Small nucleic acid molecule for promoting skin wound healing and application thereof

Abstract

The invention discloses a brand new sequence small nucleic acid molecule QuickHeal RNA-1 capable of promoting wound healing, and provides an effective chemical modification method. The invention also discloses an application of the novel small nucleic acid molecule in a skin acute wound healing animal model. The invention discloses the small nucleic acid molecule QuickHeal RNA-1 capable of promoting skin wound healing for the first time, and the small nucleic acid molecule QuickHeal RNA-1 can be used as a candidate medicine for treating acute skin wounds. The small nucleic acid molecule Quick Heal RNA-1 disclosed by the invention has a relatively good application prospect in preparation of a medicine for healing a skin wound. The method has a wide application prospect.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a gene interference sequence, i.e. a novel small nucleic acid drug for promoting skin wound healing, and its application in preparing a drug for treating skin wound healing. Background Art

[0002] Wound healing is a dynamic and highly continuous process that includes hemostasis, inflammation, proliferation, and tissue remodeling. This process involves the coordinated action of wound cell spectra such as keratinocytes, fibroblasts, endothelial cells, and immune cells, and the transmission of numerous signal molecules. Healthy wounds usually heal within four to six weeks, but various adverse events may impair the progress of the wound healing stage and lead to the development of chronic non-healing wounds. Relevant epidemiological studies have shown that the annual demand for wound treatment (including various surgical incisions, diabetic ulcers, and pressure sores, etc.) in my country is about 100 million person-times. Through extensive research and innovation, a large number of wound care technologies and products, such as wound dressings, natural medicines, and negative pressure therapy, have been developed to promote the healing of acute or chronic wounds. However, the current clinical treatment of chronic wounds is still not ideal, and more than 50% of chronic wound treatments are ineffective.

[0003] Small nucleic acid drugs are a new class of therapeutic drugs that have attracted widespread attention due to their unique mechanisms and broad application prospects. Small nucleic acid drugs mainly include antisense oligonucleotides (ASOs), small interfering RNAs (siRNAs) and microRNAs (miRNAs), etc. They regulate at the post-transcriptional level and inhibit the expression of target proteins through gene silencing, thereby achieving the purpose of treating diseases. Small nucleic acid drugs have the advantages of strong specificity, short R&D cycle, high success rate, and low resistance to drugs. Their greatest advantages lie in their high specificity and design flexibility. Unlike traditional small molecule drugs and protein / antibody drugs, small nucleic acid drugs can directly act on specific gene sequences and can target targets that are difficult to handle with traditional methods, interfering with cell proliferation, migration, angiogenesis, chemotherapy resistance, etc., and are expected to form the third wave of modern new drugs after small molecule drugs and antibody drugs. In recent years, with the advancement of delivery technologies, such as in vivo-jetPEI, lipid nanoparticles and GalNAc conjugates, small nucleic acid drugs have been increasingly widely used in clinical practice. At present, a number of small nucleic acid drugs have been approved for the treatment of a variety of diseases, including genetic diseases and cancer. These drugs have demonstrated good efficacy and safety in clinical trials and practical applications, further promoting the development and application of small nucleic acid drugs.

[0004] Over the years, considerable progress has been made in our understanding of the mechanisms of impaired skin healing and chronic wound healing. Experimental studies have provided new insights into potential molecular targets and cellular correlates of wound healing pathology and successfully characterized the expression profile of small nucleic acids during human wound healing. For example, miR-19b has been shown to be an important regulator of wound inflammation and can reduce inflammation levels by inhibiting the expression of pro-inflammatory factors in keratinocytes, thereby improving the healing environment of chronic wounds. 1 . This provides new ideas and directions for future therapeutic interventions and preventive measures. The application of small nucleic acid drugs in wound healing shows great potential. These drugs can promote the wound healing process and accelerate tissue regeneration by regulating the expression of key genes and affecting processes such as cell proliferation, migration and differentiation. Therefore, it is necessary to develop new small nucleic acid drugs for the treatment of skin wounds. Summary of the invention

[0005] To solve the above technical problems, the present invention provides a new, modified and synthetic small nucleic acid molecule QuickHeal RNA-1 and its application. The RNA can promote wound healing in wound healing animal models, thereby providing an effective method for treating skin wounds.

