Application of aspartate transaminase gene AspAT10 in improvement of nitrogen utilization rate of poplar

Abstract

The invention discloses an application of an aspartate transaminase gene AspAT10 in improving the nitrogen utilization rate of poplar trees. An overexpression vector of the gene and a transgenic poplar seedling material containing the overexpression vector are constructed by using the poplar trichocarpa PtAspAT10 gene, compared with a wild type, the AspAT10 overexpression material has obvious differences in rooting time, fresh weight, root length and plant height, and the carbon and nitrogen content and NUE in the material can still be greatly improved in a low-nitrogen environment. It is proved that the PtAspAT10 gene participates in the growth process of plants, is an important gene related to nitrogen metabolism, and has wide application prospects in the aspects of crop germplasm resource improvement and genetic breeding. And a high-quality gene resource and a scientific basis are provided for how to efficiently improve the nitrogen utilization efficiency of the poplar in an environment-friendly manner so as to reduce the input of a nitrogen fertilizer and protect the ecological environment in a plant excellent breeding project.

Description

Technical Field

[0001] The invention relates to application of aspartate aminotransferase gene AspAT10 in improving nitrogen utilization rate of poplars, and belongs to the technical field of forestry breeding. Background Art

[0002] Poplars are deciduous woody plants belonging to the Salicaceae family (Salicaceae), angiosperms, and are characterized by rapid growth, high yield, and strong environmental adaptability. They are widely used in ecological protection, urban greening, industry, and fiber production. Poplars are also the preferred perennial plants for the production of bioenergy raw materials. In addition, the whole genome sequencing of poplars has been completed, and its genome is small and easy to operate. Moreover, poplars have the ability to reproduce asexually and are the natural host of Agrobacterium tumefaciens, which facilitates the genetic transformation of plants using the Agrobacterium tumefaciens-mediated method. They have been used as a model plant for forest genetic engineering research. 84K poplar (Populus alba x Populus glandulosa) is a new generation of white poplar poplar varieties. It is easy to root, grows fast in the seedling and sapling stage, has good material, strong wind resistance, and wide adaptability. It also has strong stress tolerance and has great application value in vegetation restoration, prevention of soil erosion, and saline-alkali land restoration.

[0003] The rapid growth of poplars makes them have a high demand for nutrients in the soil. When planting poplars on nutrient-poor, arid and barren land or sandy soil where it is difficult to maintain water-fertilizer balance, fertilizers need to be applied in time to ensure their survival rate. Among various nutrient supplies, nitrogen fertilizer input has a significant impact on the growth and development of poplars. Within a certain range of nitrogen concentration, the application of nitrogen is beneficial to increase the biomass and photosynthetic rate of poplars. However, the use of nitrogen fertilizers in my country has long lacked standardized guidance. Whether to apply nitrogen fertilizers and how much to use are usually determined by farmers' subjective will. This leads to problems such as insufficient or excessive fertilizer input that does not match plant needs, as well as ecological environmental damage and land degradation caused by fertilizer production and loss. In addition, some nitrogen fertilizers may be released into the air to form pollutants such as ammonia, or leak into drinking water, affecting human health. Controlling fertilizer input or conducting genetic level improvement breeding is currently the main means to solve the fertilizer utilization problem facing poplar cultivated forests. Previous studies have found that overexpression of the ammonium transporter gene PtrAMT1;6 of Populus trichocarpa affects the activity of nitrogen metabolism-related enzymes, the content of soluble proteins and soluble sugars; overexpression of glutamine synthetase GS1 promotes efficient nitrogen utilization and plant growth. This shows that nitrogen metabolism in poplars can be enhanced through genetic improvement, thereby enhancing the growth and development of poplars and their stress resistance. However, nitrogen metabolism in plants is affected by many factors, which involve a large number of genes with diverse functions. In forest genetic breeding research, only a small number of genes have been deeply explored, and the functions of more genes are yet to be explored, especially genes involved in plant nitrogen metabolism regulation. The study of their regulatory functions and mechanisms is particularly important. By optimizing the nitrogen metabolism pathway and promoting the efficient growth of poplars in nitrogen stress (low nitrogen and high nitrogen) environments, it is expected to improve the nitrogen utilization efficiency of poplars, reduce the adverse effects of nitrogen fertilizer input on the environment, improve the productivity and quality of poplars, and improve the health and balance of the ecosystem.

