Salt-tolerant xylanase and application thereof

Abstract

The application discloses a salt-tolerant xylanase and application, and relates to the technical field of biology. The amino acid sequence of the salt-tolerant xylanase is shown as SEQ ID NO:1. A new xylanase gene xynaes is separated from the macro-genome of the Aiding Lake in Xinjiang, the xylanase belongs to the GH10 family and has low homology with the reported xylanases. The recombinant xylanase has high activity and tolerance at high temperature and performs well in an alkaline environment, has high tolerance to various metal ions, but loses activity rapidly under SDS treatment, and should be avoided from contacting with SDS in industrial production.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically to a salt-tolerant xylanase and its applications. Background Technology

[0002] Lignocellulose is the most abundant renewable biomass on Earth, producing 100 billion tons annually through photosynthesis. Its main components are cellulose, hemicellulose, and lignin, along with small amounts of pectin, etc. (Kumar et al., 2009). Hemicellulose is the second most abundant polysaccharide in nature after cellulose, accounting for about one-third of all renewable organic carbon on Earth. Xylan, a major component of hemicellulose, is widely found in plant cell walls (Uday et al., 2016). It is a heteropolysaccharide composed of xylose monomers linked by β-1,4-glycosidic bonds, characterized by its complex structure and slow natural degradation. Xylanase breaks down hemicellulose by completely hydrolyzing the linear polysaccharide β-1,4-xylan into simpler compounds mainly composed of xylose (Aglaia et al., 2016), and is a complex enzyme system. It includes β-1,4-endoxylanase, β-xylosidase, α-L-arabinosidase, α-D-glucuronidase, acetylxylanase, and phenolic esterase, which catalyze the hydrolysis of xylosidic bonds. It can degrade xylan hemicellulose, which is abundant in nature. Among this hydrolytic enzyme system, β-1,4-endoxylanase is the most crucial hydrolytic enzyme, mainly hydrolyzing xylan molecules by breaking down β-1,4-glycosidic bonds into small oligosaccharides and xylobiose, as well as small amounts of xylose and arabinose.

[0003] Numerous studies have reported the production of xylanases by fungi, bacteria, yeast, algae (Mandal, 2015), seeds, crustaceans, and snails (Polizeli et al, 2005), with fungi and bacteria being the primary sources. The different sources result in xylanases with varying properties, leading to different potential uses for them.

[0004] Microbial xylanases have garnered significant attention due to their potential applications in industrial processes such as food, feed, and pulp and paper manufacturing. They demonstrate great potential in the most economical way to enhance the production of products such as SCPs, enzymes, liquid or gaseous fuels, solvents, and syrups, which can be used directly as industrial feedstocks or as raw materials for other microbial processes (Kuhad and Singh, 1993). Consequently, the xylanase market has experienced significant global growth in recent years (Aglaia et al., 2016) and is considered "one of the most important enzymes in industry" (Dhiman et al., 2008).

[0005] The specific application requirements of xylanases, such as high temperature and high pressure, have made the discovery of xylanases in extreme environments a major research focus. Currently, many extremophilic xylanases have been isolated, particularly from thermophilic, alkaliphilic, and acidphilic bacteria. However, pure culture of microorganisms in extreme environments is difficult, a problem that metagenomics has effectively solved. Metagenomics can directly obtain the nucleotide sequences of most genes from environmental DNA, without being limited by culture techniques, thus enabling the analysis of microbial genetic information and the screening of functional genes (Tansirichaiya et al., 2023). Therefore, metagenomics has significant advantages in extracting thermophilic xylanases from uncultured microorganisms in extreme environments (Montella et al., 2015).

[0006] This invention utilizes metagenomics technology to obtain a novel GH10 family xylanase gene, xynaes, from Ayding Lake in Xinjiang. The gene sequence was introduced into *E. coli* (DH5α) for cloning and heterologous expression. The recombinant xylanase (XynAES) was isolated and purified using Ni-NTA affinity chromatography, and its enzymatic properties were studied using xylan as a substrate. The results show that XynAES is a thermophilic, alkaliphilic, and salt-tolerant xylanase, suggesting its potential wide-ranging applications in feed processing, food production, pulp and paper manufacturing, and prebiotic production. Summary of the Invention

[0007] In view of this, the present invention provides a salt-tolerant xylanase and its application.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] A salt-tolerant xylanase, the amino acid sequence of which is shown in SEQ ID NO: 1.

