Method for improving antibacterial peptide secretion of bombyx mori and application of method

Abstract

The invention discloses a method for improving antibacterial peptide secretion of bombyx mori and application of the method, the application of # imgabs0 # gene serving as a regulation target or a regulation marker in improving antibacterial peptide Gloverin secretion of bombyx mori is provided for the first time, RNAi interference fragments of # imgabs1 # 7 genes are injected into five-year-old first-day larvae of bombyx mori, then bombyx mori nuclear polyhedrosis viruses continue to be infected after 6 hours, and the larvae are continuously infected with bombyx mori nuclear polyhedrosis viruses. The method can effectively improve the expression of antibacterial peptide Gloverin by bombyx mori and prolong the death time of bombyx mori infected with nuclear polyhedrosis virus, can provide a new thought for improving the expression quantity of the antibacterial peptide by using # imgabs2 # and the like as molecular targets, and is beneficial to deeply understanding the pathogen-resistant mechanism of bombyx mori. Reference is provided for bombyx mori antiviral research, and valuable reference is provided for deep research of the effect of # imgabs3 # 7 in bombyx mori immune reaction.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a method for improving the secretion of antimicrobial peptides by silkworms and an application thereof. Background Art

[0002] The silkworm, belonging to the order Lepidoptera, is an insect of significant economic significance and plays an important role in the development of the agricultural economy. In particular, it has extremely high economic value for the silk industry. However, the frequent occurrence of silkworm diseases has caused serious economic losses to the sericulture industry, which makes silkworm disease prevention and control occupy a vital position in sericulture production.

[0003] Antimicrobial peptides (AMPs) are a class of small immune peptides that are widely present in organisms and can defend against bacteria, fungi, viruses or parasites that invade organisms. They play a vital defensive function in insect immunity. When pathogens or parasites break through the first line of defense on the insect's body surface, certain tissues or cells of the insect will synthesize AMPs through humoral immune response, and they will be rapidly secreted and released into the blood, which will have a broad-spectrum killing effect on the invading pathogens. Therefore, effectively improving the expression level of AMPs in silkworms plays a very important role in the field of pathogen prevention and control. Gloverin is an inducible antibacterial insect protein that can inhibit the synthesis of important outer membrane proteins, thereby forming a permeable outer membrane. The antimicrobial peptide Gloverins can show antibacterial activity against different types of microorganisms (including Escherichia coli, Gram-positive bacteria, fungi and viruses), and are expressed from eggs to adults. Attactin mainly exhibits antibacterial effects on Gram-negative bacteria.

[0004] most It can induce the upregulation of antimicrobial peptide expression. can significantly increase the expression level of antimicrobial peptides, but using RNAi technology to However, there are few reports on methods to induce silkworms to express a large amount of AMPs secretion rate after knockdown. 7 There are no reports on the research on inducing antimicrobial peptides. Summary of the invention

[0005] Purpose of the invention: To solve the problems existing in the prior art, a new method for increasing the secretion of antimicrobial peptides by silkworms and its application are provided. 7 gene as a regulatory target in improving the secretion of antimicrobial peptides after silkworm infection with viruses. 7 Interference or effective knockdown can significantly increase the expression of antimicrobial peptides Attactin and Gloverin in silkworms, and significantly prolong the death time of silkworms infected with nuclear polyhedrosis virus.

[0006] Technical solution: In order to achieve the above purpose, the present invention The use of 7 genes as regulatory targets or regulatory markers in increasing the secretion of antimicrobial peptide Gloverin in silkworms, the The sequence of 7 gene is shown in SEQ ID NO.1.

[0007] The application is to increase the expression of antimicrobial peptide Gloverin in silkworms.

[0008] Among them, the The 7 genes include genes with gene sequences having more than 90% homology to their DNA sequences and having the same functions.

[0009] The present invention 7 genes or targeting Application of inhibitors or interfering agents of 7 gene-encoded proteins in enhancing the secretion of antimicrobial peptide Gloverin in silkworms.

[0010] Wherein, the inhibitor or interfering agent is used to increase the expression of antimicrobial peptide Gloverin in silkworm.

