Novel miRNA Nta-miRN2072f and application thereof in regulating and controlling bacterial wilt resistance of tobacco

Abstract

The invention provides novel miRNA Nta-miRN2072f and application of the novel miRNA Nta-miRN2072f in regulation and control of bacterial wilt resistance of tobacco, and belongs to the technical field of biology. A new miRNA-Nta-miRN2072f is found in tobacco, the resistance of the tobacco to bacterial wilt can be regulated and controlled, the resistance of a gene knockout mutant to the bacterial wilt can be remarkably improved by knocking out the Nta-miRN2072f in a susceptible tobacco variety CB-1, and cultivation of a new tobacco variety capable of resisting the bacterial wilt is facilitated.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a new miRNA Nta-miRN2072f and application thereof in regulating tobacco resistance to bacterial wilt. Background Art

[0002] Tobacco is infected by various pathogens during its growth. Among them, tobacco bacterial wilt caused by Ralstonia solanacearum has caused huge losses to tobacco production. Ralstonia solanacearum is a soil-borne bacterium that usually colonizes the xylem tissue of plant roots, infects the roots of susceptible plants through small wounds, and then quickly transfers to the stem tissue. The exopolysaccharides produced by Ralstonia solanacearum can cause blockage of the xylem, causing the plant to wilt. When the plant wilts, the bacteria transfer from the roots of the plant to the soil. For the prevention and control of tobacco bacterial wilt, developing resistant varieties is a green and economical method. Studying the molecular mechanism of miRNA regulating tobacco bacterial wilt resistance and exploring genes related to the formation of tobacco bacterial wilt resistance will help breed disease-resistant varieties.

[0003] miRNA is a class of endogenous small non-coding single-stranded RNA molecules of about 20-24 nucleotides. It relies on complementarity with specific mRNA to regulate the expression of its target gene at the post-transcriptional level, achieving the function of cutting, degrading mRNA or inhibiting translation. Most miRNAs target negatively regulated mRNA. With the continuous development of miRNA research, researchers have discovered a large number of miRNAs in plants, and they have been confirmed to be involved in important biological processes such as plant growth and development, metabolism, signal transduction, and resistance to external biological and abiotic stresses. Plants can resist pathogens by up-regulating or down-regulating the expression of miRNAs. miRNAs play an important role in protecting plants from pathogen invasion by regulating ROS, MAPK signaling cascades, and various transcription factors involved in turning on defense genes. These miRNAs are also involved in turning on downstream genes encoding pathogen-related proteins, phenolic compounds or phytoalexins, as well as various plant hormone signals in response to pathogen attacks, thereby regulating plant disease resistance.

[0004] Studies have shown that pathogens induce the expression of a large number of miRNAs in plants when infecting plants, thereby controlling and promoting the reprogramming of gene expression. For example, overexpression of miR172 in tobacco promotes TMV infection, while silencing of miR172 inhibits TMV infection. When miR319b is overexpressed in rice, rice resistance to rice blast is enhanced. In addition, in rice, overexpression of miR7695 promotes resistance to the pathogenic fungus rice blast by inhibiting the expression of the gene encoding natural resistance-associated macrophage protein 6 (OsNramp6). Rice overexpressing miR160a or miR398b has enhanced resistance to rice blast, which is related to the accumulation of hydrogen peroxide and the upregulation of defense-related genes. In addition, studies have shown that miR444 and miR528 are involved in rice's immune response to viruses. When wheat and barley are infected with powdery mildew, miRNAs are also differentially expressed. The above evidence all indicates that miRNAs play a certain role in biological stress.

[0005] The prominent role of miRNA in plant biotic stress is increasingly valued. Studies have shown that miRNA can regulate plant resistance to a variety of bacterial diseases, fungal diseases and viral diseases by targeting disease resistance-related genes. However, the function of miRNA in the interaction between plants and Ralstonia solanacearum is still unclear, and its application in the breeding of tobacco varieties resistant to bacterial wilt is still blank. Therefore, identifying miRNAs that respond to bacterial wilt infection in tobacco can provide ideas and strategies for breeding tobacco varieties resistant to bacterial wilt, which has important application prospects. Summary of the invention

[0006] The present invention provides a new miRNA Nta-miRN2072f and its application in regulating tobacco resistance to bacterial wilt. The miRNA can regulate tobacco resistance to bacterial wilt. By knocking out Nta-miRN2072f in the susceptible tobacco variety CB-1, the resistance of the gene knockout mutant to bacterial wilt can be significantly improved, which is helpful for the cultivation of new tobacco varieties resistant to bacterial wilt.

