Reagent and kit for LAMP visual detection of PRRSV and application

Abstract

The invention belongs to the technical field of virus detection reagents, and particularly relates to a reagent and a kit for visually detecting PRRSV (porcine reproductive and respiratory syndrome virus) through LAMP (loop-mediated isothermal amplification) and application. The reagent for the LAMP visual detection of the PRRSV comprises an outer primer F3, an outer primer B3, an inner primer FIP, an inner primer BIP, a loop primer LF and a loop primer LB. When being used for detecting the PRRSV, the reagent not only has the sensitivity and specificity of RT-PCR (Reverse Transcription-Polymerase Chain Reaction), but also is shorter in detection time, more convenient to operate and lower in cost compared with the RT-PCR, can greatly improve the detection efficiency and save the cost, is easier to popularize to various large, medium and small farms, and realizes the field detection of the PRRSV. Therefore, the method can provide a new solution strategy for realizing the normalized monitoring of the PRRSV, and also can provide practical guidance for timely discovering the infection condition of the PRRSV, guiding the formulation of intervention measures and integrally preventing and controlling the PRRSV.

Description

Technical Field

[0001] The invention belongs to the technical field of virus detection reagents, and in particular, relates to reagents, kits and applications for LAMP visualized detection of PRRSV. Background Art

[0002] Porcine reproductive and respiratory syndrome virus (PRRSV) belongs to the genus Arterivirus in the family Arteriviridae. It is the pathogen of porcine reproductive and respiratory syndrome (PRRS). Its main clinical features are abortion, premature birth, stillbirth, weak fetuses, mummies in pregnant sows, and respiratory symptoms in piglets and fattening pigs. It is a highly contagious disease and one of the most important diseases endangering the development of the global pig industry.

[0003] At present, although a lot of research has been done on the pathogenicity, immune response induction and immune escape mechanisms of PRRSV, and a series of vaccines have been developed, since PRRSV mainly infects macrophages, causing immune suppression in the body, and there is antibody-dependent enhancement (ADE), vaccination cannot effectively eliminate all viruses, and the disease is still far from being effectively controlled. Therefore, it is necessary to establish a method for rapid diagnosis of porcine reproductive and respiratory syndrome for the monitoring and prevention of porcine reproductive and respiratory syndrome epidemics.

[0004] At present, the monitoring of PRRSV in clinical practice mainly includes two aspects. One is the detection of PRRSV antibody levels, but the antibody can only be detected 10 days after the virus infection, which is not time-effective; the second aspect is the detection of PRRSV pathogens, which can detect animal infection in a timely manner, thereby facilitating timely response measures and reducing losses. Many domestic scholars have established PCR or fluorescent PCR methods for detecting PRRSV. Among them, RT-PCR technology is the most commonly used molecular biological detection method, but it requires the configuration of special instruments and equipment and more complicated reaction procedures, and it takes a long time. It is not convenient for daily monitoring of farmers or farms, and cannot be used for clinical rapid detection in remote or backward areas where PRRS occurs.

[0005] Loop-mediated isothermal amplification (LAMP) is an optional detection method for PRRSV. LAMP is a new type of nucleic acid amplification technology proposed by NOTOMI et al. This technology is a method of designing 4 to 6 specific primers for 6 regions of the target gene (F3c, F2c, F1c region at the 3' end and B1, B2, B3 region at the 5' end), using a strand displacement DNA polymerase (Bst DNA polymerase) to quickly amplify nucleic acids at a constant temperature. The turbidity of the amplification byproduct magnesium pyrophosphate precipitation can be directly used to determine whether a reaction has occurred. There is no need for long-term temperature cycles of special instruments and agarose gel electrophoresis ultraviolet observation and other operations. The test results can be observed by the naked eye. However, since PRRSV is very easy to mutate and is difficult to detect, the current method of detecting PRRSV by loop-mediated isothermal amplification technology has the problem of low specificity, and the existing detection methods usually take 1 to 2 hours to complete the detection, which is too time-consuming, not conducive to improving the detection efficiency, and cannot meet the needs of rapid detection of PRRSV. Summary of the invention

[0006] To solve the above problems, one of the purposes of the present invention is to provide a LAMP visualized detection reagent for PRRSV, which can achieve simple, rapid and sensitive detection of PRRSV, thereby providing a simple, rapid and sensitive method for rapid detection of PRRSV in clinical practice.

