Molecular markers for identifying peanut bacterial wilt and their application in assisted breeding
By constructing recombinant inbred line populations and secondary populations, locating and identifying the key disease-resistance gene AhBWR1 for peanut bacterial wilt, and transforming it into tobacco, the problem of high cost and poor effect of peanut bacterial wilt prevention and control was solved, and efficient disease-resistant breeding and identification was achieved.
Patent Information
- Application Number
- CN202411992436.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-31
- Publication Date
- 2025-10-21
- Estimated Expiration
- 2044-12-31
AI Technical Summary
In the existing technology, the prevention and control of peanut bacterial wilt is costly and ineffective, and there is a lack of effective disease-resistant gene resources, especially the cloning and application of CC-NBS-LRR genes.
By constructing recombinant inbred line populations and secondary populations, the QTL locus for peanut bacterial wilt resistance was located, the KASP molecular marker was developed, the key disease resistance gene AhBWR1 was identified, and it was genetically transformed into tobacco to enhance its resistance to bacterial wilt.
It has achieved efficient identification and resistance breeding of peanut bacterial wilt, provided important genetic resources and molecular markers, provided effective disease resistance auxiliary means for peanut breeding, and improved tobacco's resistance to bacterial wilt.
Smart Images
Figure CN119662888B_ABST
Abstract
Description
Technical Field
[0001] The invention relates to a molecular marker for identifying peanut bacterial wilt and an application thereof in assisted breeding, and belongs to the field of molecular biology. Background Art
[0002] Cultivated peanut (Arachis hypogaea L.) is an important economic and oilseed crop and a significant source of edible vegetable oil and plant protein in my country. Peanut bacterial wilt is one of the most serious soil-borne bacterial diseases affecting peanut production. The disease has affected over 10% of the country's peanut-cultivated area, primarily in central and southern peanut-producing regions. It can cause yield reductions of 10% to 30%, and in severe cases, yield reductions of over 50% or even total crop failure, severely hindering the sustainable development of the peanut industry. With global warming, peanut bacterial wilt is spreading to northern production areas. Chemical and biological control methods are commonly used in production, but these methods are costly and ineffective. Therefore, identifying wilt-resistant genes and breeding wilt-resistant varieties can address the problem of peanut wilt at its source, making it a top priority and the most cost-effective measure for preventing and controlling the disease.
[0003] Currently, most cloned disease-resistance genes in plants belong to the NBS-LRR class. NBS-LRRs are the largest class of disease-resistance proteins in plants and play a crucial role in defending against pathogens. NBS-LRR proteins can be divided into two main categories, TIR-NBS-LRR and CC-NBS-LRR, based on differences in their N-termini. While QTLs and genes associated with bacterial wilt in peanut have been reported, few have identified CC-NBS-LRR genes associated with bacterial wilt resistance through forward genetics QTL mapping. Summary of the Invention
[0004] In view of the deficiencies in the prior art, the present invention provides a molecular marker for identifying peanut bacterial wilt and its application.
[0005] This study used a population of recombinant inbred lines and a secondary population created by crosses between recombinant individual plants to locate a QTL locus for peanut bacterial wilt resistance. The main QTL was narrowed to a 147-kb interval. Transcriptome data analysis was combined to predict the key resistance gene, AhBWR1. This gene was then genetically transformed into the tobacco variety Honghua Dajinyuan, susceptible to bacterial wilt. Phenotypic analysis of the transgenic plant demonstrated that AhBWR1 enhanced tobacco's resistance to bacterial wilt.
[0006] In order to achieve the above object, the technical solution adopted by the present invention is:
[0007] The site of a peanut bacterial wilt resistance molecular marker is A12_4323949, located at 4323949bp on peanut chromosome 12. The 200bp sequences before and after [A] and [G] of the site are: SEQ ID NO.7 and SEQ ID NO.8.
[0008] The KASP primer composition for amplifying the molecular marker comprises:
[0009] A12_4323949_F1:5'-TGCTTCAACCACTCATCTATACTGC-3',
[0010] A12_4323949_F2:5'-GTTGCTTCAACCACTCATCTATACTGT-3',
[0011] A12_4323949_com:5'-CAAGAGATTGCTCTGGCATGC-3'.
[0012] The application of the gene AhBWR1 encoding the peanut NBS-LRR bacterial wilt resistance protein overexpression in plant bacterial wilt resistance genetic engineering, the nucleotide sequence of the gene AhBWR1 is shown in SEQ ID No.1.
