Molecular marker related to growth traits of sheep at different stages and application of molecular marker

Abstract

The invention provides a molecular marker related to growth traits of sheep at different stages and application of the molecular marker. The molecular marker is characterized in that a primer is designed for an XPNPEP2 gene sequence, DNA is extracted from sheep blood, and a C / T polymorphic site exists at the 95th site of an amplified fragment, such as SEQ ID NO.1, through PCR amplification, DNA sequencing and sequence analysis; an AQP primer is further used for detecting polymorphic sites of 740 sheep and establishing a least square model, correlation analysis is carried out on genotypes and chest circumference and tube circumference of growth traits, and it is determined that Y at the 95bp position as shown in SEQ ID NO.1 is C or T polymorphic sites, and the polymorphic sites can be used as molecular markers of the growth traits of the sheep at different stages. The molecular marker disclosed by the invention can be used for screening new varieties of rapid growth type high-quality mutton sheep, can be used for screening assisted breeding and breeding rapid growth type sheep, and is beneficial to increase of economic benefits.

Description

Technical Field

[0001] The invention belongs to the technical field of screening and application of molecular markers, and in particular relates to a molecular marker related to growth traits of sheep at different stages and application thereof. Background Art

[0002] Since ancient times, sheep have been one of the important domestic animals for human beings, providing humans with abundant wool, mutton and other products. Wool can be used to make textiles such as clothes and blankets, while mutton is a delicious dish on people's tables. Sheep meat is delicious and nutritious, and is deeply loved by consumers. The development of the mutton industry has driven the development of animal husbandry and provided farmers with a stable source of income. How to make the mutton industry bring higher economic value requires the selection of sheep that can gain weight quickly. The chest circumference and tube circumference of sheep are important body size traits to measure the growth and production performance of sheep, and as muscle development indicators, they affect the meat production and quality of sheep.

[0003] XPNPEP2 (X-prolyl aminopeptidase 2) is a protein encoding a hydrolase specific for N-terminal imidoyl bonds, which are commonly found in several collagen degradation products, neuropeptides, vasoactive peptides and cytokines. Structurally, the enzyme is a member of the "pita fold" family and exists in mammalian tissues in soluble and GPI-anchored membrane-bound forms with different tissue distributions. It is also a membrane-bound metalloprotease that catalyzes the removal of the penultimate prolyl residue from the N-terminus of peptides, such as Arg-Pro-Pro. It may play a role in the metabolism of the vasodilator bradykinin. Membrane-bound XPNPEP2 is a heavily glycosylated glycosylphosphatidylinositol-anchored protein consisting of 673 amino acids encoded by the XPNPEP2 gene on human Xq 25. Several bioactive peptides, including collagens (Cols), hormones, growth factors and cytokines, contain N-terminal Xaa-Pro sequences and are therefore potential substrates for XPNPEP2. And because Col contains a high proportion of this "triplet", XPNPEP2 has the potential for intracellular (lysosomal) degradation of Col fibrils. Given the possible role of the XPNPEP2 gene in animal growth performance, but less research on livestock, selecting individuals with good genotypes may significantly improve livestock growth efficiency and optimize breeding production. However, it is not clear what the relationship between the XPNPEP2 gene and sheep traits is.

[0004] The present invention sequences and analyzes the XPNPEP2 gene, determines SNPs, and explores the association between its different genotypes and traits related to sheep growth traits, aiming to provide a reference for sheep breeding and a genetic engineering method for breeding excellent sheep breeds. Summary of the invention

[0005] The object of the present invention is to provide a molecular marker related to the growth traits of sheep at different stages and its application. The molecular marker of the present invention is amplified from the sheep XPNPEP2 gene, and its specific nucleotide sequence is shown in SEQ ID NO.1. By amplifying the DNA sequence of the sheep XPNPEP2 gene and sequencing, the polymorphic sites of the XPNPEP2 gene are screened, so that a detection method for molecular markers related to the growth traits of sheep at different stages can be established, and the molecular marker can be applied to the breeding of fast-growing high-quality mutton sheep varieties.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] A molecular marker related to the growth traits of sheep at different stages. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein Y at the 95th bp is C or T, and the mutation leads to C / T polymorphism of the molecular marker.