[0007] The second object of the present invention is to provide the application of the above-mentioned LAMP visualized detection reagent for PRRSV.

[0008] The third object of the present invention is to provide a kit for LAMP visualization detection of PRRSV.

[0009] To achieve the above object, in the first aspect of the present invention, the technical solution adopted is:

[0010] A reagent for LAMP visualization detection of PRRSV, the reagent comprising outer primers F3 and B3, inner primers FIP and BIP, loop primers LF and LB, and also comprising a PRRSV cDNA template, DNA polymerase, magnesium sulfate, dNTPMix and a visualization dye;

[0011] Among them, the nucleotide sequence of the external primer F3 is shown as SEQ ID NO.1; the nucleotide sequence of the external primer B3 is shown as SEQ ID NO.2; the nucleotide sequence of the internal primer FIP is shown as SEQ ID NO.3; the nucleotide sequence of the internal primer BIP is shown as SEQ ID NO.4; the nucleotide sequence of the loop primer LF is shown as SEQ ID NO.5; and the nucleotide sequence of the loop primer LB is shown as SEQ ID NO.6.

[0012] As a preferred solution, the reagent also includes 10×Thermopol buffer and nuclease-free water.

[0013] As a preferred solution, the DNA polymerase is Bst 3.0 DNA polymerase.

[0014] As a preferred solution, the visualization dye is SYBR Green I. The use of this dye can obtain the best visualization detection effect.

[0015] As a preferred solution, the reagent is used for LAMP visual detection of PRRSV, and the detection process includes the following steps: extracting genomic DNA of the sample to be tested, using the reagent for LAMP visual detection of PRRSV to construct a reaction system for loop-mediated isothermal amplification, adding a visual dye after amplification, observing the turbidity change results, and determining whether PRRSV is infected.

[0016] As a preferred solution, the reaction system includes the following components and dosages: 1 μL of 8000U / mL DNA polymerase, 2.5 μL of 10×Thermopol buffer, 1.5 μL of 100mmol / L magnesium sulfate, 2 μL of 10mmol / L dNTP Mix, 0.25 μL of 10μmol / L outer primer F3 and outer primer B3, 4 μL of 10μmol / L inner primer FIP and inner primer BIP, 1.5 μL of 10μmol / L loop primer LF and loop primer LB, 3 μL of PRRSV cDNA template, and nuclease-free water is added to 25 μL.

[0017] The reagent for LAMP visual detection of PRRSV provided by the present invention can directly judge whether a reaction occurs by the turbidity of the amplification byproduct magnesium pyrophosphate precipitation, without the need for long-term temperature cycling of special instruments and operations such as agarose gel electrophoresis ultraviolet observation, and the detection result can be observed only by naked eyes, which greatly simplifies the detection process of PRRSV.

[0018] As a preferred solution, the reaction temperature of the loop-mediated isothermal amplification is 61° C. and the reaction time is 40 min.

[0019] As a preferred solution, the sample to be tested is a pig serum sample.

[0020] The second aspect of the present invention adopts the following technical solution:

[0021] The use of the above-mentioned reagent for LAMP visualization detection of PRRSV in the preparation of a kit for LAMP visualization detection of PRRSV.

[0022] The third aspect of the present invention adopts the following technical solution:

[0023] A kit for LAMP visualization detection of PRRSV comprises the above-mentioned reagent for LAMP visualization detection of PRRSV.