[0010] A DNA molecule encoding a salt-tolerant xylanase, the nucleotide sequence of which is shown in SEQ ID NO: 2.

[0011] A recombinant vector comprising the DNA molecule of claim 2 and a regulatory sequence for expression operably linked to the DNA molecule.

[0012] The host cell includes the DNA molecule or the recombinant vector of claim 3.

[0013] Application of a salt-tolerant xylanase in the degradation of cellulose.

[0014] As can be seen from the above technical solution, compared with the prior art, the beneficial effects of the present invention are as follows:

[0015] This invention isolated a novel xylanase gene, xynaes, from the metagenomic genome of Ayding Lake in Xinjiang. This xylanase belongs to the GH10 family and has low homology with previously reported xylanases. The recombinant xylanase exhibits high activity and tolerance at high temperatures and performs well in alkaline environments. It also shows high tolerance to various metal ions, but rapidly loses activity under SDS treatment; therefore, contact with SDS should be avoided in industrial production. The hydrolysis products of xylans from various sources by XynAES are all xylanbiose and xylantetraose, indicating that this enzyme is a strictly endo-xylanase and is almost unaffected by xylan branching. The fixed hydrolysis products are beneficial for the production of prebiotics using xylooligosaccharides. In summary, XynAES can be considered a heat- and alkali-resistant xylanase with high catalytic efficiency. This enzyme may have wide applications in the industrial use of hemicellulose, detergent additives, and feed additives. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0017] Figure 1 This is a sequence and structural analysis diagram of the recombinant xylanase XynAES of the present invention; Figure 1 The left side shows the phylogenetic tree diagram obtained from the maximum likelihood analysis based on the amino acid sequence, which shows the phylogenetic position of XynAES and related xylanases, with the guide value (expressed as a percentage of 1000 replications) given at the node; Figure 1 The right side shows the predicted structure of xylanase XynAES;

[0018] Figure 2 This is an SDS-PAGE electrophoresis image of the recombinant xylanase XynAES of the present invention; Lane 1, protein molecular weight label, the left side indicates mass; Lane 2, total protein of E. coli DH5α / pSHY211-XynAES; Lane 3, purified XynAES;

[0019] Figure 3 The graph shows the effect of temperature and pH on the activity and stability of recombinant XynAES. Figure 3 A represents the effect of temperature on the activity of XynAES. Figure 3 B represents the effect of pH on the activity of XynAES. Figure 3 C represents the effect of temperature on stability. Figure 3 D represents the effect of pH on stability;

[0020] Figure 4 The graph shows the effect of NaCl on the activity of recombinant xylanase XynAES. Figure 4 A represents the relative activity of XynAES at different NaCl concentrations; Figure 4 B represents the residual activity of XynAES after one week of incubation at different salinities;

[0021] Figure 5 This is a TLC chromatogram of the recombinant xylanase XynAES of the present invention on the xylan hydrolysis products. Lane 1: Xylo-oligosaccharide (X2, X3, and X4) standards; Lane 2: 1% beech xylan reaction solution without recombinant XynAES; Lane 3: Reaction solution containing recombinant XynAES and 1% beech xylan; Lane 4: 1% corn cob xylan reaction solution without recombinant XynAES; Lane 5: Reaction solution containing recombinant XynAES and 1% corn cob xylan. Detailed Implementation

[0022] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0023] Example 1

[0024] 1. Materials and Methods

[0025] 1.1 Sample collection and metagenomic sequencing

[0026] Soil samples were collected from Ayding Lake, Qiatkale Township, Gaochang District, Turpan City, Xinjiang Uygur Autonomous Region, China, at coordinates: latitude 42.6704°N, longitude 89.2564°E. Samples were rapidly frozen on dry ice for laboratory metagenomic DNA extraction. DNA was isolated using a metagenomic extraction kit (MOBIO dnasy PowerSoil Kit, USA) according to the instruction manual. A HiSeq 2500GENWI instrument was used for metagenomic sequencing. De novo assembly was performed using the elvet assembly program version (Zerbino & Birney, 2008). The IMG database (https: / / img.jgi.doe.gov / cgi-bin / mer / main.cgi) was used for sequence lookup and analysis. The potential functions of individual genes and open reading frames (ORFs) were analyzed using the COG (Tatusov, 2001), KEGG (Nakaya et al., 2012), and Pfam (Finn et al., 2007) databases.