[0011] Wherein, the inhibitor or interfering agent includes specific knockout Gene editing reagents and specific interference of 7 genes 7 Interfering molecules and specific inhibition of gene expression 7 Small molecule compounds that specifically target gene expression proteins 7 genes expressing proteins / binding antibodies or ligands.

[0012] Preferably, the interfering agent is dsRNA, and its sequence is shown in SEQ ID NO.2.

[0013] Wherein, the interfering agent is dsRNA, which includes interfering primers, and the sequences thereof are: TAATACGACTCACTATAGGGATTGGGTCGGTTCAGTTCAG and TAATACGACTCACTATAGGGTACGGAAGCTGTGTCGAGTG.

[0014] The method for increasing the secretion of antimicrobial peptides by silkworms comprises: After knockdown, the expression of antimicrobial peptide Gloverin in silkworm was increased.

[0015] Injection into the host 7-gene dsRNA, and then infected with BmNPV, inducing the secretion of a large amount of antimicrobial peptide Gloverin.

[0016] The method for increasing the secretion of antimicrobial peptide Gloverin by silkworms is used in prolonging the death time of silkworms infected with nuclear polyhedrosis virus.

[0017] Furthermore, the present invention 7 gene as a regulatory target or regulatory marker in increasing the secretion of antimicrobial peptide Attactin in silkworms, the The sequence of 7 gene is shown in SEQ ID NO.1.

[0018] Wherein, the application is to increase the expression of antimicrobial peptide Attactin in silkworm.

[0019] Among them, the The 7 genes include genes with gene sequences having more than 90% homology to their DNA sequences and having the same functions.

[0020] The present invention 7 genes or targeting Application of inhibitors or interfering agents of 7 gene-encoded proteins in enhancing the secretion of antimicrobial peptide Attactin in silkworms.

[0021] Wherein, the inhibitor or interfering agent is used to increase the expression of antimicrobial peptide Attactin in silkworm.

[0022] Wherein, the inhibitor or interfering agent includes specific knockout Gene editing reagents and specific interference of 7 genes 7 Interfering molecules and specific inhibition of gene expression 7 Small molecule compounds that specifically target gene expression proteins 7 genes expressing proteins / binding antibodies or ligands.

[0023] Preferably, the interfering agent is dsRNA, and its sequence is shown in SEQ ID NO.2.

[0024] Wherein, the interfering agent is dsRNA, which includes interfering primers, and the sequences thereof are: TAATACGACTCACTATAGGGATTGGGTCGGTTCAGTTCAG and TAATACGACTCACTATAGGGTACGGAAGCTGTGTCGAGTG.

[0025] The method for increasing the secretion of antimicrobial peptides by silkworms is as follows: After knockdown, the expression of antimicrobial peptide Attactin in silkworms was increased.

[0026] Injection into the host 7-gene dsRNA, and then infected with silkworm nuclear polyhedrosis virus, inducing the secretion of a large amount of antimicrobial peptide Attactin.

[0027] The method for increasing the secretion of antimicrobial peptide Attactin by silkworms is used in prolonging the death time of silkworms infected with nuclear polyhedrosis virus.

[0028] The prior art does not disclose Bombyx mori 7 can induce the expression of antimicrobial peptides. This invention is the first to use RNAi technology to 7 knockdown induced silkworms to express a large number of AMPs, especially Attactin and Gloverin. After the expression of gene 7, the death time of silkworms infected with nuclear polyhedrosis virus can be significantly prolonged.

[0029] The present invention provides a 7, a new use of RNAi technology to target genes 7 Effective knockdown, that is, dsRNA was injected into the fifth instar first day silkworm body 6 hours later, followed by infection with Bombyx mori nuclear polyhedrosis virus, which could significantly induce the secretion of AMPs in large quantities 24 hours later. This method is simple and easy to operate, low cost, and significantly improves efficiency.

[0030] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0031] The present invention first discovered interference or knockout 7 gene as a regulatory target or regulatory marker in increasing the secretion of antimicrobial peptides Attactin and Gloverin in silkworms. 7 Interference or effective knockdown can significantly increase the expression of antimicrobial peptides Attactin and Gloverin in silkworms, and significantly prolong the death time of silkworms infected with nuclear polyhedrosis virus.

