μL, RVA reverse 0.5 μL and RVA probe 0.5 μL, 10 pmol / μL PIADV forward 0.4 μL, PIADVreverse 0.4 μL and PIADV probe 0.3 μL, 10 pmol / μL, RNaseFree dH2O 2 μL, and 3 μL of sample RNA template to be detected;

[0034] (2) Fluorescence quantitative RT-PCR reaction system amplification

[0035] Set the detection reaction conditions as follows: first stage, 42℃ / 5min; second stage, 95℃ / 30s; third stage, 95℃ / 5s, 59℃ / 35s to collect fluorescence, 40 cycles. Save the file and run;

[0036] (3) Result determination

[0037] Result analysis condition setting: Read the test results. The threshold setting principle is that the threshold line just exceeds the highest point of the normal negative control amplification curve. Different instruments can adjust the position of the threshold line, and then read the test results;

[0038] Quality control standards: The negative control has no Ct value and no amplification curve; the Ct value of the positive control should be ≤36, and a specific amplification curve should appear; if the negative control and positive conditions do not meet the above conditions, the experiment is considered invalid;

[0039] The results are described and judged as follows: the probes of pigeon Newcastle disease virus, pigeon rotavirus and pigeon adenovirus are marked with FAM fluorescence, CY5 fluorescence and ROX fluorescence, respectively; if there is no Ct value and no fluorescence amplification curve, the sample is judged to be negative for all three viruses; if one of the fluorescence amplification curves appears and the Ct value is ≤36, the virus corresponding to the fluorescence is judged to be positive, and the other two viruses are negative; if multiple fluorescence amplification curves appear and the Ct values ​​are all ≤36, the viruses corresponding to these fluorescences are judged to be positive, and the remaining viruses are negative.

[0040] The present invention provides a triple fluorescence RT-PCR detection method for rapid detection of pigeon Newcastle disease virus, pigeon rotavirus and pigeon adenovirus based on molecular biology, so as to realize safe, specific, rapid, sensitive, simple and high-throughput rapid detection of three common pigeon diarrhea diseases, namely pigeon Newcastle disease virus, pigeon rotavirus and pigeon adenovirus, thereby making up for the shortcomings of existing traditional detection technology. In addition, this method is very suitable for high-throughput detection, can detect a large number of samples at the same time and quickly determine the results, and uses TaqMan fluorescent probes to avoid the pollution and low specificity caused by the traditional SYBR Green staining method. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 This is the standard curve of triple fluorescence quantitative RT-PCR of pigeon Newcastle disease virus, pigeon rotavirus and pigeon adenovirus;

[0042] Figure 2 This is a graph showing the specific results of triple fluorescence quantitative RT-PCR of pigeon Newcastle disease virus, pigeon rotavirus and pigeon adenovirus;

[0043] Figure 3 This is the sensitivity result diagram of triple fluorescence quantitative RT-PCR of pigeon Newcastle disease virus;

[0044] Figure 4 This is the sensitivity result diagram of triple fluorescence quantitative RT-PCR of pigeon rotavirus;

[0045] Figure 5 This is the sensitivity result of triple fluorescence quantitative RT-PCR of pigeon adenovirus, where 1-9: template concentration is 10 7 -10 0 Amplification curve of copies / μL; N: negative control. DETAILED DESCRIPTION

[0046] The present invention is described in detail below in conjunction with specific embodiments. Based on the following description and these embodiments, those skilled in the art can determine the essential features of the present invention, and can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention to make it suitable for various uses and conditions.

[0047] The present invention is a triple fluorescence RT-PCR reaction of pigeon Newcastle disease virus, pigeon rotavirus and pigeon adenovirus. These three viruses can all cause diarrheal diseases in pigeons, but due to the continuous evolution of viruses, each virus has multiple genotypes. Therefore, when performing molecular biological detection, a conservative region with good specificity and small differences between virus genotypes should be selected as a template for designing detection primers and probes, so that non-specific reactions between viruses can be avoided during detection, and each genotype of the virus can also be detected. Pigeon Newcastle disease virus selects the conservative region of the F gene to design primers and probes, pigeon rotavirus selects the conservative region of the VP6 gene to design primers and probes, and pigeon adenovirus selects the conservative region of the PVIII gene to design primers and probes.