[0007] In order to achieve the above object, the present invention provides an application of a Nta-miRN2072f precursor sequence or a biological material containing the Nta-miRN2072f precursor sequence in regulating tobacco resistance to bacterial wilt. The precursor DNA sequence of Nta-miRN2072f is shown in SEQ ID NO: 1.

[0008] The present invention also provides an application of knocking out Nta-miRN2072f in significantly improving tobacco resistance to bacterial wilt. The precursor sequence of Nta-miRN2072f is shown in SEQ ID NO:1.

[0009] The present invention also provides a method for constructing an Nta-miRN2072f knockout mutant having resistance to bacterial wilt, comprising the following steps:

[0010] Based on the Nta-miRN2072f precursor sequence, two target sequences were designed for knockout, and then the two target sequences were simultaneously connected to the gene editing vector pDC45, and the vector was transferred into the tobacco variety CB-1 by Agrobacterium transformation to perform dual-target knockout of Nta-miRN2072f;

[0011] The obtained transgenic seedlings were then identified by PCR to obtain positive plants, which were then sequenced to determine the editing positions to obtain homozygous Nta-miRN2072f precursor sequence knockout mutants with resistance to bacterial wilt.

[0012] Preferably, the two target sequences are g1 and g2, wherein the g1 sequence is ATGAAGAAGGGGTAGATCTAGGG, and the g2 sequence is AACGATTTTAGATCCAAGACGGG.

[0013] Preferably, the bacterial wilt disease index of the Nta-miRN2072f knockout mutant was 26.19-38.10 15 days after inoculation with bacterial wilt pathogen. Compared with the control CB-1, the bacterial wilt disease incidence rate was only 28.00%-38.10% of that of the control CB-1.

[0014] Preferably, compared with the control CB-1, the number of R. solanacearum in the roots of the Nta-miRN2072f knockout mutant 2 days after infection with R. solanacearum was only 17.95%-55.38% of that of the control CB-1.

[0015] The present invention also provides a method for breeding tobacco varieties resistant to bacterial wilt, by knocking out Nta-miRN2072f in the susceptible tobacco variety CB-1, causing its function to be lost, thereby breeding tobacco varieties resistant to bacterial wilt, wherein the precursor sequence of the Nta-miRN2072f is shown in SEQ ID NO: 1.

[0016] The present invention also provides an application of a knocked-out Nta-miRN2072f precursor sequence in breeding tobacco varieties resistant to bacterial wilt, wherein the Nta-miRN2072f precursor sequence is shown in SEQ ID NO:1.

[0017] Compared with the prior art, the advantages and positive effects of the present invention are:

[0018] The present invention discovered a new miRNA-Nta-miRN2072f in tobacco, which can regulate the resistance of tobacco to bacterial wilt. By knocking out Nta-miRN2072f in the susceptible tobacco variety CB-1, the resistance of the gene knockout mutant to bacterial wilt can be significantly improved, which is helpful for the cultivation of new tobacco varieties resistant to bacterial wilt. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The structure of Nta-miRN2072f, wherein A. the base sequence alignment of Nta-miRN2072a, Nta-miRN2072fb, Nta-miRN2072c, Nta-miRN2072d, Nta-miRN2072e and Nta-miRN2072f precursor DNA sequences; B. the stem-loop structure of the Nta-miRN2072f RNA molecule, the red region is the mature region of Nta-miRN2072f;

[0020] Figure 2 Identification of Nta-miRN2072f knockout mutants, including A. PCR identification of Nta-miRN2072f knockout mutants; B. Gene editing position of Nta-miRN2072f knockout mutants;