[0032] The present invention first discovered a 7 New uses of genes, using RNAi technology to target genes 7. After the fifth instar silkworms were injected for 6 hours and then continued to be infected with Bombyx mori nuclear polyhedrosis virus, the secretion rate of AMPs could be significantly increased after 24 hours. The method can effectively increase the secretion rate of AMPs in silkworms. The method is simple and easy to operate, low in cost, and significantly improves efficiency. The present invention can effectively increase the secretion efficiency of AMPs in silkworms, provide a new idea for increasing protein expression by RNAi interference, and is conducive to a deep understanding of the mechanism of silkworm resistance to pathogens, providing a reference for silkworm antiviral research and 7 provides valuable reference for its role in the immune response of silkworms. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 In order to inject the fifth-instar silkworm with the dsRNA described in the present invention, collect silkworm blood, extract RNA, and perform RT-qPCR to test the interference efficiency: (A) In vitro synthesis of targeted dsRNA of 7 (ds-BmSpz7) and the control group ds-egfp were injected into the first day of the fifth instar silkworm larvae, and serum samples were collected 4 hours later to extract RNA for RT-qPCR to verify the interference efficiency. (B) Interference 7 After 6 hours, the silkworm nuclear polyhedrosis virus was injected, and serum samples were collected 24 hours later to extract RNA. The expression level of AMPs was analyzed by RT-qPCR. Statistical analysis was performed. 7 expression, and the secretion rate of AMPs increased significantly after 24 h of BmNPV infection, indicating that the interference After 7, the secretion rate of AMPs increased significantly.

[0034] Figure 2 In order to utilize the ds-BmSpz7 described in the present invention to inject the fifth-instar silkworms, Ds-BmSpz7 (10 μl, 1 μg / μl) was injected into 50 first-day fifth-instar silkworm larvae with a microsyringe, with each silkworm being injected with 10 μl, and the control group was injected with ds-egfp (10 μl, 1 μg / μl). After 6 hours, Bombyx mori nuclear polyhedrosis virus (2.3×107TCID50 / mL 10 μl) was injected, with each silkworm being injected with 10 μl. Ordinary fresh mulberry leaves sprayed with penicillin-streptomycin antibiotic dilution (1:100) and dried were added in sufficient amount every day for feeding. After 4 days, the silkworms began to become ill and the number of deaths began to be counted. The survival rate of silkworms after dsRNA interference was compared. The results showed that compared with the control group ds-egfp, Knockdown of 7 significantly delayed the death time of silkworms infected with nuclear polyhedrosis virus (8 hours). DETAILED DESCRIPTION

[0035] The present invention is further described below in conjunction with specific embodiments, which are only used to explain the present invention and cannot be understood as limiting the present invention. It can be understood by those skilled in the art that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and purpose of the present invention, and the scope of the present invention is defined by the claims and their equivalents.

[0036] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent companies unless otherwise specified.

[0037] Example 1 Based on the NCBI sequence (GeneID: 101738945), a pair of ds-BmSpz7 interference primers (ds-BmSpz7 F and ds-BmSpz7 R in Table 1) were first designed, and double-stranded dsRNA was synthesized using cDNA extracted from silkworm ovarian cells (preserved by the School of Biotechnology, Jiangsu University of Science and Technology) as a template to knock down B. 7 gene expression; at the same time, ds-egfp interference primers (ds-egfp F and ds-egfp R in Table 1) were designed to express the plasmid pIZ / V5-eGFP-TMD containing the egfp gene (provided by the School of Biotechnology, Jiangsu University of Science and Technology, Hao B, Liu L, Liu N, Sun L, Fan F, Huang J. The Bombyx mori Nucleopolyhedrovirus GP64 Retains the Transmembrane Helix of Signal Peptide to Contribute to Secretion across the Cytomembrane. Microbiol Spectr. 2022Aug31;10(4):e0191322.doi:10.1128 / spectrum.01913-22.Epub 2022Aug 8. PMID: 35938817; PMCID: PMC9430547.) was used as a template to synthesize double-stranded dsRNA as a control.

[0038] The detection 7 Knockdown expression efficiency qPCR primers (BmSpz7QF and BmSpz7 QR in Table 1) and internal reference primers (GAPDH QF and GAPDH QR).