[0048] The present invention establishes a simple, rapid, highly sensitive and specific triple fluorescence PCR detection method based on the screening, combination and testing of a large number of detection primer pairs and probes. The method can simultaneously detect three pigeon respiratory disease pathogens, namely pigeon Newcastle disease virus, pigeon rotavirus and pigeon adenovirus, which have a huge impact on my country's pigeon breeding industry in one detection reaction, and can meet the rapid detection needs of my country's pigeon breeding industry.

[0049] The standard used in the embodiment of the present invention is to clone the pigeon Newcastle disease virus F gene, pigeon rotavirus VP6 gene and pigeon adenovirus PVIII gene sequence into the pEASY-T5 vector according to the sequence in GenBank, transform into Trans-T1 bacterial competent cells, extract the recombinant plasmid, and extract the pigeon Newcastle disease virus and pigeon rotavirus plasmids, and then perform in vitro transcription to obtain the standard. After sequencing verification, it is used as the plasmid standard for multiple fluorescent quantitative RT-PCR.

[0050] The sequence of the F gene of pigeon Newcastle disease virus is as follows:

[0051] CAGACAGGGTCAATCATAGTCAAGTTGCTCCCGAATATGCCCAAGGACAAAGAGGCATGTGCGAAAGCCCCACTAGAGGCATACAACAGAACACTGACCACTTTACTCACCCCCCTCGGTGATTCCATCCGCAGGATACAAGGATCTGTATCCACATCAGGAAGAAGGAGGCAGAAGCGCTTCATAGGTGCCATTATAGGCAGTGTGGCTCTTGGGGTTGC (SEQ ID NO: 1);

[0052] The sequence of the VP6 gene of pigeon rotavirus is as follows:

[0053] GACCAGTATTTCCAGCAGGTATGAATTGGACTGAGTTGCTTAATAATTATTCAGCATCTAGAGAAGATAACTTGCAACGTATATTTACAGCAGCATCCATTCGGAGCATGGTTATTAAGTAGAGATTAGGCGTAACAGCCTATACCGAAGCTTAATGGTCATGTAGCTATACTGAAGGAAAATTCGTAGTGGACGTAAGCATCTGCGCTACCCATGCAAGA (SEQ ID NO: 2);

[0054] The sequence of the PVIII gene of pigeon adenovirus is as follows:

[0055] ACCGAATACGTCTGGAAGTACAATCCTCTCTCCGGAATTCCGGCCGGCGCCCAACAGAATTACGGAGCCACCATCGATTGGGTCCTGCCGGGCGGTCTGCCCATGGCCTACGCGGCAGAAGAGATACGCGCCCGCACCCTTCCGCCCGACGTCACGCGGGCCATCACCGCCCGCTTCGACGCCGAGAGCGATCAACAACCTTTCGCCG (SEQ ID NO: 3).

[0056] The triple fluorescence quantitative PCR reaction was performed using standard samples of pigeon Newcastle disease virus, pigeon rotavirus and pigeon adenovirus as templates, and then the reaction multiplicity was gradually increased, the concentrations of primers and probes were optimized, and the optimal reaction system of fluorescence quantitative PCR was established.

[0057] RNA from pigeon Newcastle disease virus, pigeon rotavirus and pigeon adenovirus samples was extracted and reverse transcribed into cDNA as template. Enzyme-free water was used as negative control. Multiple fluorescence quantitative RT-PCR amplification was performed according to the optimized reaction system and reaction conditions to evaluate the specificity of the method. Standard samples of pigeon Newcastle disease virus, pigeon rotavirus and pigeon adenovirus were diluted 7 times in 10-fold ratio to obtain 10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 , 10 0 Eight orders of magnitude of copy numbers were amplified using an optimized triple fluorescence quantitative PCR reaction system to determine the minimum detection template copy concentration and draw a standard curve.

[0058] The present invention is described in detail below with reference to the embodiments.

[0059] Example 1: Design of triple fluorescence quantitative RT-PCR primers and probes for pigeon Newcastle disease virus, pigeon rotavirus and pigeon adenovirus

[0060] The sequences of the F gene of pigeon Newcastle disease virus (OM542336.1, PP216549.1, OP818743.1), the VP6 gene of pigeon rotavirus (OK185349.1, MH568761.1, KT873812.1), and the PVIII gene of pigeon adenovirus (KX121164.1, KX673408.1, NC031503.1) were compared. Three sets of primers were designed for each strain using PrimerPremier 5.0 software for the conserved regions of these gene sequences, and the concentration of the primers after synthesis was diluted to 10 μmol / L for use.