[0004] Aspartate aminotransferase (AspAT; EC 2.6.1.1), also known as glutamic-oxaloacetic transaminase (GOT), is widely present in plants, microorganisms and animals. It is a 5'-pyridoxal phosphate (PLP)-dependent aminotransferase. Under the catalysis of AspAT, aspartate (Asp) and α-ketoglutarate (2-OG) are reversibly converted into glutamate (Glu) and oxaloacetate (OAA). AspAT is not only involved in important metabolic regulation in plants, such as the tricarboxylic acid cycle, amino acid catabolism, connecting carbon and nitrogen metabolism, redox, TOR pathway and other basic metabolism and signaling pathways, but also participates in various stress responses. In abiotic stress, nitrogen nutritional status affects the transcriptional accumulation of AspAT in crops and the enzyme activity of AspAT in different cellular components. Nitrogen-free and high nitrogen treatments can significantly upregulate the expression of mitochondrial ZmAspAT1.3 and plastid ZmAspAT / PAT ( RA, et al. 2009). In addition, plant hormone signals may crosstalk with nitrogen signals, which can also significantly affect the transcription level of AspAT. Exogenous jasmonic acid treatment of Populus nigra significantly induced the expression of aspartate aminotransferase (AAT2)-like AspAT (BABST BA, et al. 2009). Exogenous treatment of Arabidopsis with GABA under low carbon has a strong induction effect on Arabidopsis AtASP2 (ALBERT B, et al. 2014). In addition, under drought stress, Northern Blot detection found that the abundance of PvAspAT-2 in soybean nodules was reduced (SILVENTE S, et al. 2003), and under salt stress and drought stress, the transcription level of Arabidopsis AspAT3 increased after 10-24h (SEKI M, et al. 2002). In the biotic stress experiment, AspAT2 overexpressing transgenic Arabidopsis showed more lesions when infected with Botrytis cinerea, and the transcript of this gene increased during infection (BRAUC S, et al. 2011). Silencing PsAAT3 of Phytophthora sojae reduced the pathogenicity of soybean plants and affected the growth under nitrogen starvation conditions, indicating that PsAAT3 is involved in the pathogenicity and nitrogen utilization of pathogens during infection (WANG R, et al. 2016). The gene expression pattern of AspAT was analyzed by bioinformatics, and it was found that different AspAT-encoded genes were differentially expressed under stress (BRAUC S, et al. 2011). PlantCARE analyzed the upstream 1.5kb cis-acting element sequence of 10 isozyme genes of the poplar AspAT family and found that it contained multiple stress response elements such as low temperature, drought, hypoxia and biotic stress (SU T, et al. 2019), suggesting that AspAT may be involved in the regulation of various stresses in poplars. In summary, AspAT is a key metabolic hub that is interconnected with multiple metabolic pathways such as C and N metabolism, which are of great significance to plant nutrition, energy and stress response. However, there are relatively few studies on AspAT in plants, and its biological function and mechanism of action need to be further explored. Summary of the invention

[0005] Purpose of the invention: The purpose of the present invention is to provide an application of aspartate aminotransferase gene AspAT10 in improving nitrogen utilization efficiency of poplars, which can increase the total carbon and nitrogen content and NUE in poplar plants under nitrogen stress environment.

[0006] Technical solution: The present invention provides the application of aspartate aminotransferase gene AspAT10 in improving nitrogen utilization rate of poplar.

[0007] The invention also provides the use of an aspartate aminotransferase gene AspAT10 overexpression vector in improving nitrogen utilization rate of poplars.

[0008] Furthermore, the original vector of the aspartate aminotransferase gene AspAT10 overexpression vector is a pRI101 vector.

[0009] Furthermore, the nucleotide sequences of the specific primers used to construct the overexpression vector are shown in SEQ ID NOs. 1-2.

[0010] Furthermore, the poplar variety is 84K poplar.

[0011] The present invention also provides a method for obtaining a poplar plant with high nitrogen utilization efficiency, the method comprising making the poplar plant contain an aspartate aminotransferase gene AspAT10 or an overexpression vector containing the gene.

