Highly catalytically active IsMHETase mutants and their applications
By performing site-directed mutagenesis on IsMHETase, its catalytic activity was improved, solving the problem of low catalytic activity of existing IsMHETase, thus achieving efficient biodegradation of PET plastic and reducing degradation costs.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- UNIV OF ELECTRONICS SCI & TECH OF CHINA
- Filing Date
- 2024-09-29
- Publication Date
- 2026-04-21
AI Technical Summary
The existing IsMHETase has low catalytic activity, making it difficult to achieve efficient biodegradation of PET plastics.
By performing site-directed mutagenesis on IsMHETase, mutants with high catalytic activity were obtained. Specific mutation sites included K442A, A380Q, W397A, N134A, S286A, and S350T. Vectors were constructed and expressed in hosts such as Escherichia coli to improve the enzyme's catalytic efficiency.
The mutant IsMHETase enzyme activity increased by 1.13 to 3.20 times, significantly improving PET degradation efficiency and reducing degradation costs, thus providing a promising prospect for industrial applications.
Smart Images

Figure CN119662597B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to highly catalytically active IsMHETase mutants and their applications. Background Technology
[0002] Plastics are ubiquitous in modern society, from food packaging and building materials to automotive parts and medical devices, bringing numerous conveniences to our lives. However, this convenience is accompanied by increasingly serious environmental problems. Plastic pollution has become a global crisis, especially in the oceans, where the presence of plastic waste has a profound impact on ecosystems. Plastic debris in the ocean not only damages the underwater landscape but is also ingested by marine life, harming their health and affecting the entire food chain. On land, plastic accumulation also causes numerous problems, affecting the aesthetics of urban and rural environments and polluting soil and water resources. The long-term presence of plastics makes these wastes a persistent environmental problem, difficult to degrade naturally, leading to ecosystem destruction and biodiversity loss.
[0003] The accumulation of plastic is extremely harmful. Accumulated plastic waste not only affects the natural beauty of the environment but also poses a threat to flora and fauna. Large amounts of plastic waste hinder the restoration of natural landscapes and may lead to habitat loss. Animals that ingest plastic may suffer from intestinal obstruction, malnutrition, or even death. For humans, harmful chemicals in plastic can enter our bodies through the food chain, and long-term exposure may lead to various health problems, including endocrine disorders and increased cancer risk.
[0004] Although plastic degradation is a natural process, the extremely slow degradation of traditional plastics often leads to long-term environmental impacts. Physical degradation breaks down plastics into fragments through ultraviolet radiation and weathering, but these fragments still pose a threat to the environment. Chemical degradation often causes secondary environmental damage. Biodegradation is currently a more ideal solution. First, the biodegradation of plastics requires less energy, produces less environmentally harmful byproducts, and is more environmentally friendly. Second, compared to traditional plastics, biodegradable plastics can accelerate decomposition through cascade reactions, significantly reducing waste accumulation in a shorter time.
[0005] PET (polyethylene terephthalate) is widely used in beverage bottles, food packaging, and fiber materials due to its excellent mechanical strength, chemical resistance, and transparency. However, the long-term stability and durability of PET make it difficult to degrade in the environment, leading to a growing problem of plastic waste. To address this issue, researchers are seeking effective methods to accelerate the degradation process of PET. Recently, PETase and MHETase from *Ideonella sakaiensis* have been found to effectively degrade PET. In particular, IsMHETase can catalyze the degradation of MHET (CAS No. 959-26-2, mono-(2-hydroxyethyl)terephthalate). MHET is an important intermediate product in the PET degradation process; its accumulation leads to intermediate product inhibition, which is one of the rate-limiting steps for further degradation. MHETase accelerates the final stage of PET degradation, weakening the inhibition of PET degradation intermediate products. This discovery provides important insights for developing new plastic degradation technologies and opens up new avenues for solving the plastic pollution problem. By utilizing biodegrading enzymes such as MHETase, we can expect to improve the degradation efficiency of PET, reduce the negative environmental impact of plastic waste, and thus promote the process of plastic recycling and resource reuse.