[0061] Table 1: Designed primers and probes

[0062]

[0063]

[0064] Screening of primer combinations was performed to screen primer sets with high amplification efficiency, thereby avoiding the mutual influence between primers, which would result in low amplification efficiency of some primer sets and false negatives. The primer sequences designed in Table 1 were combined to obtain a total of 27 combinations, which are as follows:

[0065] (1) AαⅠ; (2) AαⅡ; (3) AαⅢ; (4) AβⅠ; (5) AβⅡ; (6) AβⅢ; (7) AγⅠ; (8) AγⅡ; (9) AγⅢ; (10) BαⅠ; (11) BαⅡ; (12) BαⅢ; (13) BβⅠ; (14) BβⅡ; (15) BβⅢ; (16) BγⅠ; (17) BγⅡ; (18) BγⅢ; (19) CαⅠ; (20) CαⅡ; (21) CαⅢ; (22) CβⅠ; (23) CβⅡ; (24) CβⅢ; (25) CγⅠ; (26) CγⅡ; (27) CγⅢ;

[0066] Pigeon Newcastle disease virus, pigeon rotavirus, and pigeon adenovirus plasmid standards were selected as positive controls, and ddH2O was used as a negative control to verify the specificity and sensitivity of 27 pairs of primers and probes.

[0067] The results showed that all 27 pairs of primers and probes could produce specific amplification for the corresponding strains, and had no amplification effect on other types of strains, and the negative controls were established. It proves that none of the 27 pairs of primers and probes will have false negative results. Moreover, compared with the primer probe groups A, B and C, the primer probe group A has better amplification efficiency, and the primer probe groups B and C have missed detection in the combination, and the amplification efficiency has decreased, so the Newcastle disease virus of pigeons chooses the primer probe group A. Compared with the primer probe groups α, β and γ, the amplification efficiency of the α and β primer groups is higher than that of the γ group, and the α primer probe group can produce detectable results in a shorter time, so the α primer probe group is selected for pigeon rotavirus. Comparing primer probe groups Ⅰ, Ⅱ and Ⅲ, the amplification efficiency of primer probe group I is better, and the amplification efficiency of primer probe groups II and III in the combination is reduced. However, some pigeon adenovirus strains failed to be amplified in primer probe group I. Therefore, based on the upstream primer of group I, the last base G of the upstream primer is changed to R, and the downstream primer and probe remain unchanged, so that more pigeon adenovirus can be amplified. Therefore, primer group I is selected for pigeon adenovirus.

[0068] The final combination was determined to be (1) AαⅠ. After the final primer probe (Table 2) sequence was determined, it was handed over to Sangon Biotech (Shanghai) Co., Ltd. for synthesis.

[0069] Table 2: Primers and probes used in triple fluorescence quantitative RT-PCR detection method

[0070]

[0071] The gene sequences of pigeon Newcastle disease virus, pigeon rotavirus and pigeon adenovirus were searched in the NCBI database. Specific primers and probes were designed using PrimerPremier 5.0 software with reference to relevant domestic literature reports. The primers and probes were compared using Primer-BLAST in NCBI to ensure the specificity of the designed primers. The primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0072] Table 3: Primer and probe sequence list for pigeon Newcastle disease virus, pigeon rotavirus and pigeon adenovirus

[0073]

[0074] (1) Preparation of fluorescent quantitative RT-PCR reaction system

[0075] Each tube of reaction solution is 25μL, containing 2×One step RT-qPCR BufferⅡ(probe)12.5μL, 5U / μLEvoM-MLV RTase Enzyme Mix 0.4μL, Pro Taq HSDNA polymerase 0.4μL, 10pmol / μLforward, reverse 1μL, probe 0.5μL, RNase Free dH2O 6.2μL, and 3μL of sample RNA template to be tested.

[0076] (2) Fluorescence quantitative RT-PCR reaction system amplification

[0077] Set the detection reaction conditions as follows: first stage, 42°C / 5min; second stage, 95°C / 30s; third stage, 95°C / 5s, 59°C / 35s (collecting fluorescence), 40 cycles. Save the file and run.