[0008] The molecular markers described above are used in screening fast-growing sheep. When the genotype of the polymorphic site is TT type sheep individuals, their chest circumference and tube circumference at 80 days to 180 days of age are significantly higher than those of sheep individuals with CC genotype.

[0009] A primer pair for detecting the molecular markers related to the growth traits of sheep at different stages is used in screening fast-growing sheep. Preferably, the nucleotide sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0010] An application of AQP primers for detecting the above-mentioned molecular markers related to growth traits of sheep at different stages in screening fast-growing sheep. Preferably, the nucleotide sequences of the AQP primers are shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6.

[0011] A kit for detecting the above-mentioned molecular markers related to the growth traits of sheep at different stages is used in screening fast-growing sheep. Preferably, the kit comprises a common PCR primer pair or an AQP sequence pair, the nucleotide sequence of the common PCR primer pair is shown in SEQ ID NO.2 and SEQ ID NO.3; the nucleotide sequence of the AQP primer is shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6.

[0012] A method for detecting the above-mentioned molecular markers related to the growth traits of sheep at different stages, comprising the following steps:

[0013] 1) using the above-mentioned common PCR primer pair, AQP primer pair or a kit containing the above-mentioned primer pair to amplify sheep blood genomic DNA;

[0014] 2) Typing and identifying the polymorphic sites of the amplified product obtained in step 1).

[0015] Wherein, in step 2), the above-mentioned typing and identification methods include but are not limited to direct sequencing method, fluorescent probe method, gene chip method, and high-resolution melting curve method.

[0016] Furthermore, preferably, when a common PCR primer pair is used for amplification, the polymorphic sites of the amplified products are identified by direct sequencing.

[0017] Further, preferably, when the AQP primer pair is used for amplification, the typing result is checked by detecting the fluorescence signal.

[0018] The method as described above is used in screening fast-growing sheep. By analyzing the types of polymorphic sites, the chest circumference and tube circumference of sheep at different growth stages can be determined, and sheep with higher chest circumference and tube circumference growth can be screened out; the Y at the 95th bp of the identification amplification product as shown in the sequence SEQ IN NO.1 represents C or T, and the mutation leads to the T / C polymorphism of the molecular marker; the chest circumference and tube circumference of sheep carrying the TT genotype at 80 days of age to 180 days of age are significantly higher than those of sheep carrying the CC genotype, and the larger the chest circumference and tube circumference, the more meat production.

[0019] The molecular markers, PCR primer pairs for detecting molecular markers, AQP primers or the detection method of the kit as described above are used in sheep breeding. By using the primer pairs or kits to amplify and detect the genomic DNA of the sheep, the genotype of the molecular markers of the sheep to be tested is determined, so that fast-growing and high-meat-producing sheep breeds can be bred therefrom. Sheep carrying the TT genotype should be screened for breeding.

[0020] The beneficial effects of the present invention are:

[0021] The invention performs PCR amplification and sequencing on the XPNPEP2 gene of sheep, finds that there is a C / T polymorphic site at the 95th position of the sequence shown in the amplified fragment SEQ ID NO.1, and determines a molecular marker related to the growth traits of sheep at different stages by detecting the polymorphism of 740 Hu sheep and establishing a least squares model. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein Y at the 95th bp thereof is C or T, and the mutation leads to the C / T polymorphism of the molecular marker. When the genotype of the polymorphic site is TT type sheep individual, the chest circumference and the tube circumference of the sheep individual at the age of 80 days to 180 days are significantly higher than those of the sheep individual with the CC genotype. The invention is used for selecting TT homozygous sheep as breeding sheep during breeding, and is used for cultivating fast-growing and high-quality meat sheep with high meat yield, and provides gene materials for the genetic improvement of the growth traits of sheep, and has great practical application value.