[0039] In order to detect the changes in the expression levels of AMPs in silkworm cells, three AMP qPCR primers were designed, namely primers for detecting the expression of antimicrobial peptide Attacin (BmAttacin QF and BmAttacin QR in Table 1), primers for Gloverin (BmGloverin QF and BmGloverin QR in Table 1), and primers for Moricin (BmMoricin QF and BmMoricinQR in Table 1).

[0040] Table 1 Target gene sequences and qPCR primer sequences required for RNAi

[0041]

[0042] The dsRNA was synthesized by T7 RNAi in vitro transcription kit (Takara, Nanjing) to obtain a 495 bp dsRNA for subsequent interference experiments.

[0043] Specific synthesis process:

[0044] (1) dsRNA primer synthesis

[0045] The designed primer sequences in Table 1 were sent to Sangon Biotech (Shanghai) Co., Ltd. for synthesis and standby use.

[0046] (2) Preparation of double-stranded dsRNA

[0047] First, the synthesized ds-BmSpz7 F and ds-BmSpz7 R primers were dissolved in sterilized ddH2O and then prepared into a 100 pmol / μL solution.

[0048] Then prepare the oligo DNA annealing reaction solution, the specific configuration of the system used is:

[0049]

[0050] Reaction conditions were set as follows: denaturation: 98°C, 10 sec; annealing: 62°C, 15 sec; extension: 72°C, 10 sec.

[0051] (3) In vitro transcription reaction

[0052] Prepare the RNA in vitro transcription reaction solution as follows:

[0053]

[0054] After ensuring that the above solutions are mixed evenly, centrifuge slightly, then collect the transcription reaction solution at the bottom of the reaction tube and place it in a 42°C constant temperature water bath for 4 hours to ensure complete reaction.

[0055] (4) Nuclease treatment

[0056] During the experiment, the RNase T1 (original concentration is 100U / μL) provided by the kit needs to be diluted to the target concentration of 4U / μL by RNase T1 Dilution Buffer. After the in vitro transcription reaction is completed, accurately add 1μL of 4U / μL RNase T1 solution to the reaction tube, and add 5U / μL RNase free DNaseⅠ at the same time. After ensuring that the mixture is fully uniform, place the system in a water bath at a constant temperature of 37℃ for 2 hours of reaction treatment.

[0057] (5) Purification of dsRNA

[0058] An equal volume of a water-saturated acidic phenol / chloroform / isoamyl alcohol mixture (ratio 25:24:1) was added to the above reaction solution, mixed thoroughly, and centrifuged at 10000 rpm at room temperature for 5 min; the upper layer of liquid was transferred to a new EP tube, and the same volume of 5 M ammonium acetate (pH 5.6) and four times the volume of 99.5% ethanol were added, and centrifuged at 15000 rpm for 5 min at 25°C; the supernatant was aspirated, the EP tube was placed in a ventilated place to dry, and 20 μL of RNase ddH2O was added to the tube to dissolve the precipitate.

[0059] (6) Take 1 μL of the synthesized dsRNA (ds-BmSpz7) and measure its concentration using a NanoDrop micro-spectrophotometer.

[0060] The sequence of the synthesized dsRNA (ds-BmSpz7) is as follows:

[0061] ATTGGGTCGGTTCAGTTCAGTGTCGGCAATACAATTTCGAACAACAAT

[0062] TCACTTATAGTCGAAATGCCACCGGGATGCAGAGGCGAAAAGATGTGTTT

[0063] TGAAAAATCTAAGGACTATCCAACCGATAAAATCAATAGCCTATTAAATA

[0064] GCACGGGTTGGGGAATAGCCGACGCGATCAGGGTGGTCGGTCATCGACA

[0065] AGGTAGCTTCGTAGAAATCTGCAAATCTAAGATACTGCCACCTACACAGG

[0066] TGTACGAAATTGAAGACGAGAACGGCATCATTCGGTTCGTTGTTCAAGAT

[0067] GAGAAGTTTAAGCAAATCGTGAACGTCATTAAGTGCAGTGACGAAGGGA

[0068] ACATCACGAGGTCGTCTGATATATACGAAAGATCTTATTTCGCTTACGGA

[0069] GCATTGATAAGCTACAGCCTGACGTGTAGACAGGTAACAATTGATTTCAA

[0070] GTTCCTGGTGCTCAGTATAGACGGGCAATCACTCGACACAGCTTCCGTA

[0071] Note: The method for synthesizing ds-egfp control is similar to that for synthesizing ds-BmSpz7, except that the template and primers are replaced with pIZ / V5-egfp and ds-egfp F and ds-egfp R.