[0013] The amino acid sequence of the protein encoded by the gene AhBWR1 is shown in SEQ ID No.2.
[0014] An expression vector for the gene AhBWR1 encoding peanut bacterial wilt resistance NBS-LRR.
[0015] Application of a peanut NBS-LRR-encoded protein AhBWR1 in plant bacterial wilt resistance genetic engineering.
[0016] An application of the AhBWR1 expression vector in plant bacterial wilt resistance genetic engineering.
[0017] An application of the peanut bacterial wilt resistance molecular marker in plant bacterial wilt resistance: if the typing result of the peanut material molecular marker A12_4323949 site is A:A, the material is resistant to bacterial wilt; if the typing result of the peanut material molecular marker A12_4323949 site is G:G or / : / , the material is susceptible to bacterial wilt, and the plants include but are not limited to tobacco and peanut.
[0018] Beneficial effects of the present invention:
[0019] The present invention utilizes peanut recombinant inbred line populations and constructed secondary populations to locate QTLs for bacterial wilt resistance genes, develops KASP markers tightly linked to resistance, and identifies genes related to bacterial wilt resistance, which are applied to peanut bacterial wilt resistance-assisted breeding, providing important marker detection and gene resources for peanut bacterial wilt breeding.
[0020] The present invention uses recombinant individual plants selected from a recombinant inbred line population as parents to prepare a secondary population, further narrowing the previously mapped interval from 216.7 kb to 147 kb. Analysis of genes within this interval, combined with acquired transcriptome data, revealed the NBS-LRR-encoded resistance gene AhBWR1, which is tightly linked to peanut bacterial wilt resistance. This gene was genetically transformed into the tobacco variety Honghua Dajinyuan, resulting in transgenic lines with enhanced resistance to the disease. This gene provides an important theoretical basis for elucidating the molecular mechanisms of peanut resistance and a valuable genetic resource for plant resistance to the disease.
[0021] The KASP molecular marker tightly linked to bacterial wilt resistance of the present invention can identify peanut germplasms with bacterial wilt resistance of different genetic backgrounds and can be applied to peanut bacterial wilt resistance molecular assisted breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 Schematic diagram of recombinant individual plants in the secondary F4 population;
[0023] Figure 2 Collinearity analysis of the qBWA12 interval reference genome sequence and the Yuanza9102 genome sequence;
[0024] Figure 3 Heat map of R1 and S1 transcript expression within the bacterial wilt resistance QTL interval;
[0025] Figure 4 Genotypic and phenotypic identification of transgenic tobacco;
[0026] Figure 5 Linkage between molecular marker A12_4323949 and bacterial wilt resistance in 353 natural populations. DETAILED DESCRIPTION
[0027] The specific embodiments of the present invention are further described in detail below with reference to the examples.
[0028] Example 1 Obtaining the bacterial wilt resistance candidate gene AhBWR1
[0029] (1) Using Yuanza 9102 (female parent) and wt09-0023 (male parent) as parents, an F family consisting of 521 families was constructed by single seed transmission. 8：10Recombinant inbred line population. A major QTL for bacterial wilt resistance, qBWA12, was mapped using a recombinant inbred line population constructed by hybridizing Yuanza 9102 and wt09-0023. The physical interval size was 216.7 kb (Qi et al., 2022). Most of the genes in this interval are NBS-LRR disease resistance genes with high sequence homology, making it impossible to further explore disease resistance genes. To narrow the QTL interval, two recombinant plants with opposite bacterial wilt resistance, P474 (resistant to bacterial wilt) and P790 (susceptible to bacterial wilt), were selected from the recombinant inbred line population and hybridized to obtain a secondary population. Based on the genotypes of the parents of the secondary population, 10 KASP molecular markers were further developed within the major QTL interval (Table 1);
[0030] Table 1 KASP molecular markers, primers and their sequences developed based on the secondary population constructed from recombinant individual strains
[0031]
[0032]
[0033] The 10 KASP molecular markers were well-typed in the secondary F2 population, with nearly 50% of the offspring being heterozygous. Based on the typing results, individual plants that underwent recombination within the major effect QTL were screened. When the genotype in the qBWA12 interval was heterozygous, the strain showed sensitivity to Ralstonia solanacearum. Therefore, the recombinant plants were added to the F4 generation, and the genotype and phenotype of the harvested F4 seeds were identified.