[0006] The inspiration for designing this small nucleic acid molecule comes from in-depth research on the role of small nucleic acids in wound healing mechanisms. Studies have shown that small nucleic acids (such as miRNA, circRNA, siRNA and lncRNA) can accelerate the wound healing process by regulating the expression of genes related to wound healing, regulating inflammatory responses, and promoting cell proliferation, migration and differentiation. For example, local treatment of miR-19b has shown a significant improvement in wound healing in a skin wound healing mouse model by suppressing inflammation levels. 1,2 At the same time, technologies for synthesizing small nucleic acids, such as chemical synthesis and in vitro transcription, have been widely used and maturely developed, providing solid technical support for the design and optimization of such molecules.

[0007] In terms of technical difficulties, the stability of small nucleic acid molecules is a key issue. They are easily degraded by nucleases in the in vivo environment, reducing the therapeutic effect. In addition, how to effectively deliver small nucleic acid molecules to target cells is also a major challenge. Common delivery systems (such as liposomes, nanoparticles, etc.) must ensure that they can be efficiently released into cells while protecting small nucleic acids. This involves multiple factors such as biocompatibility and cell uptake mechanisms. Therefore, solving these technical difficulties is crucial to realizing the clinical application of small nucleic acid molecules.

[0008] In the first aspect, the present invention provides a novel small nucleic acid molecule QuickHeal RNA-1 that promotes skin wound healing, the sequence of which is shown in SEQ ID NO.1, i.e., 5'-UGUUCAAAAUACAGUAAAACUGA-3', named QuickHeal RNA-1;

[0009] Furthermore, the Quick Heal RNA-1 also includes LNA (Locked nucleic acid monomer) chemical modification.

[0010] Furthermore, the chemical modification is to add methylene groups at C2'-O- and C4'- on the ribose to "lock" the ribofuranose ring into a 3'-endo conformation.

[0011] Furthermore, the chemical modification is to add a methylene group between the C2'-O- and C4'-positions of the ribose in the 2nd, 9th, 14th and 20th bases from the 5' end of QuickHeal RNA-1.

[0012] In a second aspect, the present invention further provides a drug / pharmaceutical composition comprising the small nucleic acid molecule as described above, and / or a pharmaceutically acceptable carrier.

[0013] Furthermore, the drug / drug composition is used in combination with a carrier drug in vivo-jetPEI and a 5% glucose solution.

[0014] Specifically, the pharmaceutically acceptable carrier refers to a drug that does not produce adverse, allergic or other adverse reactions when the drug is properly administered to animals or humans. Pharmaceutically acceptable carriers include, but are not limited to: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium methylcellulose, ethyl cellulose and methyl cellulose; tragacanth powder; malt; gelatin; talc; solid lubricants, such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils, such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa butter; polyols, such as propylene glycol, glycerol, sorbitol, mannitol and polyethylene glycol; alginic acid; emulsifiers, such as Tween; wetting agents, such as sodium lauryl sulfate; colorants; flavorings; tablets, stabilizers; antioxidants; preservatives; pyrogen-free water; isotonic saline solution; and phosphate buffer, etc. These materials are used as needed to aid in the stability of the formulation or to help increase the activity or its bioavailability or to produce an acceptable taste or flavor in the case of oral administration.

[0015] Preferably, the pharmaceutically acceptable carrier comprises nanoparticle carrier in vivo-jetPEI and 5% glucose solution.

[0016] Specifically, the drug / drug composition may also contain physiologically compatible excipients, including buffers, diluents, excipients, fillers, binders, wetting agents, disintegrants, absorption enhancers, surfactants, adsorption carriers, lubricants, etc.

[0017] Specifically, the drug / pharmaceutical composition can be prepared into injection, sterile powder for injection, tablet, pill, capsule, lozenge, elixir, powder, granule, syrup, solution, tincture, aerosol, powder spray, or suppository, etc. The above-mentioned drugs / pharmaceutical compositions in various dosage forms can be prepared according to conventional methods in the pharmaceutical field.

[0018] Specifically, the drug / drug composition can be introduced into the body such as muscle, intradermal, subcutaneous, intravenous, mucosal tissue by injection, spraying, nasal drops, eye drops, penetration, absorption, physical or chemical mediation; or introduced into the body after being mixed or wrapped with other substances. Preferably, the drug is administered by injection. The drug / drug composition can also be used in combination with other treatment methods, including surgery, radiotherapy, chemotherapy, and targeted therapy.

[0019] Preferably, the medicament / pharmaceutical composition is administered by intradermal injection.

[0020] The present invention also provides the use of the small nucleic acid molecule, or the drug / drug composition as described above in the preparation of a drug for treating skin wound healing.

[0021] The present invention also provides the use of the small nucleic acid molecule, or the drug / drug composition in preparing an acute skin wound healing animal model.