[0021] Figure 3 Phenotypic analysis of Nta-miRN2072f knockout material under bacterial wilt infection, including A. morbidity of CB-1 and mutants (KO_A5, KO_A10) after inoculation with bacterial wilt pathogen Y45; B. Disease index of CB-1 and mutants (KO_A5, KO_A10) after inoculation with bacterial wilt pathogen Y45, * indicates significant difference, ** indicates extremely significant; C. Morbidity of CB-1 and mutants (KO_A5, KO_A10) after inoculation with bacterial wilt pathogen, * indicates significant difference, ** indicates extremely significant; D. Infection of RS10-GFP2 in the roots of CB-1 and mutants (KO_A5, KO_A10) after inoculation with bacterial wilt pathogen RS10-GFP2; E. Growth of RS10-GFP in the roots of CB-1 and mutants (KO_A5, KO_A10) on NA (kan) after inoculation with RS10-GFP2; F, G. Inoculation with RS10-GFP2 Statistics of RS10-GFP2 in the roots of CB-1 and mutants (KO_A5, KO_A10) after 1 dpi and 2 dpi. * indicates significant difference, ** indicates extremely significant difference. DETAILED DESCRIPTION

[0022] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0023] Example 1 Structural analysis of Nta-miRN2072f

[0024] Based on the mature sequence of Nta-miRN2072 CUCCGGUCAAGAUCUUCCAUC, five miRNA precursor DNA sequences of Nta-miRN2072 were predicted in PmiREN (https: / / pmiren.com / ), namely Nta-miRN2072a, Nta-miRN2072b, Nta-miRN2072c, Nta-miRN2072d and Nta-miRN2072e. However, the Nta-miRN2072 precursor cloned from tobacco variety CB-1 in this study had base differences with the five predicted precursors, so it was named Nta-miRN2072f.

[0025] like Figure 1 As shown in A, DNAMAN was used to analyze the base differences of the precursor DNA sequences of Nta-miRN2072a, Nta-miRN2072fb, Nta-miRN2072c, Nta-miRN2072d, Nta-miRN2072e and Nta-miRN2072f. There were base differences between the precursor DNA sequences of Nta-miRN2072f and Nta-miRN2072a, Nta-miRN2072fb, Nta-miRN2072c, Nta-miRN2072d and Nta-miRN2072e. The precursor sequence of Nta-miRN2072f is shown in SEQ ID NO: 1. Subsequently, RNAfold (RNAfold web server) was used to perform structural analysis on Nta-miRN2072f, as shown in FIG. Figure 1 As shown in B, Nta-miRN2072f has a typical stem-loop structure, and Nta-miRN2072 is generated from the 5' arm (red region) of the precursor sequence.

[0026] Example 2 Construction of Nta-miRN2072f knockout mutant

[0027] Based on the location information of the precursor sequence on the genome, two knockout targets were designed using CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR2 / ) from Huazhong Agricultural University:

[0028] g1: ATGAAGAAGGGGTAGATCTAGGG,

[0029] g2: AACGATTTTAGATCCAAGACGGG.

[0030] Subsequently, the two target sequences were simultaneously connected to the gene editing vector pDC45 to obtain the knockout vector pDC45-Cas9 / gRNA-Nta-miRN2072f, and the pDC45-Cas9 / gRNA-Nta-miRN2072f was transferred into CB-1 by Agrobacterium transformation to perform double target knockout of Nta-miRN2072f and obtain T0 transgenic materials. For the obtained T0 transgenic seedlings, PCR identification was first performed using primers delect+former_F / delect+former_R, hyg_F / hyg_R and NtActin_F / NtActin_R to obtain positive single plants ( Figure 2 A), and then the positive strains were sequenced using primers Nta-miRN2072f-Crispr_F / Nta-miRN2072f-Crispr_R to determine the editing position ( Figure 2 B), two homozygous mutant lines KO_5 and KO_10 were finally identified.

[0031] delect+former_F: TACCATGCCTTGCATTTAGATT

[0032] delect+former_R:GATGGAAGATCTTGACCGGAG

[0033] hyg_F:CAAAGATCGTTATGTTTATCGGCACT

[0034] hyg_R:TTGGCGACCTCGTATTGGGAA

[0035] NtActin_F:ACCTCTATGGCAACATTGTGCTCAG

[0036] NtActin_R:CTGGGAGCCAAAGCGGTGATT

[0037] Nta-miRN2072f-Crispr_F: TACCATGCCTTGCATTTAGATT

[0038] Nta-miRN2072f-Crispr_R:ATCTTATCCTTTTCCTTACTCAGCA

[0039] Example 3 Nta-miRN2072f regulates tobacco resistance to bacterial wilt

[0040] To determine the regulatory role of Nta-miRN2072f on tobacco bacterial wilt, we evaluated the resistance of CB-1 and Nta-miRN2072f mutants KO_5 and KO_10 to bacterial wilt (Y45) in the greenhouse. Figure 3 A). The bacterial wilt disease index of the Nta-miRN2072f knockout mutant was only 26.19 and 38.10 after 15 days of inoculation with bacterial wilt pathogen. Compared with the control CB-1, the bacterial wilt disease incidence of the Nta-miRN2072f knockout mutant was only 28.00% and 38.10% of that of the control CB-1 ( Figure 3 B, 3C).