[0027] 1.2 Xylanase sequence prediction, gene synthesis, and sequence analysis

[0028] Based on functional prediction, a novel functional gene sequence (named xynaes) embodying xylanase was screened from the Ayding Lake metagenomic database. The nucleotide sequence of the xylanase gene (xynaes) has been uploaded to GenBank. The BLASTx and BLASTp programs (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) were used to align the DNA and protein sequences of xynaes, respectively. SignalP (http: / / www.cbs.dtu.dk / Services / SignalP / ) was used to predict the signal peptide. The primary structure of the amino acid sequence was inferred and analyzed using EXPASY (http: / / web.expasy.org / protparam / ). MEGA 11 software was used for phylogenetic analysis of the xylanase gene (xynaes), and a phylogenetic tree was constructed using the maximum likelihood (ML) method with a Poisson regression model.

[0029] XynAES sequence analysis results

[0030] A similar search for xylanases in the overall sequence revealed a new candidate xylanase gene sequence, named xynaes. Nucleotide sequence analysis of the xynaes gene showed an ORF length of 1095 bp, encoding a xylanase protein of 364 amino acid residues, but no signal peptide sequence was found.

[0031] The xylanase gene DNA sequence (1095 bp) is shown in SEQ ID NO: 1;

[0032]

[0033] The amino acid sequence (364 residues) of xylanase XynASE is shown in SEQ ID NO: 2;

[0034] MWSGCNQASEAPPEKEEIPVLKEVFKDAFLIGAALNRSQISGEDVHGVELVKRQYNTITPENILKWENVHPEPDRYDFEAADRYVQFGEENGMFIVGHTLVWHNQTPDWVFLDDDGNRLEREGLLERMREHIHTVVGRYKGRIHGWDVVNEALNDDGSLRQTRWLETIGDDYISKAFEFAREA DPDAELYYNDYSLENPEKRNGAVELIQKLQNDGVPVTGVGTQGHFSLDWPSLEEVEATITAFADLGIDVMVTELDIDVLPPVSEGQGADISFNTEPADSLNPYTGGLPDSVQQTLAQRYKDLFGIYNKHHDVIKRITFWGVSDGDSWKNNWPVRGRTNYPLLFDRNHQPKPAFYSVIEIPE-;

[0035] The theoretically calculated molecular size of the recombinant protein XynAES is 41.50 kDa, and the theoretical pI is 4.64. The amino acid sequence homology of XynAES with other xylanases was 74.45%, 67.94%, 64.07%, and 66.67%, respectively, derived from endo-1,4-beta-xylanase of Balneolaceae bacteriu (NCBI accession NO.: MDX1641403.1); endo-1,4-beta-xylanase of Blastocatellia bacterium (NCBI accession NO.: HST22061.1); endo-1,4-beta-xylanase of Rhodothermaceae bacterium RA (NCBI accession NO.: ARA95075.1); and endo-1,4-beta-xylanase of Balneolaceae bacterium ANBcel3 (NCBI accession NO.: MDI6400537.1). Phylogenetic analysis of the protein sequences showed that XynAES clustered with endo-1,4-beta-xylanase from Balneolaceae bacterium. Figure 1 )

[0036] 1.3 Plasmids and Expression Vectors

[0037] *E. coli* DH5α was used for the cloning and expression of the xylanase gene. The plasmid pSHY211, constructed in the laboratory, was used. This constitutive expression plasmid was constructed by adding a DNA fragment containing the GH11 endonuclease gene promoter to pET28a (Yin et al., 2023). pSHY211-xynaes was used for heterologous expression of the xylanase gene. *E. coli* was grown on LB medium containing 50 μg / mL kanamycin. DNA isolation and purification kits were purchased from Sangon (China).

[0038] 1.4 Cloning, expression, and purification of the xynaes gene

[0039] Design primers based on nucleotide sequences:

[0040] xynaes-F: CAAATGGGTCGCGGATCCGAA ATGTGGTCAGGATGCAAT CAAG, as shown in SEQ ID NO: 3;

[0041] xynaes-R: GTGCTCGAGTGCGGCCGCAAG TTATTCAGGAATTTCAAT TACAG, as shown in SEQ ID NO: 4;

[0042] The full-length xylanase gene was amplified.