[0006] Although ISMHETase can degrade MHET, its enzyme activity is still relatively low, making it difficult to directly achieve the industrial application of MHET biodegradation. Summary of the Invention
[0007] The technical problem to be solved by the present invention is that the existing ISMHETase has low activity.
[0008] The technical solution of the present invention is a highly catalytically active IsMHETase mutant, which is a protein obtained by mutating the IsMHETase amino acid sequence as shown in SEQ ID No. 1.
[0009] Specifically, the mutation sites are amino acids 134, 286, 350, 380, 397, or / and 442.
[0010] Preferably, the mutation sites are K442A, A380Q, W397A, N134A, S286A and / or S350T.
[0011] The present invention also provides a coding gene encoding the aforementioned IsMHETase mutant.
[0012] Specifically, the gene encoding the mutant with the mutation site K442A is shown in SEQ ID No. 7.
[0013] Specifically, the gene encoding the mutant with the mutation site A380Q is shown in SEQ ID No. 4.
[0014] Specifically, the gene encoding the mutant with the mutation site W397A is shown in SEQ ID No. 5.
[0015] Specifically, the gene encoding the mutant with the mutation site N134A is shown in SEQ ID No. 2.
[0016] Specifically, the gene encoding the mutant with the mutation site S286A is shown in SEQ ID No. 10.
[0017] Specifically, the gene encoding the mutant with the mutation site S350T is shown in SEQ ID No. 3.
[0018] The present invention also provides an expression element, vector, or host containing the above-mentioned IsMHETase mutant or encoding gene.
[0019] Specifically, the vector is a plasmid vector or a viral vector.
[0020] Furthermore, the host is a protein expression host such as Escherichia coli, Bacillus, Streptomyces, cyanobacteria, or engineered yeast.
[0021] Specifically, the Escherichia coli is EPI400, BL21(DE3), Top10, or DH5α.
[0022] Furthermore, the present invention also provides the application of the IsMHETase mutant, the coding gene encoding the IsMHETase mutant, the expression element containing the IsMHETase mutant or its coding gene, the vector, or the host in the degradation of plastics.
[0023] Specifically, the plastic is PET (polyethylene terephthalate).
[0024] The present invention also provides a product for degrading plastics, the main active ingredient of which is the IsMHETase mutant, the coding gene encoding the IsMHETase mutant, an expression element containing the IsMHETase mutant or the coding gene, a vector or a host.
[0025] Specifically, the plastic is PET (polyethylene terephthalate).
[0026] The present invention also provides the application of the IsMHETase mutant, the coding gene encoding the IsMHETase mutant, the expression element containing the IsMHETase mutant or the coding gene, the vector or the host in the degradation of MHET.
[0027] The present invention also provides a product for degrading MHET, the main active ingredient of which is the IsMHETase mutant, the coding gene encoding the IsMHETase mutant, the expression element containing the IsMHETase mutant or the coding gene, the vector or the host.
[0028] The beneficial effects of this invention are as follows: This invention, through molecular structure evolution, site-directed mutagenesis, protein structure prediction, high-throughput molecular docking, and preliminary virtual screening of mutants derived from the key enzyme IsMHETase in the previously constructed genetically engineered E. coli capable of degrading MHET, identified 34 mutation hotspots. Further screening using molecular dynamics analysis yielded 9 mutants (N134A, S350T, A380Q, W397A, W397E, K442A, R116N, R318A, and S286A). Among these, 6 mutants (N134A, S350T, A380Q, W397A, W397E, and K442A) exhibited enzyme activities 1.13–3.20 times higher than the wild-type IsMHETase. The IsMHETase mutants obtained by this invention possess higher enzyme activity, making them more efficient in the biodegradation of MHET small molecules, simplifying the degradation steps, reducing degradation costs, and providing broad prospects for their industrial application. Attached Figure Description
[0029] Figure 1 The confidence results of AlphaFold3 prediction for MHETase are shown in Figure A. The Predicted Local Distance Difference Test (pLDDT) image is a graph used to represent the accuracy of protein structure prediction. This type of graph is often associated with model evaluation and visualization in protein structure prediction. The main purpose of the pLDDT image is to assess the confidence and reliability of each amino acid residue position in the protein structure prediction. Figure B shows the Prediction Alignment Error (PAE) graph. Each point represents an amino acid residue, with the horizontal axis representing the position in the protein sequence and the vertical axis representing the AlphaFold3 structure prediction error. Lower PAE values indicate more accurate structure predictions.