[0041] The formulas for disease index (DI) and disease rate (DR) are as follows:

[0042] DI=(∑(Ni×Vi)) / (N×4)×100

[0043] DR=n / N×100%

[0044] Ni = number of plants with the corresponding disease index, Vi = disease index (0, 1, 2, 3 and 4), n = number of diseased plants, N = total number of plants used in each treatment.

[0045] Furthermore, we used the GFP-fluorescent bacterial wilt RS10-GFP2 to observe and count the colonization of bacterial wilt in the roots of CB-1 and Nta-miRN2072f mutants ( Figure 3 D). As shown in the figure, fluorescence microscopy showed that the number of bacterial wilt bacteria in the roots of the Nta-miRN2072f mutant was significantly reduced compared with CB-1. In addition, the plate experiment also observed that compared with CB-1, the number of bacterial wilt bacteria in the roots of the Nta-miRN2072f knockout mutant was only 17.95% and 55.38% of that of the control CB-1 2 days after bacterial wilt infection ( Figure 3 E-3G).

[0046] Combined with the above analysis, it can be seen that the new miRNA-Nta-miRN2072f discovered in tobacco in the present invention can regulate the resistance of tobacco to bacterial wilt. After knocking out Nta-miRN2072f in the susceptible tobacco variety CB-1, the resistance of the gene knockout mutant to bacterial wilt was significantly improved, which is helpful for the cultivation of new tobacco varieties resistant to bacterial wilt.

Claims

1. Use of Nta-miRN2072f or a biomaterial containing Nta-miRN2072f in regulating tobacco resistance to bacterial wilt, characterized in that: The precursor sequence of Nta-miRN2072f is shown in SEQ ID NO:

1.

2. The use of knocking out Nta-miRN2072f in significantly improving tobacco resistance to bacterial wilt, characterized in that: The precursor sequence of Nta-miRN2072f is shown in SEQ ID NO:

1.

3. A method for constructing a Nta-miRN2072f precursor sequence knockout mutant with resistance to bacterial wilt, characterized in that: The following steps are involved: Based on the Nta-miRN2072f precursor sequence, two target sequences were designed for knockout, and then the two target sequences were simultaneously connected to the gene editing vector pDC45, and the vector was transferred into the tobacco variety CB-1 by Agrobacterium transformation to perform dual-target knockout of Nta-miRN2072f; The obtained transgenic seedlings were then identified by PCR to obtain positive plants, which were then sequenced to determine the editing positions to obtain homozygous Nta-miRN2072f precursor sequence knockout mutants with resistance to bacterial wilt.

4. The construction method according to claim 3, characterized in that: The two target sequences were g1 and g2, where the g1 sequence was ATGAAGAAGGGGTAGATCTAGGG and the g2 sequence was AACGATTTTAGATCCAAGACGGG.

5. The construction method according to claim 3, characterized in that: The bacterial wilt disease index of the Nta-miRN2072f knockout mutant was 26.19-38.10 15 days after inoculation with bacterial wilt pathogen. Compared with the control CB-1, its bacterial wilt disease incidence was only 28.00%-38.10% of that of the control CB-1.

6. The construction method according to claim 3, characterized in that: Compared with the control CB-1, the number of R. solanacearum in the roots of the Nta-miRN2072f knockout mutant was only 17.95%-55.38% of that in the control CB-1 2 days after R. solanacearum infection.

7. A method for breeding tobacco varieties resistant to bacterial wilt, characterized in that: By knocking out Nta-miRN2072f in the susceptible tobacco variety CB-1, its function is lost, thereby cultivating tobacco varieties resistant to bacterial wilt, wherein the precursor sequence of Nta-miRN2072f is shown in SEQ ID NO:

1.

8. The use of knocking out Nta-miRN2072f in cultivating tobacco varieties resistant to bacterial wilt, characterized in that: The precursor sequence of Nta-miRN2072f is shown in SEQ ID NO:1.

Images