[0022] The molecular markers related to the growth traits of sheep at different stages and the C / T polymorphic sites thereof provided by the present invention can effectively identify whether the sheep have fast growth in chest circumference and tube circumference by detecting the genotype of the polymorphic sites, thereby providing an effective detection means for the selection and breeding of fast-growing sheep. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The figure is a gel electrophoresis diagram of the amplified sheep LGALS3 gene fragment; wherein, lane M: DL 3000PlusMarker, lanes 1-10: amplification results of blood genomic DNA of ten sheep.

[0024] Figure 2 This is the sequencing result of the mutation site of the sheep XPNPEP2 gene in the present invention.

[0025] Figure 3 This is the AQPTM typing result of the mutation site g.113699247C> of the sheep XPNPEP2 gene in the present invention; among them, the blue point close to the left represents the CC genotype, the green point close to the middle represents the CT genotype, and the orange point close to the right represents the TT genotype. DETAILED DESCRIPTION

[0026] The following examples are used to further illustrate the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the present invention all belong to the scope of the present invention.

[0027] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise specified, the reagents used in the examples are of analytical grade or above.

[0028] Example 1 Amplification of XPNPEP2 gene

[0029] 1) Primer design

[0030] Using sheep XPNPEP2 gene DNA (GenBank accession number: NC_056080.1) as a template, a pair of primers, upstream primer F and downstream primer R, were designed using Oligo7.0 software. The primer sequences are as follows:

[0031] Upstream primer F (SEQ ID NO. 2): 5'-TTGGGCTCAATTATGGTCAC-3', downstream primer R (SEQ ID NO. 3): 5'-GGCTCTGGCTATTATTTCTCTG-3'

[0032] 2) Amplification and sequencing of the XPNPEP2 gene

[0033] Genomic DNA was extracted from the blood of 10 sheep as a template. The PCR reaction system used a 35 μL system, including: 17.5 μL of 2×PCR Master Mix, 1 μL of upstream primer F with a concentration of 10 μmol / L, 1 μL of downstream primer R with a concentration of 10 μmol / L, 1.5 μL of DNA template, 14 μL of ddH 2 O.

[0034] The PCR amplification program was as follows: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 52.5°C for 30 s, extension at 72°C for 60 s, 35 cycles, and final extension at 72°C for 10 min.

[0035] The PCR reaction product was detected by 1.5% agarose gel electrophoresis, and the results showed that a specific amplified fragment was obtained, such as Figure 1 The amplified PCR fragment was sequenced, and the sequencing results showed that the specific nucleotide sequence of the amplified fragment was as shown in SEQ ID NO.1, wherein there was a polymorphic site Y at the 95 bp position of the sequence, which was represented by C or T, that is, the amplified XPNPEP2 gene fragment had a C / T polymorphism at the 95 bp position as shown in SEQ ID NO.1. By using SeqMan software to compare the amplified XPNPEP2 gene fragments of 10 sheep, it was found that Figure 2 shown.

[0036] SEQ ID NO.1: TTGGGCTCAATTATGGTCACGGGACAGGCCATGGC ATTGGCAACTTCCTATGTGTGCACGAGTTGTAGGTATCTCTTTGGCACTCCCCTGCAGTCYCCCCTTATGAGAGAGGCAGAGTATTTCACAGGTATGGAAAGGACTGGGACCCGTGGAGGGGCAGTGACCCAGGCCAGGGGACCCAGCT GGTGGGAAGTTGGTGCTCCACAGGGTAAGTGAGAAATGCTGGCAGTTGGCCACTCCAACTGGCATCCAGGATGGGTCCAGAAAGAAGAGAGGCAGGTCAAGACACAGTGGCTGACTGGCCTAGACCCCAGAGAAATAATAGCCAGAGCC.

[0037] (3) DNA sequence homology search and identification:

[0038] The DNA sequence obtained after sequencing was compared with the known physiological function genes published in the GenBank database by BLAST (Basic Local Alignment Search Tool) software on the website of the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) to identify and obtain the functional information of the DNA sequence. The search results showed that the sequence was 99% identical to the partial sequence of the sheep XPNPEP2 gene DNA (GenBank accession number: NC_056080.1).