[0030] Figure 2 A histogram of affinity for wild-type and some mutants, with the horizontal axis representing wild-type and mutant types and the vertical axis representing affinity after molecular docking.
[0031] Figure 3Agarose gel electrophoresis of the PCR product of the IsMHETase mutant designed in this invention.
[0032] Figure 4 A graph showing the MHET degradation effects of wild-type and different IsMHETase mutants. The horizontal axis represents the mutant type, and the vertical axis represents enzyme activity.
[0033] Figure 5 A visualization of the docking results of the three mutants with the highest enzyme activity. Detailed Implementation
[0034] To obtain a more active IsMHETase, the applicant chose to use genetic engineering techniques to modify the gene.
[0035] The applicant chose point mutation as the approach. First, an open-source molecular evolutionary model was used to analyze MHETase. This model is an unsupervised algorithm that combines protein structural information with a protein language model. This algorithm provided optimization suggestions for the top 33 sites. Then, a bioinformatics platform was used to analyze the amino acid sequences of the mutants resulting from single-point mutations of each of the 33 amino acids, predicting their 3D structures. After docking with MHETase and ranking by affinity, candidate mutation sites were obtained and constructed into vectors. These vectors were then transformed into *E. coli*. By detecting the activity of IsMHETase in the fermentation products, the mutations that increased enzyme activity were identified.
[0036] The present invention will be described in detail below with reference to specific embodiments in order to better understand the present invention, but the scope of protection of the present invention is not limited to the following description.
[0037] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0038] The culture medium formulation involved in the examples is as follows: LB liquid medium (1L) contains: 5g yeast extract, 10g tryptone, 10g NaCl, pH 7.0. The improvement in enzyme catalytic activity can be expressed in specific enzyme activity units (μmol / mg / min, the number of moles of substrate converted to product per milligram of enzyme molecule catalyzed by the enzyme's catalytic active site per unit time). Therefore, an increase in specific enzyme activity represents an increase in enzyme catalytic activity.
[0039] Example 1: Determination of Mutation Hotspots of IsMHETase
[0040] 1. Mutation site prediction
[0041] The prediction is based on a protein modification model published in Science in July 2024. Paper link: https: / / www.science.org / doi / 10.1126 / science.adk8946; Open source code: https: / / github.com / varun-shanker / structural-evolution.
[0042] After setting up the model running environment according to the instructions, input the amino acid sequence of MHETase into the ESM-IF1 structure-enhanced protein language model. Driven by the MHETase structure information, the protein language model can effectively guide the evolution of MHETase enzyme through amino acid sequence and protein structure information. The suggested mutation sites and mutation directions are shown in Table 1.
[0043] Table 1 suggests mutation sites and directions.
[0044] S235A H293E M192F K437A W453Y Y197I H467A S196A A181S W466V R411M A553L W397E W397A N134A V341A M433A A119V K256R A310V A380Q T638D D555S S350T A139D S260Q R318A R375S R116N Q458A N195L S286A W397A
[0045] 2. IsMHETase 3D Model Construction
[0046] The amino acid sequence of MHETase (UniProtKB: A0A0K8P8E7) was obtained. The Alphafold3 model was run on Google DeepMind's AlphaFold Server, and the model with the best PLDDT value was used for subsequent docking experiments. Alphafold prediction results are as follows: Figure 1 A pLDDT (Per-Residue Local Distance Difference Test) value close to or greater than 90 at the first 550 or more positions of the protein sequence indicates a highly reliable structure prediction. The PAE (Per-Residue Absolute Error) for the optimal conformation of MHETase is also relevant. Figure 1 All green areas represent protein structures with very small prediction errors, close to zero. This means that AlphaFold3's prediction of the IsMHETase protein structure is very accurate in most positions. The prediction also received a pTm score of 0.97 (prediction template modeling score), which is higher than 0.5, indicating that the overall predicted folding of the complex is likely similar to the actual structure, reflecting high accuracy across the entire structure.