[0043] The underlined sequence represents the homologous recombination fragment of the pSHY211 vector digested with EcoRI and HindIII. PCR was performed using TransStarFastPfu DNA polymerase (TransGenBiotech, China). The PCR program consisted of 10 cycles: 95°C pre-denaturation for 3 min, followed by 10 cycles of denaturation at 98°C for 20 s and annealing at 68°C for 2.5 min; then 29 cycles of denaturation at 98°C for 20 s, 55°C for 30 s, and 72°C for 2.5 min; and finally, extension at 72°C for 10 min. The PCR product was inserted into pSHY211 using the pEASY-Uni Cloning and Assembly Kit (TransGenBiotech, China) to obtain the expression plasmid pSHY211-xynaes. Overnight cultures of *E. coli* (DH5α) cells containing the recombinant plasmid (pSHY211-xynaes) (Thermo Fisher Scientific, Shanghai, China) were prepared. The recombinant *E. coli* DH5α cells were conjugated with pSHY211-xynaes and cultured in 200 mL LB broth containing 50 μg / mL kanamycin at 37°C with shaking at 180 rpm for 8 h, followed by 25°C with shaking at 180 rpm for 12 h. Cells were collected by centrifugation, and the lysate was collected after sonication. After centrifugation at 12000 × g, 4°C, 20 min, cell-free extracts were purified using a ni-chelate affinity column (Histrap, TransGen Biotech, China) according to the method previously reported by Yin et al. (2017) (Yin YR, Meng ZH, Hu QW 2017). The purified protein was analyzed by 12% SDS-PAGE. Protein concentration was determined using a Bradford protein assay kit (Order No. C503031, Sangon Biotech, China), with bovine serum albumin as the standard.

[0044] SDS-PAGE gel (SDS polyacrylamide gel) protein analysis results

[0045] Xylanase activity and sequencing results confirmed that the gene was successfully cloned into pHY211 C-His as a His-tag fusion protein. XynAES was isolated and purified using Ni-NTA affinity chromatography. The purified protein was analyzed by SDS-PAGE electrophoresis and stained with Coomassie brilliant blue. The results are as follows: Figure 2 As shown, there is a clear single band at 44kDa in the third lane, indicating that the enzyme has been successfully separated and its size is close to the theoretical value. It is preliminarily determined that the band is a recombinant protein product.

[0046] 1.5 Determination of the enzymatic properties of xylanase

[0047] Beech xylan (Sigma, USA) was used as a substrate, and the activity of recombinant XynAES was measured at 540 nm using a microplate reader (Yin et al., 2016). Reducing sugars were determined using the DNS (3,5-dinitrosalicylic acid) method with xylose as a standard (Miller, 1959). One unit (U) of XynAES activity is defined as the amount of enzyme that releases 1 μmol of reducing sugar per minute using 1% of the optimal xylan substrate under optimal reaction conditions.

[0048] 1.5.1 Effects of temperature and pH on xylanase activity

[0049] 1% beech xylan was prepared using citrate-disodium hydrogen phosphate buffer (pH 3.0–8.0) and glycine-sodium hydroxide buffer (pH 8.0–10.0), and the pH value of recombinant xylanase was determined. The optimal temperature was determined by measuring the activity of XynAES at different temperatures (20–80 °C) and the optimal pH. To evaluate the thermal and pH stability of XynAES, purified XynAES was incubated at different temperatures (60, 65, and 70 °C) for different times (0, 20, 40, 60, 80, 100, and 120 min) and at different pH values ​​(4, 5, 6, 7, 8, 9, 10, and 11) for different times (12 and 24 h), and the residual xylanase activity was measured.

[0050] Results of the effects of temperature and pH on XynAES activity

[0051] The optimal reaction temperature for XynAES activity is 65℃, and it retains more than 90% of its relative activity at 55-70℃. Figure 3 A). The optimal pH for XynAES activity is 8.0, and it maintains more than 65% relative activity between pH 6 and 9.0. Figure 3 B). Thermal stability analysis shows that, Figure 3 As shown in Figure C, XynAES retained 20% activity after heat treatment at 60℃ for 2 hours, 55% activity after withstanding 2 hours at 65℃, and approximately 50% activity after incubation at 70℃ for 2 hours. pH stability analysis showed... Figure 3 As shown in D, after incubation at 4℃ for 12 hours, it retained more than 60% of the relative activity at pH 5-10 and more than 80% of the relative activity at pH 6-9. After incubation at 4℃ for 24 hours, it retained more than 60% of the relative activity at pH 6-10 and more than 80% of the relative activity at pH 6-9.