[0039] Example 2 Establishment of genotyping detection method

[0040] (1) Primer sequence design

[0041] Design of AQP for the C / T polymorphic site of the amplified fragment in Example 1 TM Primer pair, thereby used for specific detection of the polymorphic site, the AQP TM The nucleotide sequences of the primer pairs are:

[0042] Forward primer A1 (SEQ ID NO.4) for detecting AlleleT:

[0043] 5′-GAAGGTGACCAAGTTCATGCTTGGCACTCCCCTGCAGTCT-3′;

[0044] Forward primer A2 for detecting AlleleC (SEQ ID NO.5):

[0045] 5′-GAAGGTCGGAGTCAACGGATTTTGGCACTCCCCTGCAGTCC-3′;

[0046] Universal reverse primer C (SEQ ID NO. 6): 5'-CGGGTCCCAGTCCTTTCCAT A-3'.

[0047] The above primers were synthesized by Beijing Shenggong Biotechnology Co., Ltd. TM Each set of primers in the primer pair was diluted to 100 μmol / L for use.

[0048] (2) Extracted genomic DNA and performed quality control

[0049] To extract genomic DNA from sheep blood, a DNA extraction kit can be used. The quality of the extracted genomic DNA is tested by 1% agarose electrophoresis and Nanodrop2100, respectively. The DNA is required to meet the following requirements: (1) Agarose electrophoresis shows a single DNA band without obvious diffusion. (2) Nanodrop2100 detection A260 / 280 is between 1.8-2.0; A260 / 230 is between 1.8-2.0; there is no obvious light absorption at 270nm. If it does not meet the requirements, the genomic DNA should be re-extracted. According to the AQP of Beijing Jiacheng Biotechnology Co., Ltd. TM The detection technology and genome size are used to calculate the DNA dosage to be 2-50 ng / sample. The extracted genomic DNA is diluted to a concentration of 2-50 ng / μL and used as a DNA template.

[0050] (3) Genotyping

[0051] First, the above AQP TM Each primer in the primer pair (100 μmol / L) was mixed with sterile water in a volume ratio of 12:12:30:46 (primer A1:primer A2:primer C:sterile water) to prepare a primer mixture for use.

[0052] Then, use a pipette to add 0.07 μL of primer mixture, 0.5 μL of sterile water, 2.5 μL of HiGeno 2xProbe Mix, and 2 μL of diluted DNA template (2-50 ng / μL) to each well of the 384-well plate. After adding, seal the membrane, oscillate and centrifuge, and place on the C1000TouchTM Thermal Cycler instrument for PCR amplification.

[0053] The specific procedures are:

[0054] Pre-denaturation at 95°C for 10 minutes;

[0055] 95℃, 20 seconds (denaturation) - 61℃-55℃, 40 seconds (renaturation & extension), amplification for 10 cycles, reducing 0.6℃ each cycle;

[0056] Amplification was continued for 34 cycles from 95°C, 20 seconds (denaturation) to 55°C, 40 seconds.

[0057] After amplification, the fluorescence signal was detected at 37°C using the C1000 TouchTM Thermal Cycler instrument to check the typing status. The test results of some samples are as follows: Figure 3 As shown. With HEX as the horizontal axis and FAM as the vertical axis, each figure in the figure represents a test material, where the blue square near the left side indicates that the site is a homozygous genotype "CC"; the green triangle near the middle indicates that the site is a heterozygous genotype "CT"; the orange dot near the right side indicates that the site is a homozygous genotype "TT".

[0058] (4) Application of the molecular markers of the present invention in sheep growth trait marker-trait association analysis

[0059] A total of 740 Hu sheep were tested for polymorphism, their genotypes were determined, and the least squares model described below was established to conduct association analysis between genotype and growth traits.

[0060] Y ijkl =μ+Genotype i +P j +F k +M l +ε ijkl

[0061] Among them, Y ijkl is the observed value of the trait, μ is the overall mean, and Genotype i is the genotype effect, P j is the batch effect, F k is the paternal effect, M l is the maternal effect, ε ijkl is a random error, assuming that ε ijlmk Independent of each other, subject to N(0,σ 2 )distributed.