[0012] Furthermore, the specific steps of the method include: transforming the overexpression vector containing the aspartate aminotransferase gene AspAT10 into Agrobacterium tumefaciens competent cells to obtain positive bacteria, cutting off mature and healthy leaves or stem segments of wild-type plants, scratching wounds, infecting with positive bacteria, culturing until bacteria appear on the edges of the leaves or stem segments, and then performing multiple rounds of screening using a culture medium containing antibiotics; transferring the newly grown callus into a differentiation culture medium for differentiation, and after germination, transferring the poplar seedlings into a rooting culture medium, and culturing for 5 to 10 days to obtain transgenic poplar plants with high nitrogen utilization efficiency.

[0013] The present invention also provides a method for identifying the poplar plant with high nitrogen utilization rate obtained by the above method, and determining whether the plant contains the above aspartate aminotransferase gene AspAT10.

[0014] Furthermore, the nucleotide sequences of the specific primers used for identification are shown in SEQ ID NOs. 3-4.

[0015] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: The present invention uses the PtAspAT10 gene of Populus trichocarpa to construct an overexpression vector of the gene and a transgenic poplar seedling material containing the overexpression vector. Compared with the wild type, the AspAT10 overexpression material has obvious differences in rooting time, fresh weight, root length and plant height, and can still significantly increase the carbon and nitrogen content and NUE in the material under a low nitrogen environment. It proves that the PtAspAT10 gene is involved in the growth process of plants and is an important gene related to nitrogen metabolism. It has broad application prospects in crop germplasm resource improvement and genetic breeding. It provides high-quality genetic resources and scientific basis for how to efficiently and environmentally improve the nitrogen utilization efficiency of poplars in the subject of plant breeding to reduce the input of nitrogen fertilizers and protect the ecological environment. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Cloning and vector construction of PtAspAT10 gene. PtAspAT10 cloning verification (A). Schematic diagram of pRI101-PtAspAT10 plasmid (B). Transformation of pRI101-PtAspAT10 plasmid into E. coli DH5α for verification (C). Quality detection of plasmid extracted from positive DH5α colonies (D). Verification of pRI101-PtAspAT10 plasmid double enzyme digestion products (E).

[0017] Verification of transformation of Agrobacterium tumefaciens GV3101 with pRI101-PtAspAT10 plasmid (F). (Wherein, product: PtAspAT10 cloned by specific primers; N: no cDNA template; M: DNAMarker 1kb ladder. Ndel / BamHI digestion: pRI101-PtAspAT10 vector was linearized using NdeI and BamHI double restriction sites; Control: pRI101-PtAspAT10 plasmid without restriction digestion; RB and LB: right and left borders of T-DNA; CaMV35S: 35S promoter of cauliflower mosaic virus (CaMV); EGFP: enhanced green fluorescent protein; NPTII: encoding Kan gene; NOS: NOS terminator; 1-8 in Figure C: 8 Escherichia coli DH5α colonies randomly selected after transformation with pRI101-PtAspAT10 plasmid; 1-2 in Figure F: 2 Agrobacterium tumefaciens GV3101 colonies randomly selected after transformation with pRI101-PtAspAT10 plasmid).

[0018] Figure 2 Different stages of transformation of PtAspAT10 overexpressing 84K. Co-cultivation (A), screening (B), differentiation (C), seedling (D) and seedling (E) stages. Morphology of 84K under UV light (E) (F).

[0019] Figure 3 Phenotypes of OEAspAT10 and WT under nitrogen treatment. Morphology of OEAspAT10 and WT under LN (A), NN (B) and HN (C). Schematic diagram of phenotype (D). Rooting time (E), fresh weight (F), plant height (G) and root length (H) of OEAspAT10 and WT under LN, NN and HN. Different letters on the bar graphs indicate significant differences between the data of different treatments after significance test (P ≤ 0.05) using one-way ANOVA and Duncan test.