[0034] The results showed that when the genotype of F4 between the two markers A12_4323949 and A12_4471816 was heterozygous or the same as the susceptible parent's genotype, the phenotype was susceptible to bacterial wilt, while when it was consistent with the resistant parent's genotype, it was resistant to bacterial wilt, thus further narrowing the interval to 147kb. Based on the genotype of F4, it was found that the two markers were linked and no further recombination occurred within the interval ( Figure 1 ).
[0035] (2) Due to the poor collinearity between Tifrunner and Yuanza9102 genome sequences in the target interval, e.g. Figure 2As shown, the horizontal axis represents the physical position of the Tifrunner genome on chromosome A12 is 4180207-4442239; the vertical axis represents the physical position of the YZ9102 genome on chromosome A12 is 4156572-4330807. It can be seen that the sequence collinearity is good in the interval of 1-100000 on the horizontal and vertical axes, and is in a linear relationship; while the sequence collinearity is poor in the interval of 100000-160000 on the vertical axis, and there are repeated sequences in the sequence of the Tifrunner genome, which are projected on the same position of the YZ9102 genome; the sequence collinearity is poor, and it is impossible to further encrypt the markers and thus narrow the interval. Combined with the three-generation full-length transcriptome data obtained in the early stage, the gene expression in the main effect QTL interval was analyzed. A total of 9 genes were expressed in the resistant or susceptible materials in the QTL interval, of which 4 genes were expressed in both resistant and susceptible materials. The sequences of the two genes arahy.WQJN9J and arahy.MXY2PU in the resistant and susceptible materials were quite different, with similarities of only 36.86% and 59.2% (Table 2).
[0036] (3) To further analyze the expression of genes within the QTL interval after infection with R. solanacearum, the root gene expression changes were analyzed at 0h, 12h, 24h, 48h, and 72h after inoculation. In the resistant materials (Y and R), the expression levels of arahy.V6I7WA (transcript_HQ_R1_transcript146742 / f1p0 / 2707) and arahy.MXY2PU (transcript_HQ_R1_transcript12461 / f3p0 / 3204) changed after inoculation, indicating that arahy.V6I7WA and arahy.MXY2PU were induced by R. solanacearum and these two genes may be related to resistance to R. solanacearum ( Figure 3 ).
[0037] Table 2 Transcripts corresponding to reference genome gene IDs in R1 and S1
[0038]
[0039] Note: In Table 2, transcript names are displayed, indicating that the gene is expressed in R1 or S1; those without names indicate that the gene is not expressed in R1 or S1.
[0040] Combined with the above mapping results, arahy.MXY2PU is located within the 147 kb mapping interval, so arahy.MXY2PU was identified as a candidate gene for bacterial wilt resistance. Because this gene may be associated with peanut bacterial wilt resistance, it was named AhBWR1 (bacterial wilt resistant 1).
[0041] Example 2 Cloning and Functional Verification of the Bacterial Wilt Resistance Gene AhBWR1
[0042] (1) Using the third-generation full-length transcript sequence transcript_HQ_R1_transcript12461 / f3p0 / 3204 in Table 2 as a reference, Editseq software was used to predict that the ORF length of the AhBWR1 gene was 2460 bp (SEQ ID NO. 1), and its corresponding amino acid sequence contained 820 amino acids (SEQ ID NO. 2). This sequence was unique to Yuanza 9102, and its primer sequence was
[0043] AhBWR1-F1: 5'-TTCTTTCATGTTCTTTGGCTTT-3' (SEQ ID NO.3),
[0044] AhBWR1-R1: 5'-CACCACATCTAACTCAAAATCTTAA-3' (SEQ ID NO.4),
[0045] Using Yuanza9102 cDNA as a template, the ORF sequence of AhBWR1 (SEQ ID NO.1) was cloned. The sequence contained Rx-N, NB-ARC and PLN03210 domains and belonged to the CC-NBS-LRR (CNL) class of disease resistance proteins.
[0046] (2) The ORF of AhBWR1 was connected to the overexpression vector 35S:AhBWR1 and transformed into the tobacco variety Honghua Dajinyuan, which is susceptible to bacterial wilt, through the leaf disc method to obtain transgenic seedlings. After one generation of propagation, the resistance of T1 generation to bacterial wilt was identified.