[0022] Compared with the prior art, the beneficial effects of the present invention are:

[0023] The small nucleic acid molecule or drug / drug composition of the present invention has a relatively simple preparation process in the research and development and production stages, and has the advantages of abundant candidate targets, short research and development cycle, and few side effects.

[0024] The present invention provides a small nucleic acid molecule containing a new sequence QuickHeal RNA-1, and provides an effective chemical modification method. The present invention also provides the use of the new small nucleic acid molecule in an animal model of acute wound healing of the skin. Compared with the existing miRNA-19b that has been proven to promote healing, Quick Heal RNA-1 can more effectively reduce the wound area, significantly shorten the wound closure time, and further accelerate the healing process of acute wounds. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0026] Figure 1 It represents the chemically modified structural formula of the small nucleic acid molecule QuickHeal RNA-1;

[0027] Figure 2 A flowchart showing the preparation of the small nucleic acid drug Quick Heal RNA-1 and its application in an animal model of acute skin wound healing;

[0028] Figure 3 A representative diagram showing the effect of the small nucleic acid drug Quick Heal RNA-1 in the mouse model of acute skin wound healing;

[0029] Figure 4 Statistical graph showing the acute wound area in the mouse model after application of the small nucleic acid drug QuickHeal RNA-1. DETAILED DESCRIPTION

[0030] In conjunction with the following specific examples and accompanying drawings, the present invention is further described in detail, and the protection content of the present invention is not limited to the following examples. Without departing from the spirit and scope of the inventive concept, the changes and advantages that can be thought of by those skilled in the art are all included in the present invention, and the attached claims are the scope of protection. The process, conditions, experimental methods, etc. of implementing the present invention, except for the content specifically mentioned below, are all common knowledge and common common sense in the art, and the present invention has no special restrictions. The materials, reagents, etc. used in the present embodiment, if not otherwise specified, are reagents and materials obtained from commercial sources.

[0031] The following description of at least one exemplary embodiment is actually only illustrative and is by no means intended to limit the present invention and its application or use. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] In all examples shown and discussed herein, any specific values ​​should be interpreted as merely exemplary and not as limiting. Therefore, other examples of the exemplary embodiments may have different values.

[0033] The present invention provides a novel small nucleic acid drug Quick Heal RNA-1 that can promote wound healing, and provides an effective chemical modification method. The present invention also provides the use of the novel small nucleic acid drug in a skin wound healing animal model. The present invention proposes for the first time that it can promote skin wound healing and can be used as a drug candidate for treating skin wounds. The small nucleic acid molecule QuickHeal RNA-1 proposed in the present invention has good application prospects in the preparation of drugs for skin wound healing. The present invention has broad application prospects.

[0034] Example 1 Design of a new sequence Quick Heal RNA-1

[0035] The present invention designs a small nucleic acid molecule, named Quick Heal RNA-1, whose sequence is SEQ ID NO.1: UGUUCAAAAUACAGUAAAACUGA. Then the present invention entrusts the designed Quick Heal RNA-1 to GenePharma Company, uses a nucleic acid synthesizer and a solid phase synthesis method to obtain a crude product, and then HPLC purifies the crude product to obtain a QuickHeal RNA-1 small nucleic acid molecule dry powder product.

[0036] In addition, the present invention ordered small nucleic acid molecule dry powder products of miR-19b mimic as shown in SEQ ID No. 2 and RNAmimic NC as shown in SEQ ID No. 3 from GenePharma.

[0037] SEQ ID NO.1:

[0038] UGUUCAAAAUACAGUAAAACUGA

[0039] SEQ ID NO.2:

[0040] UGUGCAAAUCCAUGCAAAACUGA

[0041] SEQ ID NO.3:

[0042] UUGUACUACACAAAAGUACUG

[0043] Example 2 Preparation of small nucleic acid drug Quick Heal RNA-1

[0044] In this example, the dry powder products of the small nucleic acid molecules Quick Heal RNA-1, miR-19bmimic and RNAmimic NC in Example 1 of the present invention were dissolved in DEPC water and diluted to 20 nM. The drug delivery carrier selected the ready-to-use cationic polymer in vivo-jetPEI reagent (purchased from Polyplus), which can condense nucleic acids into stable nanoparticles. According to the recommended N / P ratio of 6-8, the nucleic acid injection dosage for each animal was determined to be 10 μg, and the in vivo-jetPEI dosage was 1.2 μl. According to the method in the reagent manual, QuickHeal RNA-1, miR-19b mimic and RNAmimic NC were prepared with in vivo-jetPEI using 5% glucose solution to form a small nucleic acid drug in vivo transfection complex ( Figure 2 ) and incubate at room temperature for 15 minutes.