[0062] The results of genotype detection showed that among the 740 individuals, there were 375 individuals with CC genotype, 76 individuals with CT genotype, and 289 individuals with CC genotype. The results of the association analysis between genotype and traits are shown in Table 1. Among them, the chest circumference at 80 days of age refers to the chest circumference length of the sheep when it grows to 80 days of age, and the tube circumference at 80 days of age refers to the tube circumference length of the sheep when it grows to 80 days of age; by analogy, the chest circumference is the vertical circumference of the chest measured at the posterior angle of the shoulder ribs, and the tube circumference refers to the horizontal circumference measured at the upper third of the forearm bone of the left forelimb.

[0063] Table 1 Association analysis between XPNPEP2 gene polymorphism and growth traits in sheep

[0064]

[0065] Note: Data in the same row with different lowercase letters indicate significant differences (P<0.05), while data with the same lowercase letters indicate no significant differences (P>0.05).

[0066] The results showed that the XPNPEP2 g.113699247C>T mutation site, which is the C / T mutation site at the 95bp position shown in the sequence SEQ ID NO.1, was significantly correlated with sheep growth traits (birth weight, chest circumference, tube circumference) (P<0.05). The chest circumference and tube circumference of individuals carrying the TT genotype were significantly higher than those of individuals with the CC genotype. As important production performance, chest circumference and tube circumference are closely related to meat production. The larger the chest circumference and tube circumference, the greater the meat production. Therefore, individuals with the TT genotype can be used as breeding sheep during breeding to cultivate fast-growing sheep with excellent meat quality and high meat production.

Claims

1. A molecular marker associated with growth traits at different stages of sheep, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein Y at the 95th bp is C or T, and the mutation leads to C / T polymorphism of the molecular marker.

2. Use of the molecular markers associated with growth traits of sheep at different stages as described in claim 1 in screening fast-growing sheep.

3. Use of the primer pair for detecting the molecular markers related to the growth traits of sheep at different stages as claimed in claim 1 in screening fast-growing sheep, characterized in that: The sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.

3.

4. Use of the AQP primers for detecting the molecular markers related to the growth traits of sheep at different stages as claimed in claim 1 in screening fast-growing sheep, characterized in that: The nucleotide sequences of the AQP primers are shown in SEQ ID NO.4-SEQ ID NO.

6.

5. Use of a kit for detecting molecular markers associated with growth traits of sheep at different stages according to claim 1 in screening fast-growing sheep, characterized in that: The kit comprises a common PCR primer pair or an AQP sequence pair. The nucleotide sequence of the common PCR primer pair is shown in SEQ ID NO.2 and SEQ ID NO.3; the nucleotide sequence of the AQP primer is shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.

6.

6. Use of the method for detecting molecular markers associated with growth traits of sheep at different stages according to claim 1 in screening fast-growing sheep, characterized in that: It includes the following steps: 1) using the above-mentioned common PCR primer pair, AQP primer pair or a kit containing the above-mentioned primer pair to amplify sheep blood genomic DNA; 2) Typing and identifying the polymorphic sites of the amplified product obtained in step 1).

7. The use according to claim 6, characterized in that When common PCR primer pairs are used for amplification, the polymorphic sites of the amplified products are identified by direct sequencing.

8. The use according to claim 6, characterized in that When the AQP primer pair is used for amplification, the typing results are checked by detecting the fluorescent signal.

9. The use according to claim 6, characterized in that The chest circumference and tube circumference of sheep carrying TT genotype at 80-180 days of age were significantly higher than those of sheep carrying CC genotype.

10. Use of the molecular markers related to the growth traits of sheep at different stages, the PCR primer pairs or AQP primers or the kit for detecting the molecular markers related to the growth traits of sheep at different stages as claimed in claim 1 in sheep breeding, characterized in that: The breeding is for selecting fast-growing sheep, the nucleotide sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.3; the nucleotide sequences of the AQP primers are shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, the kit includes the PCR primer pair or the AQP primer, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein the Y at the 95th bp represents C or T, and the mutation leads to the C / T polymorphism of the molecular marker; sheep with TT genotype are screened for breeding.

Images