[0078] (3) Result determination

[0079] Result analysis condition setting: Read the test results. The threshold setting principle is that the threshold line just exceeds the highest point of the normal negative control amplification curve. Different instruments can adjust the position of the threshold line, and then read the test results.

[0080] Quality control standards: The negative control has no Ct value and no amplification curve; the Ct value of the positive control should be ≤36, and a specific amplification curve should appear; if the negative control and positive conditions do not meet the above conditions, the experiment is considered invalid.

[0081] Result description and judgment: The probes of pigeon Newcastle disease virus, pigeon rotavirus and pigeon adenovirus were labeled with FAM fluorescence, CY5 fluorescence and ROX fluorescence respectively. If there is no Ct value and no fluorescence amplification curve, the sample is judged to be negative for all three viruses; if one of the fluorescence amplification curves appears and the Ct value is ≤36, the virus corresponding to the fluorescence is judged to be positive, and the other two viruses are negative; if multiple fluorescence amplification curves appear and the Ct values ​​are all ≤36, the viruses corresponding to these fluorescences are judged to be positive, and the remaining viruses are negative.

[0082] Under the same reaction conditions, pigeon Newcastle disease virus, pigeon rotavirus and pigeon adenovirus standards were used as templates to screen and verify the detection primers and probes for pigeon Newcastle disease virus, pigeon rotavirus and pigeon adenovirus, respectively, to ensure that the screened primers and probes can only detect the corresponding virus standards to avoid cross-amplification reactions in the same system. After screening and verification, the sequence information of the primers and probes finally determined is as follows:

[0083] Pigeon Newcastle disease virus detection forward primer NDV forward:

[0084] 5′-CARACMGGGGTCAATCATAGT-3′(SEQ ID NO:4)

[0085] Pigeon Newcastle disease virus detection reverse primer NDV reverse:

[0086] 5′-GCAACCCCAAGAGCYACA-3′(SEQ ID NO:5)

[0087] Pigeon Newcastle disease virus detection probe NDV probe:

[0088] 5′-ATRAAGCGYTTYTGCCTCCTTCYTCC-3′(SEQ ID NO:6)

[0089] Pigeon rotavirus detection forward primer RVA forward:

[0090] 5′-GACCAGTRTTTCCAGCWGGTATG-3′(SEQ ID NO:7)

[0091] Pigeon rotavirus detection reverse primer RVA reverse:

[0092] 5′-TCTTGCRTGGGTAGCGCAGAT-3′(SEQ ID NO:8)

[0093] Pigeon rotavirus detection probe RVA probe:

[0094] 5′-TTYACAGCAGCATCCATTCGGAGCAT-3′(SEQ ID NO:9)

[0095] Pigeon adenovirus detection forward primer PIADV forward:

[0096] 5′-ACCGAATACGTCTGGAAR-3′(SEQ ID NO:10)

[0097] Pigeon adenovirus detection reverse primer PIADV reverse:

[0098] 5′-CKGCGWAAGGTTGTTGATC-3′(SEQ ID NO:11)

[0099] Pigeon adenovirus detection probe PIADV probe:

[0100] 5'-CAGAAYTACGGAGCCACMATCGATTG-3' (SEQ ID NO: 12).

[0101] Among them, the NDV probe for pigeon Newcastle disease virus detection was labeled with carboxyfluorescein FAM at the 5′ end and with the quencher group BHQ1 at the 3′ end; the RVA probe for pigeon rotavirus detection was labeled with carboxyfluorescein CY5 at the 5′ end and with the quencher group BHQ2 at the 3′ end; the PIADV probe for pigeon adenovirus detection was labeled with carboxyfluorescein ROX at the 5′ end and with the quencher group BHQ2 at the 3′ end.