[0047] 3. Screening of mutation hotspots
[0048] All sequences (33 in total) of MHETase after 33 single-point directed amino acid mutations were input, and homology modeling was performed using the wild-type MHETase structure predicted by AlphaFold3 as a template to obtain the 3D structures of the 33 mutants for subsequent experiments.
[0049] Using Autodock and Autodock Vina software, the MHET small molecule (CID:22062452) was docked with each mutant structure as a small molecule substrate. The affinity was ranked, and the top 4 optimal mutants were obtained: N134A, S350T, A380Q, W397A, W397E, K442A, R116N, R318A, and S286A, which are abbreviated as R116N, N134A, R318A, S350T, and K442A respectively. Figure 2 This is a bar chart showing the affinity of wild-type, the optimal mutant, and the remaining mutants; illustrating the affinity of wild-type and different IsMHETase mutants for the substrate MHET molecule. All the mutants we selected exhibited a significant advantage in affinity, with all other selected mutants showing higher affinity than the wild-type (WT) at -1.668 kcal / mol.
[0050] Example 2 Construction of mutants
[0051] Using PCR technology, a specific nucleotide sequence was successfully introduced into the NusA-MHETase-Pcold recombinant DNA vector previously synthesized via gene synthesis (mutation primers are shown in Table 2), achieving site-directed mutagenesis (primer synthesis services were provided by Shanghai Sangon Biotech Co., Ltd.). The site-directed mutagenesis results are shown below. Figure 3 As shown, the results indicate that the coding sequence of the mutated protein was obtained.
[0052] The specific conditions for this PCR amplification process are as follows: pre-denaturation at 94℃ for 2 minutes, followed by 35 cycles, each cycle consisting of 10 seconds at 98℃, 2 minutes and 30 seconds at 62℃, and 2 minutes at 72℃. After amplification, a final extension is performed at 72℃ for 10 minutes.
[0053] Table 2. All primers used for site-directed mutagenesis.
[0054]
[0055]
[0056] Sequencing confirmed that the target mutation site had been successfully introduced into the NusA-MHETase-Pcold recombinant DNA vector. This vector was transformed into *E. coli* ST7 competent cells and cultured on LB agar plates containing 100 μg / mL ampicillin at 37°C for 12 hours, successfully yielding positive clones.
[0057] To obtain more mutant vectors, transformants were expanded in liquid LB medium, resulting in the successful construction of nine different NusA-MHETase-Pcold genetically engineered Escherichia coli mutants.
[0058] The mutants mentioned above were named N134A, S350T, A380Q, W397A, W397E, K442A, R116N, R318A, and S286A, respectively. The nucleotide sequences of the mutated MHETase gene are listed below:
[0059] SEQ ID No. 1 Wild-type MHETase amino acid sequence
[0060] MQTTVTTMLLASVALAACAGGGSTPLPLPQQQPPQQEPPPPPVPLASRAACEALKDGNGDMVWPNAATVVEVAAWRDAAPATASAAALPEHCEVSGAIAKRTGIDGYPYEIKFRLRMPAEWNGRFFMEGGSGTNGSLSAATGSIGGGQIASALSRNFATIATDGGHDNAVNDNPDALGTVAFGLDPQARLDMGYNSYDQVTQAGKAAVARFYGRAADKSYFIGCSEGGREGMMLSQRFPSHYDGIVAGAPGYQLPKAGISGAWTTQSLAPAAVGLDAQGVPLINKSFSDADLHLLSQAILGTCDALDGLADGIVDNYRACQAAFDPATAANPANGQALQCVGAKTADCLSPVQVTAIKRAMAGPVNSAGTPLYNRWAWDAGMSGLSGTTYNQGWRSWWLGSFNSSANNAQRVSGFSARSWLVDFATPPEPMPMTQVAARMMKFDFDIDPLKIWATSGQFTQSSMDWHGATSTDLAAFRDRGGKMILYHGMSDAAFSALDTADYYERLGAAMPGAAGFARLFLVPGMNHCSGGPGTDRFDMLTPLVAWVERGEAPDQISAWSGTPGYFGVAARTRPLCPYPQIARYKGSGDINTEANFACAAPP