[0072] Example 2

[0073] Silkworm larvae 7Gene interference and viral infection

[0074] 1. Silkworms (P50 strain) were provided and preserved by the Key Laboratory of Silkworm Genetic Improvement of the Ministry of Agriculture and Rural Affairs, and fed with common mulberry leaves at 27° C. ds-BmSpz7 (10 μl, 1 μg / μl) synthesized in Example 1 was injected into the first day of the fifth instar silkworm larvae with a microsyringe, and ds-egfp (10 μl, 1 μg / μl) was injected into the control group. Serum was collected 6 hours later and the interference efficiency was detected by qPCR.

[0075] 2. Silkworms (P50 strain) were provided by the Key Laboratory of Silkworm Genetic Improvement, Ministry of Agriculture and Rural Affairs, and fed with common mulberry leaves at 27°C. ds-BmSpz7 (10 μl, 1 μg / μl) was injected into the first day of the fifth instar silkworm larvae with a microsyringe, and the control group was injected with ds-egfp (10 μl, 1 μg / μl). 6 hours later, Bombyx mori nuclear polyhedrosis virus (preserved and cultured by the Key Laboratory of Silkworm Genetic Improvement, Ministry of Agriculture and Rural Affairs) (2.3×10 7 TCID 50 / mL, 10μl) virus, and the serum was collected 24 hours later to detect the expression level of AMPs by qPCR.

[0076] 3. The steps to detect interference efficiency are as follows:

[0077] (1) Take silkworm hemolymph samples and extract RNA:

[0078] 1) Take an appropriate amount of silkworm blood into an EP tube, add 1 ml of RNAiso plus (Takara, Nanjing) lysis buffer into the tube and mix well.

[0079] 2) Then shake gently and thoroughly to ensure the mixture is uniform, and keep it at room temperature for about 5 minutes.

[0080] 3) Precool the refrigerated centrifuge to 4°C, add 200 μl of chloroform, mix thoroughly, keep at room temperature for about 5 minutes, and then centrifuge at 12,000 rpm for 5 minutes.

[0081] 4) Pipette the supernatant into a new EP tube, add 1 mL of isopropanol, and shake gently to ensure mixing. Then, let it stand at room temperature for 10 minutes to promote the formation of RNA precipitation. Then centrifuge at 12000 rpm for 15 minutes.

[0082] 5) Aspirate the supernatant solution, add 2 volumes of 75% ethanol solution (prepared with DEPC water) to the EP tube, gently suspend the RNA precipitate with a pipette, and then centrifuge at 7500 rpm for 5 minutes.

[0083] 6) Discard the supernatant and place the EP tube in a ventilated place to dry for 5 minutes. Dissolve the RNA precipitate in the EP tube with 20 μl of RNase free H2O, mix well and take 1 μl to measure the RNA concentration, then take 5 μl, add 6× Loading Buffer, and use 1% agarose gel electrophoresis to detect the quality of the extracted RNA sample.

[0084] (2) RNA reverse transcription:

[0085] according to III RT SuperMix for qPCR (+gDNA wiper) reverse transcription kit instructions, take 1μg of RNA sample for reverse transcription.

[0086] 1) Removal of genomic DNA

[0087] Prepare the genome removal premix (Table 2) in an RNase-free PCR tube, mix gently, and heat in a 42°C water bath for 2 min.

[0088] Table 2 Genome removal master mix

[0089]

[0090] 2) Preparation of reverse transcription reaction premix

[0091] Add 4 μl of 5×HiScript III qRT SuperMix to the premix after the first step reaction and mix by gently pipetting.

[0092] 3) Perform reverse transcription reaction

[0093] The prepared reverse transcription reaction premix was placed in a PCR instrument under the following reaction conditions: 37°C for 15 min, 85°C for 5 s. The concentration of the solution after the reaction was determined using a NanoDrop spectrophotometer.