[0024] The above technical solution of the present invention has the following beneficial effects:

[0025] The present invention uses LAMP technology to successfully establish a rapid, simple, and visual detection reagent, kit, and detection method for PRRSV pathogens. The LAMP visual detection reagent and kit provided by the present invention not only have a high sensitivity (1.64×10 3 It has high detection rate, high specificity (100%), and has shorter detection time (40 minutes to get the result), more convenient operation and lower cost than RT-PCR. It can greatly improve the detection efficiency, save costs, and is easier to promote to large, medium and small farms to realize on-site detection of PRRSV.

[0026] Therefore, the present invention can provide a new solution strategy for realizing the normalized monitoring of PRRSV, and can also provide practical guidance for timely discovering the infection of PRRSV, guiding the formulation of intervention measures and the overall prevention and control of PRRSV. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The amplification result of the RT-PCR method in the first test example of the present invention;

[0028] Figure 2 The amplification result of the RT-LAMP method in Experimental Example 1 of the present invention;

[0029] Figure 3 This is the primer volume optimization result of the outer primer F3 / B3 in the RT-LAMP method in Experimental Example 1 of the present invention;

[0030] Figure 4 The primer volume optimization result of the inner primer FIP / BIP in the RT-LAMP method in Experimental Example 1 of the present invention;

[0031] Figure 5 This is the primer volume optimization result of the loop primer LF / LB in the RT-LAMP method in Experimental Example 1 of the present invention;

[0032] Figure 6 In the first test example of the present invention, in the RT-LAMP method, MgSO 4 Volume optimization results of

[0033] Figure 7 This is the volume optimization result of dNTP in the RT-LAMP method in Experimental Example 1 of the present invention;

[0034] Figure 8 This is the optimization result of the reaction temperature in the RT-LAMP method in Experimental Example 1 of the present invention;

[0035] Fig. 9 This is the optimization result of the reaction time in the RT-LAMP method in Experimental Example 1 of the present invention;

[0036] Fig.10 This is the visualization comparison result of different types of dyes in the RT-LAMP method in Experimental Example 1 of the present invention;

[0037] Fig.11 The results of the specificity test of the RT-LAMP method evaluated by gel electrophoresis in Experimental Example 2 of the present invention;

[0038] Fig.12 This is the visualized specificity test result of the RT-LAMP method in Test Example 2 of the present invention;

[0039] Fig.13 This is the specific identification result of RT-PCR control in Experimental Example 2 of the present invention;

[0040] Fig.14 The results of the sensitivity test of the RT-LAMP method evaluated by gel electrophoresis in Experimental Example 3 of the present invention;

[0041] Fig.15 This is the visualization sensitivity test result of the RT-LAMP method in Experimental Example 3 of the present invention;

[0042] Fig.16 This is the sensitivity identification result of RT-PCR control in Experimental Example 3 of the present invention;

[0043] Fig.17 This is the stability test result of the RT-LAMP method in Test Example 4 of the present invention. DETAILED DESCRIPTION

[0044] The technical scheme and technical effects of the present invention will be clearly and completely described below in conjunction with specific embodiments and drawings. However, it should be understood by those skilled in the art that the embodiments are only used to illustrate the technical scheme of the present invention and should not be regarded as limiting the scope of protection of the present invention. The test methods used in the following examples are conventional methods unless otherwise specified; the raw materials used are all commonly used in the art, available to the public or commercially available, unless otherwise specified.

[0045] Among them, in the following embodiments, PRRSV, PCV (porcine circovirus), PRV (pseudorabies virus), CSFV (classical swine fever virus), ASFV (African swine fever virus), etc. are all common viruses reported in the prior art, and their corresponding genomic DNA / RNA are extracted from the corresponding strains in the present invention. PRRSV recombinant plasmid standards are constructed and preserved by the present invention using conventional plasmid construction methods. Bst 3.0DNA Polymerase was purchased from New England Biolabs (NEB). DNA Marker and dNTP Mix were purchased from Novazon. Calcein (Cat. No. G1217) and SYBR Green I nucleic acid dye (Cat. No. SY1020) are from Beijing Solebow Technology Co., Ltd.