[0020] Figure 4Total nitrogen (A) and total carbon (B) contents, NUtE (C) and NUpE (D) of OEAspAT10 and WT under nitrogen treatments. Different letters on the bar graphs indicate significant differences between the data of different treatments after one-way ANOVA and Duncan's test (P≤0.05). DETAILED DESCRIPTION

[0021] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0022] Example 1 Cloning of PtAspAT10 gene and vector construction

[0023] According to the PtAspAT10 gene sequence (GenBank accession number: PNS93336.1) in the Populus trichocarpa genome database provided by NCBI, and with the homology arm of the plasmid added to the 5' end of the primer, gene-specific primers (PtAspAT10 Forward: CTTCACTGTTGATACATATGGAGTCTTCTTCTGTGTTTG (SEQ ID NO.1) and Pt AspAT10 Reverse: CCTTGCTCACCATGGATCCGCCAACACGGGTAACAG (SEQ ID NO.2)) were designed and cloned using the primers from Takara. MaxDNAPolymerase high-fidelity PCR amplification kit was used to obtain the full-length cDNA through PCR amplification and purify the product. The results showed that the length of the purified product was 1230bp, with a single band without contamination, which was consistent with the expected size. The negative control (N) had no band ( Figure 1 A). PCR reaction system: 25μl PrimeSTAR Max Premix (2×), 10-15pmol primers, 100-200ng cDNA template, add ddH2O to make up the volume to 50μl. PCR reaction conditions: 98℃ pre-denaturation for 2min, 98℃ for 10sec, 55℃ for 5-15sec, 72℃ for 15sec for a total of 30-35 cycles. 72℃ extension for 5min. The template is the extracted Populus trichocarpa cDNA.

[0024] The pRI101 vector (V1033-G, Sinogenesci) with double restriction sites of NdeI and BamHI was selected, and the target gene (the above 1230 bp PCR purified product) was connected with the linearized pRI101 vector purified product by seamless cloning ( Figure 1B). The ligation product was transformed into E. coli competent cells DH5α, and the 2×Rapid TaqMaster Mix rapid PCR mixture from Vazyme was used. Specific primers (P35: GTGCGTC ATCCCTTACGTCAGT (SEQ ID NO.3) and EGFPN3: CTGGTCGAGCTGGACGGCGA CG (SEQ ID NO.4)) were selected to identify the recombinant plasmid by colony PCR. The PCR reaction system: 10μl 2×Rapid Taq Master Mix, 10-15pmol primers, 0.1-10ng template, add ddH2O to make up the volume to 20μl. PCR reaction conditions: 95℃ pre-denaturation for 3min, 95℃15sec, 60℃15sec, 72℃10sec for a total of 30-35 cycles. 72℃ extension for 5min. PCR results ( Figure 1 C) shows that the eight colonies with serial numbers 1-8 all had bands after PCR reaction, and the band size was 1412bp, which was consistent with the size of the gene to be detected. The negative control (N) had no bands, proving that the colonies detected were all positive colonies. The plasmid was extracted using a plasmid mini-extraction kit (DP103, Tiangen Company) and tested by agarose gel electrophoresis. The results were ( Figure 1 D) shows that the plasmid bands are clear and the extraction purity is good. The recombinant plasmid was analyzed by double enzyme digestion with NdeI and BamHI. The recombinant plasmid can be seen as a double band of 1223bp and 11111bp under agarose gel electrophoresis ( Figure 1 E), which was consistent with the expected size, indicating that the target gene had been recombined into the plasmid. The plasmid was then sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing verification. The correctly sequenced pRI101-PtAspAT10 plasmid was transformed into Agrobacterium tumefaciens GV3101 by heat shock method. After 2 days, the number of single colonies on the transformed plate was large and non-contaminated. Two single colonies were randomly selected and PCR verified using specific primers (SEQ ID NO.3-4). The target gene band was 1412bp ( Figure 1 F), indicating that the recombinant plasmid has been successfully transformed into Agrobacterium GV3101.

[0025] Example 2 Construction of 84K poplar overexpressing PtAspAT10

[0026] (1) Take out the Agrobacterium tumefaciens GV3101 glycerol strain prepared in Example 1 from a -80°C freezer and spread it on a culture medium plate for activation.

[0027] (2) Pick a single clone and transfer it to LB liquid culture medium (add 50 mg / L kanamycin (Kan) and 25 mg / L rifampicin Rif), place it in a shaker at 28°C, 220 rpm and culture overnight in the dark.