[0061] The nucleotide after the N134A mutation of SEQ ID No.2
[0062]
[0063] Nucleotides following the SEQ ID No. 3S350T mutation
[0064]
[0065] Nucleotides following the SEQ ID No. 4A380Q mutation
[0066]
[0067] Nucleotides following the SEQ ID No. 5W397A mutation
[0068]
[0069] Nucleotides following the SEQ ID No. 6W397E mutation
[0070]
[0071] Nucleotides following the SEQ ID No. 7K442A mutation
[0072]
[0073] Nucleotides following the SEQ ID No. 8R116N mutation
[0074]
[0075] Nucleotides following the SEQ ID No. 9R318A mutation
[0076]
[0077] Nucleotide after SEQ ID No.10 S286A mutation
[0078] ATGCAGACCACCGTGACCACCATGCTGCTGGCGAGCGTTGCGCTGGCGGCGTGCGCGGGTGGCGGTA
[0079] GCACCCCGCTGCCGCTGCCGCAGCAACAGCCGCCGCAACAGGAGCCGCCGCCGCCGCCGGTGCCGC
[0080] TGGCGAGCCGTGCGGCGTGCGAAGCGCTGAAGGATGGTAACGGTGACATGGTGTGGCCGAACGCGG
[0081] CGACCGTGGTTGAGGTTGCGGCGTGGCGTGATGCGGCGCCGGCGACCGCGAGCGCGGCGGCGCTGC
[0082] CGGAGCACTGCGAAGTTAGCGGTGCGATCGCGAAGCGTACCGGTATTGACGGCTACCCGTATGAAATC
[0083] AAATTTCGTCTGCGTATGCCGGCGGAGTGGAACGGTCGTTTCTTTATGGAAGGCGGTAGCGGTACCAA
[0084] CGGCAGCCTGAGCGCGGCGACCGGTAGCATCGGCGGTGGCCAAATTGCGAGCGCGCTGAGCCGTAA
[0085] CTTTGCGACCATTGCGACCGATGGTGGCCACGACAACGCGGTGAACGATAACCCGGACGCGCTGGGT
[0086] ACCGTTGCGTTCGGCCTGGATCCGCAGGCGCGTCTGGACATGGGTTACAACAGCTATGATCAAGTGAC
[0087] CCAGGCGGGCAAGGCGGCGGTTGCGCGTTTCTACGGTCGTGCGGCGGACAAAAGCTATTTTATCGGT
[0088] TGCAGCGAGGGTGGCCGTGAAGGCATGATGCTGAGCCAACGTTTCCCGAGCCACTACGATGGTATCG
[0089] TGGCGGGTGCGCCGGGTTATCAGCTGCCGAAGGCGGGTATTAGCGGCGCGTGGACCACCCAAAGCCT
[0090] GGCGCCGGCGGCGGTGGGTCTGGACGCGCAGGGCGTTCCGCTGATTAACAAAgcgTTTAGCGACGCG
[0091] GATCTGCACCTGCTGAGCCAAGCGATCCTGGGTACCTGCGATGCGCTGGACGGTCTGGCGGATGGCAT
[0092] TGTTGACAACTACCGTGCGTGCCAGGCGGCGTTCGATCCGGCGACCGCGGCGAACCCGGCGAACGGT
[0093] CAAGCGCTGCAATGCGTGGGTGCGAAGACCGCGGACTGCCTGAGCCCGGTGCAAGTTACCGCGATCA
[0094] AACGTGCGATGGCGGGTCCGGTTAACAGCGCGGGCACCCCGCTGTACAACCGTTGGGCGTGGGATGC
[0095] GGGTATGAGCGGCCTGAGCGGTACCACCTATAACCAAGGTTGGCGTTCCTGGTGGCTGGGCAGCTTTA
[0096] ACAGCAGCGCGAACAACGCGCAGCGTGTGAGCGGTTTCAGCGCGCGTAGCTGGCTGGTTGACTTTGC
[0097] GACCCCGCCGGAGCCGATGCCGATGACCCAGGTGGCGGCGCGTATGATGAAGTTCGACTTTGATATCG
[0098] ACCCGCTGAAAATTTGGGCGACCAGCGGTCAATTCACCCAGAGCAGCATGGATTGGCACGGTGCGAC
[0099] CAGCACCGATCTGGCGGCGTTTCGTGACCGTGGTGGCAAGATGATCCTGTACCACGGTATGAGCGAC
[0100] GCGGCGTTCAGCGCGCTGGATACCGCGGACTACTATGAACGTCTGGGTGCGGCGATGCCGGGTGCGG
[0101] CGGGTTTCGCGCGTCTGTTTCTGGTGCCGGGTATGAACCATTGCAGCGGTGGTCCGGGCACCGATCGT
[0102] TTTGACATGCTGACCCCGCTGGTTGCGTGGGTTGAGCGTGGTGAAGCGCCGGATCAAATTAGCGCGT
[0103] GGAGCGGCACCCCGGGTTATTTCGGTGTTGCGGCGCGTACCCGTCCGCTGTGCCCGTACCCGCAGATC
[0104] Example 3 Evaluation of IsMHETase Recombinant Expression Activity