[0046] Example 1

[0047] This embodiment provides a reagent for LAMP visual detection of PRRSV, including outer primers F3 and B3, inner primers FIP and BIP, and loop primers LF and LB;

[0048] Among them, the nucleotide sequence of the external primer F3 is shown as SEQ ID NO.1; the nucleotide sequence of the external primer B3 is shown as SEQ ID NO.2; the nucleotide sequence of the internal primer FIP is shown as SEQ ID NO.3; the nucleotide sequence of the internal primer BIP is shown as SEQ ID NO.4; the nucleotide sequence of the loop primer LF is shown as SEQ ID NO.5; and the nucleotide sequence of the loop primer LB is shown as SEQ ID NO.6.

[0049] Specifically, the nucleotide sequence of the outer primer F3 is: 5′-gctgggtaagatcatcgcc-3′ (SEQ ID NO. 1);

[0050] The nucleotide sequence of the outer primer B3 is: 5′-gccctgattgaaggcagt-3′ (SEQ ID NO. 2);

[0051] The nucleotide sequence of the internal primer FIP is: 5′-tggggcttctccgggtttttccaaaaccagtccagaggca-3′ (SEQ ID NO. 3);

[0052] The nucleotide sequence of the internal primer BIP is: 5′-cgactgaagatgacgtcaggcaggatcgacgacagacacaat-3′ (SEQ ID NO. 4);

[0053] The nucleotide sequence of the loop primer LF is: 5′-tttttcttccccggtccct-3′ (SEQ ID NO. 5);

[0054] The nucleotide sequence of the loop primer LB is: 5′-tcactttacccctagtgagcg-3′ (SEQ ID NO. 6).

[0055] Furthermore, the reagent also includes PRRSV cDNA template, DNA polymerase, 10×Thermopol buffer, magnesium sulfate, dNTP Mix, nuclease-free water, and visualization dye, wherein the DNA polymerase is Bst 3.0 DNA polymerase, and the visualization dye is SYBR Green I nucleic acid dye.

[0056] Furthermore, when the reagent is used for LAMP visual detection of PRRSV, the detection process includes the following steps: extracting genomic DNA of the object to be detected, performing loop-mediated isothermal amplification using the reagent for LAMP visual detection of PRRSV, adding a visual dye after amplification, observing the turbidity change results, and determining whether PRRSV is infected. The object to be detected is a clinical sample of pig serum.

[0057] When the above reagents are used for LAMP visualization detection of PRRSV, the reaction system used includes the following components and dosages: 1 μL of 8000U / mL DNA polymerase, 2.5 μL of 10×Thermopol buffer, 1.5 μL of 100mmol / L magnesium sulfate, 2 μL of 10mmol / L dNTP Mix, 0.25 μL of 10μmol / L outer primer F3 and 10μmol / L outer primer B3, 4 μL of 10μmol / L inner primer FIP and 10μmol / L inner primer BIP, 1.5 μL of 10μmol / L loop primer LF and 10μmol / L loop primer LB, 3 μL of PRRSV cDNA template, and nuclease-free water is added to 25 μL. The reaction temperature of loop-mediated isothermal amplification is 61°C and the reaction time is 40 min.

[0058] Example 2

[0059] This example provides the use of the reagent for LAMP visualization detection of PRRSV in Example 1 in the preparation of a kit for LAMP visualization detection of PRRSV.

[0060] Example 3

[0061] This embodiment provides a kit for LAMP visualization detection of PRRSV, comprising the reagent for LAMP visualization detection of PRRSV of Example 1.