[0052] 1.5.2 Effects of Metal Ions and Chemical Reagents on Enzymes

[0053] To evaluate the effects of metal ions and chemical reagents on the activity of XynAES, various metal ions (10 mM and 1 mM): KCl, MgSO4, FeCl3, CaCl2, NiSO4, CoCl2, BaCl2, MnCl2, AgNO3, Pb(NO3)2, CuSO4, ZnSO4, and AlCl3 were added to the reaction system; 1% of chemical reagents were added: SDS, Urea, MeOH (methanol), Tween 80, EDTA (ethylenediaminetetraacetic acid), DTT (Deloitte Touche Tohmatsu), PMSF (phenylmethylsulfonyl fluoride), β-Me (β-mercaptoethanol), and IPA (isopropanol). A control was determined using the same process described above, with no additives in the reaction mixture.

[0054] Results of the effects of metal ions and chemical reagents on enzyme activity

[0055] The effects of different metal ions and inhibitors on the enzyme activity of xylanase XynAES are shown in Table 1. XynAES activity was affected by Mn... 2+ Activation was achieved at 1 mM and 10 mM, reaching 113.99 ± 3.75% and 130.77 ± 1.39%, respectively. Ca removal was performed under the action of 1 mM ions. 2+ and Co 2+ Except for significant inhibition of XynAES activity, activation or minimal effect on activity was observed under the action of other ions. However, under the action of 10 mM ions, only Mn... 2+ Pb 2+ Fe 3+ Aside from significant activation, all other processes showed varying degrees of inhibition. Specifically, in 10mM Zn... 2+ and Ag + Under the influence of Co, it loses most of its activity, while 10mM Co 2+ and Ni 2+ SDS completely inactivated XynAES. At a concentration of 0.1%, Meth, Tween 80, and β-ME had no effect on enzyme activity, while EDTA, IPA, Urea, and PMSF activated enzyme activity. At a concentration of 1%, XynAES lost 63.09% and 36.52% of its activity under the action of PMSF and β-ME, respectively, and was directly inactivated by SDS.

[0056] Table 1. Effects of metal ions, inhibitors, surfactants and organic solvents on the activity of XynAES.

[0057]

[0058]

[0059] Note: The activity of the control group (without additives) was 100%. Each value represents the mean ± SD. "*" indicates a significant difference between the experimental group and the control (P<0.05). "**" indicates an extremely significant difference between the experimental group and the control (P<0.01).

[0060] 1.5.3 Effect of NaCl on XynAES Activity

[0061] On the one hand, seawater pretreatment is currently a highly efficient and economical method in the lignocellulose processing industry; therefore, the tolerance of xylanase to NaCl affects its industrial application. On the other hand, XynAES originates from a salt lake metagenomic genome and has the potential for high tolerance to NaCl. Based on these reasons, the effect of NaCl on XynAES activity was determined. 0-5.0 mol / L NaCl was added to a standard reaction system, with the experimental group without NaCl serving as a control, to evaluate the effect of NaCl on XynAES activity.

[0062] Results of NaCl tolerance test for recombinant xylanase XynAES

[0063] like Figure 4 The XynAES samples showed some salt tolerance; xylanase activity decreased with increasing salt concentration, but maintained approximately 60% activity in 0-3.0M NaCl. XynAES were derived from Ayding Lake in Xinjiang, an alkaline and high-salt environment. Figure 4 )

[0064] 1.5.4 Substrate Specificity Assay

[0065] To determine the substrate specificity of XynAES enzyme, 1% beech xylan, microcrystalline cellulose, corn cob xylan, sugarcane bagasse xylan, sodium carboxymethyl cellulose, and cellobiose were used as substrates, with beech xylan as a reference, to determine the percentage of degradation.