[0105] Induction of Expression: In this embodiment, a single clone containing the pPET30a-IsMHETase gene from the *E. coli* mutant was first selected and inoculated into LB liquid medium at a ratio of 1:1000. The medium was cultured at 37°C and 180 rpm in a shaker until the OD600 value reached 0.6-0.8. Subsequently, 0.5 mM of isopropyl-β-D-thiogalactoside (IPTG) was added to the medium to achieve a final concentration of 0.1 mM, and the medium was further cultured at 16°C and 180 rpm for 18 hours. After culture, the bacterial cells were collected by centrifugation and resuspended in PBS buffer (pH 7.4) for subsequent experimental procedures. This step ensured efficient induction of the target protein expression, and each treatment was performed in triplicate to ensure the reliability of the results.
[0106] MHET stock solution preparation: To conduct subsequent activity evaluation experiments, 10 mg of MHET was accurately weighed and dissolved in 1 mL of dimethyl sulfoxide (DMSO) to prepare a 40 mM MHET stock solution. This step provides a standardized substrate concentration for subsequent enzyme activity evaluation.
[0107] Ultrasonic lysis: Transfer the bacterial culture to be lysed to a 50mL beaker, ensuring the total volume is between 20 and 50mL. To maintain a low temperature and prevent protein inactivation, place the beaker in a larger beaker containing ice. Use an ultrasonic lysator to perform lysis, setting the power to 170–190W, ensuring the liquid surface does not vigorously agitate or bubble. Operate for 1 second, pause for 3 seconds, for a total duration of 40 minutes. During lysis, lysis is considered complete when the liquid viscosity significantly decreases and becomes clear. If the desired effect is not achieved, the lysis time can be extended by 5–10 minutes. This step aims to physically disrupt the cell structure, releasing intracellular proteins to prepare for subsequent purification steps.
[0108] Purification: Remove the pre-cooled nickel column from 4°C and fix it vertically above an Erlenmeyer flask. Open both the top and bottom ports of the column to allow the ethanol solution inside to drain naturally. Equilibrate with 1x PBS buffer, repeating twice to ensure column equilibration. Next, prepare a 10mM imidazole solution for further equilibration of the nickel column. Add the sample supernatant to the nickel column and incubate on ice for 45 minutes to promote sufficient contact between nickel ions and the sample. Then, wash with 30mM imidazole buffer, controlling the flow rate to ensure thorough removal of impurities. Finally, prepare a 300mM imidazole solution for protein elution and collect the eluted protein solution. Rinse the nickel column with 1×PBS buffer until all impurities are removed. Close the bottom port of the nickel column, add 20% ethanol solution for storage, and store at 4°C. This step achieves efficient purification of the target protein using affinity chromatography.
[0109] Degradation: In this step, the protein concentration was first determined using Coomassie Brilliant Blue solution. The total volume of the degradation system was 800 μL, to which 20 μL of 40 mM MHET stock solution was added to bring the MHET concentration to 2 mM. Then, 100 mM of purified protein sample was added to bring the protein concentration to 100 nM, and the remaining volume was made up with PBS. Degradation was carried out at 30°C for 30 minutes, followed by inactivation at 90°C for 15 minutes.