[0047] Identification of gene expression: RNA was extracted from leaves of tobacco T0 seedlings and reverse transcribed into cDNA. The expression levels of AhBWR1 in different strains OE#1, OE#2, and OE#3 were determined using tobacco GAPDH as the internal reference gene (NtGAPDH-F: AGCTCAAGGGAATTCTCGATG (SEQ ID NO. 5), NtGAPDH-R: AACCTTAACCATGTCATCTCCC (SEQ ID NO. 6)).
[0048] The results showed that AhBWR1 was expressed in OE#1, OE#2 and OE#3 strains, with the highest expression level in OE#2 strain ( Figure 4 A).
[0049] Identification of tobacco bacterial wilt: When tobacco plants reach the five-six true leaf stage, inoculate with R. solanacearum using the root wound method. Wild-type controls are treated with sterile water. Survival rates are calculated 20 days after inoculation (survival rate = number of surviving plants / total number of plants).
[0050] The results showed that the survival rates of OE#1-3 strains were higher than those of the control ( Figure 4 B, C), indicating that transgenic AhBWR1 can improve tobacco resistance to Ralstonia solanacearum.
[0051] Figure 4 Middle: A: Fluorescence quantitative PCR detection of transgenic tobacco lines; OE#1, OE#2, and OE#3 represent overexpression lines; B: Survival rate of transgenic lines and wild-type lines after inoculation with Ralstonia solanacearum; C: Phenotypes of transgenic lines and wild-type lines after inoculation with Ralstonia solanacearum.
[0052] Example 3 Validation of KASP markers in natural populations
[0053] The peanut bacterial wilt resistance molecular marker is A12_4323949, located at 4323949bp on peanut chromosome 12. The 200bp sequence before and after this site is:
[0054] CTAGGTTGTTTTCACTAATTCTCCAATGGCTGAAGTTGTTTCTGGTGTGGCATCAACACTCTTAGGCAATTTAGCAACAAAATCTTTTCAAGAGATTGCTCTGGCATGCGGTCTTAAAGATGATGTAAAAAACTTTGAAAGTTCTTTGAGAACCATCAAAGCATATCTCATAAATGCTGAGAACAAGCAAGCAAAAAACC
A
G
[0055] The primers for identifying bacterial wilt resistance using KASP markers are:
[0056] A12_4323949_F1: 5’-TGCTTCAACCACTCATCTATACTGC-3’(SEQ ID NO.9)
[0057] A12_4323949_F2:5'-GTTGCTTCAACCACTCATCTATACTGT-3'(SEQ ID NO.10)
[0058] A12_4323949_com:5'-CAAGAGATTGCTCTGGCATGC-3' (SEQ ID NO. 11).
[0059] The KASP primers used were synthesized by LGC in the UK and included three sequences: FAM, HEX, and universal primers. Genotyping was performed using the SNPline LGC high-throughput genotyping platform (repliKator fully automated DNA plate replication workstation, Kube TM Thermal sealer, Fusion3 TM Laser sealer, Hydrocycler2 TM Water bath PCR thermal cycler, Pherastar SNP typing detector, etc.).
[0060] PCR amplification system: 2 μL template DNA (20 ng / μL) was dispensed into a 1536-well plate, and the plate was placed in a 65°C oven to dry the liquid. Then, 0.02 μL KASP primer mix and 0.98 μL KASP mix were added.
[0061] Amplification protocol: 94°C pre-denaturation for 15 minutes; 10 cycles of denaturation at 94°C for 20 seconds, annealing at 61°C for 15 seconds, decreasing the annealing temperature by 0.6°C each cycle until it reaches 55°C; 26 cycles of denaturation at 94°C for 20 seconds, annealing at 55°C for 60 seconds. At the end of the PCR amplification protocol, the 1536 plate was placed in the Pherastar SNP typing instrument, and SNP typing was performed based on the fluorescence signal ratio.
[0062] To verify the ability of the molecular marker A12_4323949 primers to identify bacterial wilt-resistant germplasm in natural populations, a linkage analysis was performed between genotypes and phenotypes of 353 natural populations. This population, comprised of farm varieties, developed cultivars, and intermediate breeding materials from 27 countries and 18 provinces in my country, included five types: the common type (var. hypogaea, hyp) (183 accessions), the dragon-born type (var. hirsuta, hir) (12 accessions), the multi-seed type (var. fastigiata, fas) (26 accessions), the pearl bean type (var. vulgaris, vul) (130 accessions), and the Peruvian type (var. peruviana, peru) (2 accessions).
[0063] The KASP molecular markers developed above were validated using 353 natural populations to obtain genotype data, which were then linked to the bacterial wilt resistance phenotypic results for linkage analysis.