[0045] Example 3 Experiment on treating acute skin wound healing mouse model with intradermal injection of small nucleic acid drug Quick Heal RNA-1

[0046] In this embodiment, mice (C57BL / 6J, male, 8 weeks old, purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.). The whole back of the mouse was prepared using a shaver and depilatory cream, and then the skin was rinsed with clean water and alcohol. After general anesthesia, a full-thickness wound was made with an 8mm biopsy puncture on the clean skin of the lower back of the mouse, and the depth of the wound extended to the subcutaneous fascia layer. Immediately after the wound, the Quick Heal RNA-1, miR-19b mimic and negative control RNAmimic NC small nucleic acid drugs shown in Example 2 of the present invention were intradermally injected into the wound edge (10μg / 20g body weight / mouse) in a four-point ring injection, with 1 / 4 volume of drug at each location. The wound area was photographed and measured daily until about 90% of the wound area was healed. When taking pictures, a soft tape measure was placed above the wound to correct the distance between the camera and the mouse. The wound area was calculated in pixels using ImageJ-win64 software (National Institutes of Health, USA), the area of ​​the reference circle was corrected, and it was expressed as a percentage of the original area. The experimental results showed that compared with the control group miR-19b mimic and RNAmimic NC, Quick Heal RNA-1 small nucleic acid drug can more effectively reduce the wound area, significantly shorten the wound closure time, and accelerate the wound healing process, showing its superiority in promoting acute wound healing in mice. Figure 3 , Figure 4 ).

[0047] In summary, the above results show that the small nucleic acid molecule Quick Heal RNA-1 provided by the present invention can effectively promote the healing of skin wounds in animal models. After the sequence is chemically modified with LNA, its anti-degradation ability is significantly improved. The sequence can also be used for in vivo and in vitro experiments and can be used as an effective small nucleic acid drug for the development of skin wound healing drugs. The present invention proposes for the first time that the treatment with the small nucleic acid molecule QuickHeal RNA-1 as the core can be used as a new strategy for the treatment of skin wounds.

[0048] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0049] As used in the present invention, the terms "include" and "comprising" are open expressions, that is, including the contents specified in the present invention but not excluding other contents.

[0050] As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items.

[0051] Although the embodiments of the present description have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present description, the scope of which is defined by the appended claims and their equivalents.

[0052] References

[0053] 1Li,D.et al.miR-19a / b and miR-20a Promote Wound Healing by Regulating the Inflammatory Response ofKeratinocytes.JInvestDermatol141,659-671(2021). https: / / doi.org:10.1016 / j.jid.2020.06.037

[0054] 2Cao,G.,Chen,B.,Zhang,X.&Chen,H.Human Adipose-Derived MesenchymalStem Cells-DerivedExosomal microRNA-19b Promotes the Healing of Skin WoundsThrough Modulation ofthe CCL1 / TGF-βSignalingAxis.ClinCosmetInvestigDermatol13,957-971(2020). https: / / doi.org:10.2147 / ccid.S274370.

Claims

1. A small nucleic acid molecule that promotes skin wound healing, characterized in that: The sequence of the small nucleic acid molecule is shown in SEQ ID NO. 1, ie, 5'-UGUUCAAAAUACAGUAAAACUGA-3', and is named Quick Heal RNA-1.

2. The small nucleic acid molecule according to claim 1, characterized in that The small nucleic acid molecule also includes a locked nucleic acid monomer chemical modification, wherein the chemical modification includes adding a methylene group between the C2'-O- and C4'-positions of the ribose in the 2nd, 9th, 14th, and 20th bases from the 5' end.

3. A drug / drug composition, characterized in that: The drug / pharmaceutical composition comprises the small nucleic acid molecule as claimed in claim 1, and a pharmaceutically acceptable carrier.

4. The drug / drug composition according to claim 4, characterized in that The drug / drug composition is used in combination with the drug carrier in vivo-jetPEI and 5% glucose solution.

5. Use of the small nucleic acid molecule according to claim 1 or 2 in the preparation of a drug for treating skin wound healing.

6. Use of the small nucleic acid molecule according to claim 1 or 2 in preparing an animal model of acute skin wound healing.

7. Use of the drug / drug composition according to claim 4 in the preparation of a drug for treating skin wound healing.

8. Use of the drug / drug composition according to claim 4 in an animal model of acute wound healing of the skin.

9. The use according to claim 5 or 7, characterized in that: The skin wound healing is acute skin wound healing.

Images