[0062] The following describes the kit for LAMP visualization detection of PRRSV and the establishment process and application effect of the detection method of the present invention in combination with test examples.

[0063] Experimental Example 1: Primer Design and Reaction System Establishment

[0064] 1.1. Design and synthesis of LAMP-specific primers based on PRRSV ORF7 gene

[0065] When selecting the target sequence, since PRRSV is very easy to mutate, the gene sequences of different strains are prone to mutation. In order to ensure the specificity of the method of the present invention, the present invention particularly selects the target sequence when designing the LAMP primer. Specifically, according to the ORF7 gene sequences of multiple strains such as HP-PRRSV, HeN-3, VR2332, NADC30-like, and NADC34 in the GenBank database of NCBI, the homology of the ORF7 gene is analyzed, and through multi-faceted comparison analysis and verification, a region with the highest conservation of the gene sequence is particularly selected as the target gene sequence (the nucleotide sequence is shown in SEQ ID NO.7).

[0066] The length of the nucleotide sequence shown in SEQ ID NO.7 is 372 bp, and its specific nucleotide sequence is: atgccaaataacaacggcaagcaaaagaaaaagaaggggaatggccagccagtcaatcagctgtgccaaatgctgggtaagatcatcgcccaacaaaaccagtccagaggcaagggaccggggaagaaaaataggaagaaaaacccggagaagccccatttccctctagcgactgaagatgacgtcaggcatcactttacccctagtgagcggcaattgtgtctgtcgtcgatccagactgccttcaatcagggcgctggaacttgtgccctgtcagattcagggaggataagttacactgtggagtttagtttgccgacgcaacatactgtgcgtctgatccgcgccacagcttcaccctcagcatga.

[0067] Based on the target gene sequence selected above (nucleotide sequence as shown in SEQ ID NO.7), 6 primers were preliminarily designed, and then the best primer combination was manually screened according to multiple requirements such as the TM value of each primer, the level of ΔG of each primer, the GC content, the distance between primers, and the prevention of secondary structure, combined with verification experiments.

[0068] Furthermore, the best primers screened by the present invention include two outer primers (F3, B3), two inner primers (FIP, BIP) and two loop primers (LF, LB), and the primers are synthesized by Qingke Biotechnology Co., Ltd. Among them, the nucleotide sequences of primers F3, B3, FIP, BIP, LF, and LB are shown in SEQ ID NO.1 to SEQ ID NO.6, and the specific sequences are shown in Table 1.

[0069] Table 1. RT-LAMP primer sequences of PRRSV ORF7

[0070] Primer name Primer sequence (5′-3′) Fragment length (bp) F3 gctgggtaagatcatcgcc 19 B3 gccctgattgaaggcagt 18 FIP tggggcttctccgggtttttccaaaaccagtccagaggca 40 BIP cgactgaagatgacgtcaggcaggatcgacgacagacacaat 42 LF tttttcttccccggtccct 19 LB tcactttacccctagtgagcg 21

[0071] 1.2. Design and synthesis of PRRSV RT-PCR primers and RT-PCR identification in validation experiments

[0072] According to the ORF7 gene sequence of porcine reproductive and respiratory syndrome virus Hn07-1 strain with accession number KX766378 included in the GenBank database of NCBI, specific primers (F and R) for PCR were designed, and the primers were synthesized by Qingke Biotechnology Co., Ltd. Among them, the nucleotide sequences of primer F and primer R are shown in SEQ ID NO.8 and SEQ ID NO.9 respectively, and the specific sequences are shown in Table 2.

[0073] Table 2. RT-PCR primer sequences of PRRSV ORF7

[0074]

[0075] The stored cDNA of PRRSV Hn07-1 was used as a template and the designed RT-PCR primers (Table 2) were used for RT-PCR identification. The reaction process was: 95°C for 3 min, 95°C for 30 s, 55°C for 30 s, 72°C for 15 s, and extension at 72°C for 5 min to compare and verify the reliability of the established RT-LAMP.