[0064] 353 natural populations were planted in naturally infected bacterial wilt nurseries for two consecutive years (2019 and 2020), and the survival rates at the harvest period were investigated. The survival rates at the harvest period were jointly analyzed with the KASP molecular marker results.
[0065] Results showed that the KASP molecular marker A12_4323949 typing results were most closely linked to the bacterial wilt resistance phenotype. Using Tifrunner as the reference genome, a G typing result at position 4323949 on chromosome A12 indicates consistency with the reference genome, with a G:G genotype; an A:A typing result indicates a homozygous variant at that locus. The A:A boxplot for the typing results of marker A12_4323949 showed a high median, indicating that all resistant germplasm could be identified. The AhBWR1 gene corresponds to Chr12:4423482-4426655 in the Tifrunner reference genome. The physical distance between the A12_4323949 locus and AhBWR1 is 99 kb, and the AhBWR1 gene is located within the 147 kb interval previously mapped. If the typing result of the A12_4323949 site is A:A, the natural population material is resistant to bacterial wilt; if the typing result of the A12_4323949 site is G:G and / : / , the natural population material is susceptible to bacterial wilt, see Figure 5 .
Claims
1. A molecular marker for peanut resistance to bacterial wilt, characterized in that: The site of the molecular marker is A12_4323949, located at 4323949 bp on peanut chromosome 12. The site is [A] or [G]. The sequence of the molecular marker is: CTAGGTTGTTTTCACTAATTCTCCAATGGCTGAAGTTGTTTCTGGTGTGGCATCAACACTCTTAGGCAATTTAGCAACAAAATCTTTTCAAGAGATTGCTCTGGCATGCGGTCTTAAAGATGATGTAAAAAAACTTTGAAAGTTCTTTGAGAACCATCAAAGCATATCTCATAAATGCTGAGAACAAGCAAGCAAAAAACC【 A】CAGTATAGATGAGTGGTTGAAGCAACTCAGAGAAGCATTTGATGATGCTGGTGACATATTAGATGAAATAGAGTATGAAGCAAAACTTAATGAAGTGGTCAAAATGTATGGAAGCATTAGCATAAAGGTCCGTCGATTCTTCTCATACACAAGTAATCCACTCGCATTTCGCATCAAGATGGCCCACAAAATCAAAGATA and CTAGGTTGTTTTCACTAATTCTCCAATGGCTGAAGTTGTTTCTGGTGTGGCATCAACACTCTTAGGCAATTTAGCAACAAAATCTTTTCAAGAGATTGCTCTGGCATGCGGTCTTAAAGATGATGTAAAAAAGTTTGAAAGTTCTTTGAGAACCATCAAAGCATATCTCATAGATGCTGAGAACAAGCAAGCAAAAAACC【G 】CAGTATAGATGAGTGGTTGAAGCAACTCAGAGAGGCATTTGATGATGCTGGTGACATATTAGATGAAATAGAGTATGAAGCAAAACTTAATGAAGTGGTCAAAATGTATGGAAGCATTAGCACGAAGGTTCGCCGATTCTTCTCATACACAAGTAATCCACTTGTATTTCGCATCAAAATGGCCCACAAAATCAAAGATA.
2. A KASP primer combination for amplifying the molecular marker according to claim 1, characterized in that: The KASP primer composition comprises: A12_4323949_F1: 5'-TGCTTCAACCACTCATCTATACTGC-3' A12_4323949_F2: 5'-GTTGCTTCAACCACTCATCTATACTGT-3' A12_4323949_com: 5'-CAAGAGATTGCTCTGGCATGC-3'.
3. Overexpression of the gene encoding the peanut NBS-LRR bacterial wilt resistance protein AhBWR1 Application of gene engineering in tobacco resistance to bacterial wilt AhBWR1 The nucleotide sequence is shown in SEQ ID No.
1.
4. The use according to claim 3, characterized in that: The gene AhBWR1 The amino acid sequence of the encoded protein is shown in SEQ ID No.
2.
5. Use of the peanut bacterial wilt resistance molecular marker according to claim 1 in identifying peanut bacterial wilt resistance, characterized in that: If the typing result of the peanut material molecular marker A12_4323949 site is A:A, the material is resistant to bacterial wilt; if the typing result of the peanut material molecular marker A12_4323949 site is G:G, the material is susceptible to bacterial wilt.