[0094] (3) Fluorescence quantitative PCR (qPCR) reaction

[0095] The samples were treated with GAPDH as the internal reference. The quantitative primers used in the qPCR reaction in this experiment are shown in Table 1. GAPDH was used as the internal reference gene (ID: EU141495.1) and 2 -ΔΔCt The relative expression of genes was calculated.

[0096] 1) Prepare the quantitative reaction premix in eight qPCR tubes (Table 3)

[0097] Table 3 Quantitative reaction premix

[0098]

[0099]

[0100] 2) Perform qPCR reaction according to the following conditions. The reaction conditions are shown in Table 4

[0101] Table 4 Quantitative reaction conditions

[0102]

[0103] (4) Statistical analysis

[0104] The experiment was repeated three times and the technical results were repeated three times, and the data were subsequently analyzed using Graph Pad Prism 8.0 software.

[0105] Verification of RNAi interference efficiency and the effect of interference on AMPs secretion Figure 1 As shown, the results found 7 was significantly lower than that of the control group, indicating that the dsRNA synthesized in Example 1 was injected into the silkworm. 7 is suppressed ( Figure 1 A) When RNAi technology is used to knock down 7, and AMPs expression levels increased significantly after 24h of BmNPV infection ( Figure 1 B), the statistical results show that the secretion rate of Attacin increased by 870%, the secretion rate of Gloverins increased by 540%, and the secretion rate of Moricin did not increase. 7 can significantly induce the expression of AMPs.

[0106] Example 2

[0107] 7 Injection of Bombyx mori nuclear polyhedrosis virus after interference delays death of silkworms

[0108] 50 5th instar day 1 larvae of B. mori (P50 strain) were injected with ds-BmSpz7 (10 μl, 1 μg / μl) using a microinjector. The control group was injected with ds-egfp (10 μl, 1 μg / μl). 6 h later, B. mori nuclear polyhedrosis virus (2.3×107 TCID 50 / mL 10μl). Every day, the silkworms were fed with fresh mulberry leaves sprayed with penicillin-streptomycin antibiotic dilution (1:100) and dried. After 4 days, the silkworms began to become ill and the number of deaths was calculated. The survival rate of silkworms after dsRNA interference was compared. The results are shown in Figure 2 As shown, compared with the control ds-EGFP, After knocking down 7, the death time of silkworms infected with the virus was significantly delayed (8 hours).

Claims

1. 7 genes as regulatory targets or regulatory markers in increasing the secretion of antimicrobial peptide Gloverin in silkworms, the The sequence of 7 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that The application is to increase the expression of antimicrobial peptide Gloverin in silkworm.

3. The use according to claim 1 or 2, characterized in that Said The 7 genes include genes with gene sequences having more than 90% homology to their DNA sequences and having the same functions.

4. 7 genes or targeting Application of inhibitors or interfering agents of 7 gene-encoded proteins in enhancing the secretion of antimicrobial peptide Gloverin in silkworms.

5. The use according to claim 4, characterized in that: The inhibitor or interfering agent includes a specific knockout Gene editing reagents and specific interference of 7 genes 7 Interfering molecules and specific inhibition of gene expression 7 Small molecule compounds of gene expression proteins, or specific 7 genes expressing proteins / binding antibodies or ligands.

6. The use according to claim 5, characterized in that the interfering agent is dsRNA, and its sequence is shown in SEQ ID NO.

2.

7. The use according to claim 6, characterized in that the interfering agent is dsRNA, and its interfering primer sequences are preferably: TAATACGACTCACTATAGGGATTGGGTCGGTTCAGTTCAG and TAATACGACTCACTATAGGGTACGGAAGCTGTGTCGAGTG.

8. A method for increasing the secretion of antimicrobial peptides by silkworms, characterized in that: By After knockdown, the expression of antimicrobial peptide Gloverin in silkworm was increased.

9. The method according to claim 8, characterized in that Injection of interference into the host 7 gene dsRNA, and then infected with Bombyx mori nuclear polyhedrosis virus, inducing the secretion of microbial peptide Gloverin in large quantities; 7. The gene interfering agent comprises the dsRNA according to claim 6.

10. Use of the method for increasing the secretion of antimicrobial peptide Gloverin by silkworms as claimed in claim 8 in prolonging the death time of silkworms infected with nuclear polyhedrosis virus.

Images