[0102] Example 2: Establishment of triple fluorescence quantitative RT-PCR standard curves for pigeon Newcastle disease virus, pigeon rotavirus and pigeon adenovirus

[0103] The standard was diluted 10 times in series and mixed in equal proportions to a final concentration of 1×10 8 copies / μL-1×10 4 The mixture was used as the positive template (ddH2O as the negative template) for multiplex fluorescence quantitative RT-PCR amplification to obtain the standard curve as shown in Figure 3 As shown in the figure, it can be seen that the triple fluorescence quantitative RT-PCR of pigeon Newcastle disease virus, pigeon rotavirus and pigeon adenovirus has a good linear relationship. The linear relationship between the copy number on the X axis and the CT value on the Y axis in the standard curve is: NDV: y = -3.882x + 41.734, R 2 =0.992; RVA: y=-3.512x+485, R 2 =0.991; PIADV: y=-3.571x+41.815, R 2 =0.996.

[0104] Example 3: Specificity and sensitivity of triple fluorescence quantitative RT-PCR for pigeon Newcastle disease virus, pigeon rotavirus and pigeon adenovirus

[0105] (1) Detection specificity

[0106] Prepare fluorescent quantitative RT-PCR reaction system: each tube of reaction solution is 20 μL, containing 2×One step RT-qPCRBufferⅡ(probe)10 μL, 5U / μL Evo M-MLV RTase Enzyme Mix 0.4 μL, Pro Taq HSDNApolymerase 0.4 μL, 10 pmol / μL NDV forward, NDV reverse 0.6 μL and NDV probe 0.4 μL, 10 pmol / μL RVAforward, RVAreverse 0.5 μL and RVAprobe 0.5 μL, 10 pmol / μLPIADV forward, PIADV reverse 0.4 μL and PIADV probe 0.3 μL, RNase Free dH2O 2 μL, and 3 μL of sample RNA template to be detected.

[0107] RNA or cDNA of 4 strains of avian influenza virus (1 strain of H3 subtype avian influenza virus, 1 strain of H5 subtype avian influenza virus, 1 strain of H9 subtype avian influenza virus, 1 strain of H10 subtype avian influenza virus), 1 strain of pigeon Newcastle disease virus, 1 strain of pigeon rotavirus and 2 strains of pigeon adenovirus (type A pigeon adenovirus, type B pigeon adenovirus) were selected as templates. The detection reaction conditions were set as follows: first stage, 42℃ / 5min; second stage, 95℃ / 30s, third stage, 95℃ / 5s, 59℃ / 35s (collecting fluorescence), 40 cycles.

[0108] The results showed that the channel corresponding to the pigeon Newcastle disease virus cDNA template only showed the FAM fluorescence detection curve, the channel corresponding to the pigeon rotavirus cDNA template only showed the RVA fluorescence detection curve, and the channel corresponding to the pigeon adenovirus cDNA template only showed the ROX fluorescence detection curve. The results showed that the primers and probes screened in this experiment had strong specificity for detecting pigeon Newcastle disease virus, pigeon rotavirus, and pigeon adenovirus by triple fluorescence RT-PCR method, and there was no cross reaction between them, which could effectively identify and detect these three common diarrhea viruses in pigeons.

[0109] (2) Detection sensitivity

[0110] Eight different concentrations of pigeon Newcastle disease virus, pigeon rotavirus and pigeon adenovirus cDNA templates were set up for amplification under the optimal conditions of fluorescent quantitative RT-PCR.

[0111] Determine the original concentration of the extracted cDNA template, dilute it to 1 ng / μL according to the ratio, and then dilute it in a 10-fold gradient to 10 7 ng / μL, 10 6 ng / μL, 10 5ng / μL, 10 4 ng / μL, 10 3 ng / μL, 10 2 ng / μL, 10 1 ng / μL, 10 0 ng / μL, 3 μL was taken as reaction template, and real-time fluorescence quantitative RT-PCR amplification was performed according to the above-mentioned sampling method.

[0112] The results showed that the primer and probe combination designed by the present invention can ensure the sensitivity of detection. The detection sensitivity of the primer and probe for pigeon Newcastle disease virus detection is 10 1 ng / μL; the detection sensitivity of pigeon rotavirus detection primers and probes is 10 2 ng / μL; the detection sensitivity of pigeon adenovirus detection primers and probes is 10 1 ng / μL.

[0113] Example 4: Detection application on actual samples

[0114] 1. Sample collection:

[0115] 100 swab samples were collected. PBS solution (pH 7.0-7.4, 0.01 mol / L) was used as the preservation solution (containing penicillin 2000 IU / mL, streptomycin 2000 IU / mL, nystatin 1000 IU / mL, BSA 5 mg / mL). After the samples were collected, they were sealed in an ice-filled incubator and sent to the laboratory for processing within 24 hours or stored at -70°C.