[0028] (3)OD 600 When the OD is 0.8-1.4, collect the bacteria. Resuspend and dilute the bacterial solution with resuspension solution (woody plant culture medium WPM + 20g / L sucrose + 1mg / L 2,4-dichlorophenoxyacetic acid (2,4-D) + 0.1mg / L kinetin (KT), pH 5.6) to OD 600 0.6-0.8, place at room temperature for 1 hour.

[0029] (4) Select 84K tissue culture seedlings grown in rooting medium for one month, cut off mature and healthy leaves and stem segments, gently cut wounds with a scalpel, and soak in the infection solution prepared in step (3) for 10-15 minutes, shaking from time to time.

[0030] (5) Wipe the bacterial solution on the surface of leaves and stem segments with filter paper and spread it on the co-culture medium (WPM + 20 g / L sucrose + 100 μM acetosyringone (AS), pH 6.0) ( Figure 2 A) Culture in the dark for 2-3 days until fungi appear on the edges of leaves and stem segments.

[0031] (6) Cut the leaves into 2-4 cm 2 , placed on screening medium (WPM + 20g / L sucrose + 1mg / L 2,4-D + 0.1mg / L KT + 300mg / L Tim + 10mg / L Kan, pH 6.0) and cultured in the dark for about 14 days. Figure 2 B) Cut the callus along the edge of the leaf and transfer it to a new screening medium. Subculture once every 4-5 days until a callus with a diameter of about 0.5 cm grows. This stage lasts about 30 days.

[0032] (7) Transfer the callus tissue to differentiation medium (WPM + 20g / L sucrose + 0.5mg / L 6-benzylaminopurine (6-BA) + 0.1mg / L naphthaleneacetic acid (NAA) + 300mg / LTim + 10mg / L Kan, pH 6.0) and subculture once every 14 days. During this period, the callus will turn green (or red), harden ( Figure 2 C).

[0033] (8) After the buds have grown to 1-2 cm in size ( Figure 2D), placed in rooting medium (1 / 2MS + 10g / L sucrose + 200mg / L Tim + 10mg / L Kan, pH6.0), rooting in about a week. After obtaining the seedlings, the top buds can be cut and placed in the rooting medium for subculture or the stem segments can be cut and placed in the differentiation medium (MS + 25g / L sucrose + 0.1mg / L 6-BA + 0.1mg / L NAA + 200mg / L Tim + 10mg / L Kan, pH6.0) for differentiation to ensure sufficient transgenic materials. The seedlings at this time are 84K poplar OEAspAT10 overexpressing PtAspAT10.

[0034] Under normal conditions, there is no significant difference in phenotype between OEAspAT10 and WT (wild-type 84K poplar) and it is impossible to distinguish ( Figure 2 E). Under ultraviolet light, the WT plant on the right appears red because chlorophyll emits red fluorescence, while OEAspAT10, which carries the GFP gene, exhibits obvious green fluorescence under ultraviolet light ( Figure 2 F) This method was used to preliminarily screen out transgenic positive plants that overexpress the gene.

[0035] Implementation 3 Nitrogen stress treatment of 84K poplar PtAspAT10 overexpressing plants

[0036] Prepare nitrogen-containing rooting medium: use MS powder without nitrogen, add 10g / L sucrose, then add different concentrations of nitrogen, add water to make up the volume to 1L, adjust the pH to 5.9-6.0, add 8g / L agar, sterilize at high temperature and high pressure, and pour evenly into the culture bottle. Select OEAspAT10 positive seedlings and WT grown in the rooting medium for one month, cut off the apical buds and insert them into the rooting medium with different concentrations of nitrogen. Three gradients of nitrogen treatment were set up, namely LN (0.25mM KNO3+0.25mM NH4Cl), NN (1mM KNO3+1mM NH4Cl) and HN (5mM KNO3+5mM NH4Cl), and cultured at 16h light (25℃) / 8h dark (20℃). One OEAspAT10 seedling (T4) and one WT seedling were inserted into each culture bottle to observe the phenotypic differences. At least 6 plants were collected for each treatment level, and the whole experiment was repeated 3 times. Figure 3 As shown in AC, the leaves of OEAspAT10 appeared light pink under fluorescence, and the stems appeared green, while the leaves and stems of WT appeared red, indicating that AspAT10 was expressed normally in the transgenic plants. Comparison of the rooting time of WT and OEAspAT10 plants showed that the rooting time of OEAspAT10 was 5-6 days, which was 7 days earlier than that of WT ( Figure 3 E). Comprehensive observation of the morphology and root length of the whole plant showed that the roots of OEAspAT10 were green under ultraviolet light at 10 days. Figure 3B) The root length and plant height of OEAspAT10 were similar to those of WT. However, in LN ( Figure 3 A) and HN( Figure 3 C) The root length of OEAspAT10 was significantly greater than that of WT. At 22 days, the fresh weight of OEAspAT10 increased by 20.54%, 4.59% and 15.31% respectively under three nitrogen concentrations compared with WT; the root length increased by 188.24%, 40.17% and 91.23% respectively; the plant height increased by 45.20%, 9.59% and 15.32% respectively ( Figure 3 The above results show that the fresh weight, root length and plant height of OEAspAT10 are significantly higher than those of WT under the same nitrogen concentration, especially under LN and HN, the difference between OEAspAT10 and WT is even greater.