[0110] High-performance liquid chromatography (HPLC) analysis: HPLC analysis was performed using a Waters E2695 chromatographic system equipped with a Shim-pack GIS column. The mobile phase consisted of a mixture of methanol and acetonitrile, with a flow rate set at 0.5 mL / min and a detection wavelength of 254 nm. During the chromatographic analysis, gradient elution was initially performed using 95% formic acid and 5% acetonitrile over a period of 0 to 2 minutes. Subsequently, linear gradient elution was performed, increasing the acetonitrile concentration to 20% over 2 to 14 minutes while maintaining an 80% formic acid concentration. The system was reequilibrated to initial conditions over a period of 14 to 15 minutes. Gradient pump mode was used throughout the chromatographic run. The amount of product from each PET hydrolysis reaction was determined by measuring the total peak area of MHET. This step accurately analyzed the degradation products of IsMHETase using HPLC, thereby evaluating its recombinant expression activity.
[0111] After verification by the above experiments, the degradation effects of all mutants are as follows: Figure 4 As shown in Table 3, after single-point mutations at mutation hotspots in the wild-type (WT) enzyme, a series of mutants, such as K442A, A380Q, W397A, N134A, S286A, and S350T, exhibited higher enzyme activity than the wild-type (WT). This phenomenon may be attributed to the positive influence of these mutation sites on the microenvironment of the enzyme's active site or the overall enzyme conformation, thereby optimizing the enzyme-substrate interaction. However, not all mutations brought positive effects; mutants W397T, R318A, and R116N showed lower enzyme activity compared to the wild-type (WT), which may be due to the adverse effects of these mutations on enzyme stability or substrate binding ability. As shown in Table 3, the activities of these mutants were increased by approximately 1.12 to 3.2 times compared to the wild-type. This significant improvement indicates that carefully designed single-point mutations can effectively enhance the catalytic efficiency of enzymes. This targeted optimization strategy can not only improve the performance of enzymes in specific industrial applications but also contribute to a deeper understanding of the molecular mechanisms regulating enzyme activity. Figure 5 As shown, three mutants with the highest enzyme activity were selected for visualization after molecular docking to further explore the enhancing effects of these mutations on enzyme activity. This analysis allows for a direct observation of the interaction between the mutation site and the substrate binding pocket, and how these interactions affect the overall conformation and function of the enzyme. These findings provide valuable information for future enzyme engineering, contributing to the design of more efficient and stable biocatalysts to meet the needs of industrial production.
[0112] Table 3
[0113] name amino acid mutation sites IU / mL multiple WT - 17.4333 1 K442A Lys442Ala 55.5567 3.19 A380Q Ala380Gln 45.8500 2.63 W397A Trp397Ala 39.0967 2.24 N134A Asn134Ala 25.8867 1.48 S286A Ser286Ala 20.4333 1.17 S350T Ser350Thr 19.9087 1.14 W397E Trp397Glu 15.7100 0.90 R318A Arg318Ala 14.6933 0.84 R116N Arg116Asn 11.3887 0.65
Claims
1. A highly catalytically active IsMHETase mutant, characterized in that: The mutant is a protein obtained by mutating IsMHETase, whose amino acid sequence is shown in SEQ ID No. 1; the mutation site is K442A.
2. The encoding gene of the IsMHETase mutant according to claim 1.
3. The encoding gene according to claim 2, characterized in that: The gene encoding the mutant with the mutation site K442A is shown in SEQ ID No.
7.
4. An expression element, vector, or host containing the encoding gene of claim 2 or 3; wherein the vector is a plasmid vector or a viral vector; and the host is a protein expression host such as Escherichia coli, Bacillus, Streptomyces, cyanobacteria, or engineered yeast.
5. The expression element, vector, or host according to claim 4, characterized in that... The Escherichia coli strain is EPI400, BL21(DE3), Top10, or DH5α.
6. The use of the IsMHETase mutant of claim 1, the encoding gene of the IsMHETase mutant of any one of claims 2 or 3, the expression element of any one of claims 4 or 5, the vector or the host in the degradation of MHET.
Citation Information
Patent Citations
PET degrading enzyme PET-mh183 / 208 mutant as well as coding gene, engineering bacterium and application thereof
CN117448297A
PET plastic degrading enzyme BMHETase mutant and application thereof
CN118222523A