[0116] 2. Sample Preparation

[0117] Place the cotton swab in a centrifuge tube containing 1 mL of sample preservation solution, vortex mix, centrifuge at 4°C 10000r / min for 5 min, and take the supernatant for nucleic acid extraction.

[0118] 3. Nucleic Acid Extraction

[0119] Refer to the instructions of the RNA extraction kit to extract 100 clinical samples, positive controls and negative controls. The extracted RNA must be amplified by RT-PCR within 2 hours. For long-term storage, it must be kept at -70°C.

[0120] 4. Test results

[0121] 100 samples were tested using the triple fluorescence quantitative RT-PCR method for pigeon Newcastle disease virus, pigeon rotavirus and pigeon adenovirus. The test results are shown in Table 4.

[0122] Table 4: Triple RT-PCR clinical test results

[0123]

[0124] The results showed that among the 100 samples tested by triple fluorescence quantitative RT-PCR, the positive detection rate of Newcastle disease virus was 26%, the positive detection rate of pigeon rotavirus was 36%, the positive detection rate of pigeon adenovirus was 29%, and the rest were negative, and no cross-infection samples were detected. The detection results of the RT-PCR method were consistent with the gene sequencing results at a rate of 100%. This shows that the triple real-time fluorescence RT-PCR method established by the present invention has high sensitivity and good clinical application effect.

Claims

1. A multiplex fluorescent RT-PCR primer pair and probe set for simultaneously detecting pigeon Newcastle disease virus, pigeon rotavirus, and pigeon adenovirus, characterized in that: The primer pair and probe group detect the conservative sequences of pigeon Newcastle disease virus, pigeon rotavirus and pigeon adenovirus, wherein the conservative sequences of pigeon Newcastle disease virus, pigeon rotavirus and pigeon adenovirus are SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3 respectively.

2. The multiplex fluorescent RT-PCR primer pair and probe set according to claim 1, wherein: The primer pair and probe set include: Pigeon Newcastle disease virus detection forward primer, the nucleic acid sequence of which is SEQ ID NO:4, Pigeon Newcastle disease virus detection reverse primer, the nucleic acid sequence of which is SEQ ID NO:5, Pigeon Newcastle disease virus detection probe, the nucleic acid sequence of which is SEQ ID NO:6; A forward primer for detecting pigeon rotavirus, the nucleic acid sequence of which is SEQ ID NO: 7; A reverse primer for detecting pigeon rotavirus, the nucleic acid sequence of which is SEQ ID NO: 8; Pigeon rotavirus detection probe, the nucleic acid sequence of which is SEQ ID NO: 9; Pigeon adenovirus detection forward primer, the nucleic acid sequence of which is SEQ ID NO: 10; Pigeon adenovirus detection reverse primer, the nucleic acid sequence of which is SEQ ID NO:11; The pigeon adenovirus detection probe has a nucleic acid sequence of SEQ ID NO:

12.

3. The multiplex fluorescent RT-PCR primer pair and probe set according to claim 2, wherein: The 5' end of the pigeon Newcastle disease virus detection probe NDV probe needle is labeled with carboxyfluorescein FAM, and the 3' end is labeled with a quenching group BHQ1.

4. The multiplex fluorescent RT-PCR primer pair and probe set according to claim 2, wherein: The 5' end of the pigeon rotavirus detection probe RVA probe is labeled with carboxyfluorescein CY5, and the 3' end is labeled with a quenching group BHQ2.

5. The multiplex fluorescent RT-PCR primer pair and probe set according to claim 2, wherein: The 5′ end of the pigeon adenovirus detection PIADV probe is labeled with carboxyfluorescein ROX, and the 3′ end is labeled with a quenching group BHQ2.

6. A multiplex fluorescent RT-PCR kit for detecting Newcastle disease virus, pigeon rotavirus, and pigeon adenovirus, characterized in that: The kit comprises the multiple fluorescent RT-PCR primer pair and probe set as claimed in claim 2.

7. A triple fluorescence RT-PCR detection method for detecting pigeon Newcastle disease virus, pigeon rotavirus, and pigeon adenovirus in clinical samples, characterized in that: The method is to use the kit described in claim 6 for detection.

Images