[0066] Substrate specificity test results

[0067] As shown in Table 2, the recombinant enzyme XynAES showed the highest activity against beechwood xylan (100±4.53 U / mg), followed by bagasse xylan (87.06±4.78 U / mg), and then corncob xylan (68.83±2.07 U / mg). It had no activity against sodium carboxymethyl cellulose (CMC-Na), cellobiose, and avicel cellulose.

[0068] Table 2. Substrate specificity of XynAES

[0069]

[0070] Note: All substrates were tested at 1% (w / v). Results are expressed as mean ± SD, where different letters indicate significant differences at the P ≤ 0.05 level, 100% = 63.08 U / mg protein.

[0071] 1.5.5 Determination of kinetic constants

[0072] To determine the kinetic parameters of xylanase XynAES, different concentrations of beech xylan (0.2 mg / mL, 0.4 mg / mL, 0.6 mg / mL, 0.8 mg / mL, 1 mg / mL, 1.2 mg / mL, 1.4 mg / mL, 1.6 mg / mL, 1.8 mg / mL, and 2 mg / mL) were used as substrates and reacted for 5 min and 10 min respectively. The Vmax and Km of xylanase on beech xylan were calculated using Lineweaver-Burk plots.

[0073] Results of kinetic constant determination

[0074] Table 3 shows that the optimal substrate for XynAES is beechwood xylan, with optimal temperature and pH of 65℃ and pH 8.0, respectively. The enzyme activity is 63.08 U / mg, Km is 3.23 mg / mL, and Vmax is relatively high at 72.46 μmol / min / mg. The theoretical molecular mass and pI of XynAES are 41.50 kDa and 4.64, respectively. The catalytic efficiency (Km / Kcat) of XynAES is 15.52 mL / s / mg. Table 3 shows the kinetic parameters of XynAES.

[0075]

[0076]

[0077] 1.6 Determination of hydrolysis products by thin-layer chromatography

[0078] A reaction mixture consisting of 1% beech xylan and 10 μg of purified enzyme was incubated at 65 °C for 2 h. The beech xylan hydrolysate was characterized by thin-layer chromatography (TLC) on a silica gel 60 plate (Merck, Darmstadt, Germany) using 1-butanol / acetic acid / water (2:1:1, v / v / v). After spraying with freshly prepared 5% (v / v) H₂SO₄ ethanol, the mixture was treated at 120 °C for 10 min, and the reducing sugar content was determined. The reducing sugar standards were xylobiose (X2), xylotriose (X3), and xylotetraose (X4).

[0079] Hydrolysis product analysis results

[0080] pass Figure 5 It can be seen that the hydrolysis products of recombinant xylan XynAES from two different sources are the same, and the final hydrolysis products are only disaccharides and tetrasaccharides.

[0081] 1.7 Statistical Analysis

[0082] Data was entered and processed using Microsoft Excel 2010, and statistical analysis was performed using SPSS 21.0. The data were analyzed using the one-way ANOVA method and passed the Duncan multiple comparison test, as shown in Table 4.

[0083] Table 4. Biochemical characteristics of GH10 xylanase

[0084]

[0085]