[0037] Example 4 Effect of Nitrogen Treatment on Carbon and Nitrogen Content of OEAspAT10

[0038] In order to explore the effect of the PtAspAT10 gene on the nitrogen status and nitrogen utilization efficiency (NUE) of 84K under different nitrogen concentrations, we measured the total carbon and total nitrogen contents of OEAspAT10 and WT respectively (the cultivation process was the same as in Example 3, and the seedlings were tested after 22 days of cultivation), and calculated the nitrogen uptake efficiency (NUpE) and nitrogen conversion efficiency (NUtE). (NUpE = plant total nitrogen / nitrogen supply, NUtE = plant dry weight / nitrogen supply).

[0039] result( Figure 4 ) showed that the total carbon and total nitrogen contents of 84K at different nitrogen concentrations increased with the increase of nitrogen concentration, and at the same nitrogen concentration, the total carbon content of OEAspAT10(T4) increased by 22.15%, 8.52% and 13.79% compared with WT, and the total nitrogen content increased by 16.57%, 20.38% and 16.93%, respectively. Overall, the total carbon and total nitrogen contents of OEAspAT10 were greater than those of WT. Compared with WT at the same nitrogen concentration, the NUpE of OEAspAT10 increased by 84.06%, 51.27% and 87.62%, respectively, and the NUtE increased by 34.49%, 6.98% and 32.66%, respectively.

Claims

1. Application of aspartate aminotransferase gene AspAT10 in improving nitrogen utilization efficiency of poplar.

2. Application of aspartate aminotransferase gene AspAT10 overexpression vector in improving nitrogen utilization efficiency of poplar.

3. The use according to claim 2, characterized in that: The original vector of the aspartate aminotransferase gene AspAT10 overexpression vector is the pRI101 vector.

4. The use according to claim 2, characterized in that: The nucleotide sequences of the specific primers used to construct the overexpression vector are shown in SEQ ID NOs. 1-2.

5. The use according to any one of claims 1 or 2, characterized in that: The poplar variety is 84K poplar.

6. A method for obtaining poplar plants with high nitrogen utilization efficiency, characterized in that: The method comprises making a poplar plant contain an aspartate aminotransferase gene AspAT10 or an overexpression vector containing the gene.

7. The method according to claim 6, characterized in that The specific steps of the method include: transforming an overexpression vector containing the aspartate aminotransferase gene AspAT10 into Agrobacterium tumefaciens competent cells to obtain positive bacteria, cutting off mature and healthy leaves or stem segments of wild-type plants, scratching wounds, infecting with positive bacteria, culturing until bacteria appear on the edges of the leaves or stem segments, and then performing multiple rounds of screening using a culture medium containing antibiotics; transferring newly grown callus tissue into a differentiation culture medium for differentiation, transferring rice seedlings into a rooting culture medium after emergence, and obtaining transgenic poplar plants with high nitrogen utilization efficiency after culturing for 5 to 10 days.

8. A method for identifying poplar plants with high nitrogen utilization efficiency obtained by the method of claim 6, characterized in that: Determine whether the plant contains the aspartate aminotransferase gene AspAT10 according to claim 1.

9. The method according to claim 8, characterized in that The nucleotide sequences of the specific primers used for identification are shown in SEQ ID NOs. 3-4.

Images