[0086] Recent reports indicate that alkali-tolerant xylanases in the GH10 family are fewer than acid-tolerant and neutral xylanases. For example, the optimal pH values ​​for XylR, BaXyn10, and XynD25 are 5.0-6.5, 7, and 7.5, respectively, all falling within the slightly acidic or neutral range. However, XynAES maintains high activity in alkaline environments, a characteristic that offers possibilities for specialized industrial production and enriches enzyme resources. Thermal stability analysis shows that… Figure 3 As shown in Figure C, XynAES retained 80% activity after heat treatment at 60℃ for 2 hours, 50% activity after withstanding 2 hours at 65℃, and approximately 20% activity after incubation at 70℃ for 2 hours. This indicates that XynAES not only exhibits high activity at high temperatures but also functions for extended periods. pH stability analysis showed... Figure 3As shown in Figure D, after incubation at 4℃ for 12 hours, it retained over 60% of its relative activity at pH 5-10 and over 80% of its relative activity at pH 6-9. After incubation at 4℃ for 24 hours, it retained over 60% of its relative activity at pH 6-10 and over 80% of its relative activity at pH 6-9. These characteristics provide various possibilities for the industrial application of XynAES. XynAES and XynSL3 (Wang et al. 2017), a xylinophilic recombinase cloned from Alkalibacterium sp. SL3 isolated from sediments of Dabusu Lake, exhibit remarkably similar enzymatic properties. Both show strong tolerance to NaCl and alkaline environments, which may be related to their similar origin. XynAES originates from Ayding Lake in Xinjiang, an alkaline and high-salt environment. XynSL3 also originates from a saline-alkali environment. It also exhibits similar salt tolerance to other xylanases from saline environments, such as marine-derived XynB (Bing Guo et al. 2013); XynB retains 40% of its activity even under 4.0 M NaCl tolerance. These reports suggest that salt lakes may contain abundant salt-tolerant xylanase genes, providing insights for the discovery of xylanases adapted to high-salt industrial production. XynAES activity was activated by Mn2+, reaching 113.99 ± 3.75% and 130.77 ± 1.39% at 1 mM and 10 mM, respectively. This is similar to the Mn2+ activation of other xylanases, such as CrXyn (Linli, 2022) and xylanases from Flavobacterium johnsoniae (S. Chen, 2013), possibly due to Mn2+ interacting with key amino acid residues in the enzyme by binding to the active site or acting as a cofactor (S. Chen, 2013). 10 mM Co²⁺ and Ni²⁺ completely inactivate XynAES. These metal ions may inhibit enzymatic reactions by binding to the enzyme's active groups, causing oxidative stress and protein damage, or by reacting with the enzyme-substrate complex (S. Hemida, 1997 and S. Gu, 2021). Therefore, contact with Co²⁺ and Ni²⁺ should be avoided when using XynAES. At a concentration of 0.1%, Meth, Tween 80, and β-ME have no effect on enzyme activity, while EDTA, IPA, Urea, and PMSF activate enzyme activity, which is beneficial for industrial production. Furthermore, like most enzymes, XynAES is highly inhibited by SDS, an anionic detergent that causes strong protein denaturation (Wang et al. 2017). At a concentration of 1%, XynAES loses 63.09% and 36.52% of its activity under the influence of PMSF and β-ME, respectively, and is directly inactivated by SDS.High concentrations of PMSF, β-ME, and SDS should be avoided in the production and use of XynAES. The optimal substrate for XynAES is beechwoodxylan, with a specific activity of 63.08 U / mg and a Km of 3.23 mg / mL, indicating good substrate affinity. The Vmax is relatively high at 72.46 μmol / min / mg, and the catalytic efficiency (Kcat / Km) is 15.52 ml / s / mg, which is significantly better than other xylanases in the GH10 family, such as XylR (Pavarina et al., 2021) at 2.23 ml / s / mg and XynDZ5 (Zarafeta et al., 2020) at 1.44 ml / s / mg. This higher catalytic efficiency provides more possibilities for practical production. The hydrolysis products of recombinant xylan XynAES from two different xylan sources are the same, with the final hydrolysis products being only disaccharides and tetrasaccharides. This indicates that the enzyme is a strictly endoxylanase and is minimally affected by xylan branching. The fixed hydrolysates facilitate the production of prebiotics from xylooligosaccharides, which are beneficial for probiotic growth and maintaining a balanced gut microbiome. The results show that its various xylan hydrolysates are consistent, which is consistent with studies on GH10 xylanases showing less influence from xylan branching (Mauro, et al., 2023). However, the beech xylan hydrolysates are more pronounced, which is also consistent with the higher activity of XynAES for beech xylan. Such xylanases with well-defined hydrolysates offer more certain possibilities for their industrial applications.

[0087] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A salt-tolerant xylanase, characterized in that, The amino acid sequence of the salt-tolerant xylanase is shown in SEQ ID NO:

2.

2. A DNA molecule encoding the salt-tolerant xylanase of claim 1, characterized in that, The nucleotide sequence of the DNA molecule is shown in SEQ ID NO:

1.

3. A recombinant vector, characterized in that, The recombinant vector comprises the DNA molecule of claim 2 and a regulatory sequence for expression operably linked to the DNA molecule.

4. A host cell, characterized in that, The host cell comprises the DNA molecule of claim 2 or the recombinant vector of claim 3.

5. The application of the salt-tolerant xylanase according to claim 1 in the degradation of xylan, characterized in that, The xylan is any one of beech xylan, bagasse xylan, and corn cob xylan.

Images