[0076] 1.3. Reaction system establishment and condition optimization

[0077] ① Establishment of RT-LAMP reaction system

[0078] When setting up the RT-LAMP reaction system, the initial LAMP reaction system was 25 μL, including: 1 μL DNA polymerase (Bst3.0 DNA Polymerase, 8000 U / mL), 2.5 μL 10×Thermopol Buffer, MgSO 4(100mmol / L) 1.5μL, nucleotide premix (dNTP Mix, 10mmol / L) 3.5μL, inner primers FIP (10μmol / L) and BIP (10μmol / L) 4μL, outer primers F3 (10μmol / L) and B3 (10μmol / L) 0.5μL, loop primers LF (10μmol / L) and LB loop primers (10μmol / L) 2μL, PRRSV Hn07-1 cDNA as template 3μL, nuclease-free water to 25μL. The reaction program is 60℃, 60min.

[0079] In the above experiment, in order to determine that the RT-LAMP method can detect PRRSV, the present invention uses the above RT-LAMP and RT-PCR methods to simultaneously amplify PRRSV nucleic acid. The RT-PCR amplification results are shown in FIG. Figure 1 The RT-LAMP amplification results are shown in Figure 2 shown. Figure 1 and 2 Middle, M: DL1000 DNA Marker; 1: negative control; 2: PRRSV.

[0080] like Figure 1 The RT-PCR results showed that the negative control had no amplified product, while the positive control had an amplified product of the expected size, indicating that the template was PRRSV positive.

[0081] like Figure 2 The RT-LAMP results showed that the negative control had no amplification product, and the positive control showed a correct amplification reaction ladder band, indicating that the primers designed by the present invention can be used for PRRSV detection.

[0082] ② Reaction system optimization

[0083] The basic amplification system of LAMP generally consists of Bst 3.0 DNA Polymerase, 10× Thermopol Buffer, dNTP Mix, MgSO 4 The present invention optimizes the volume of the outer primer F3 / B3 (10 μmol / L) (0.25, 0.5, 0.75 μL), the volume of the inner primer FIP / BIP (10 μmol / L) (3, 3.5, 4 μL), the volume of the loop primer LF / LB (10 μmol / L) (1.5, 2, 2.5 μL), the volume of the dNTP Mix (10 mmol / L) (2.0, 2.4, 2.8 μL), and the volume of the MgSO 4 (100mmol / L) volumes (1.5, 1, 0.5μL) to obtain the optimal reaction system.

[0084] In this experiment, the initial system of RT-LAMP reaction was used to adjust the volume of outer primer F3 / B3 (10 μmol / L) (0.25, 0.5, 0.75 μL), inner primer FIP / BIP (10 μmol / L) (3, 3.5, 4 μL), loop primer LF / LB (10 μmol / L) (1.5, 2, 2.5 μL), dNTP (10 mmol / L) (2.0, 2.4, 2.8 μL), MgSO 4 (100mmol / L) volume (1.5, 1, 0.5μL) was optimized, and the optimization results are as follows Figures 3 to 7 As shown. Among them, Figure 3 In the figure, M: DL5000 DNA Marker; 1: negative control; 2: 0.75 μL; 3: 0.5 μL; 4: 0.25 μL. Figure 4 In the figure, M: DL5000 DNA Marker; 1: negative control; 2: 3 μL; 3: 3.5 μL; 4: 4 μL. Figure 5 In the figure, M: DL2000 DNA Marker; 1: negative control; 2: 1.5 μL; 3: 2 μL; 4: 2.5 μL. Figure 6 Middle, M: DL2000 DNA Marker; 1: 2.0 μL; 2: 2.4 μL; 3: 2.8 μL; 4: negative control. Figure 7 Middle, M: DL2000 DNAMarker; 1: 1.5 μL; 2: 1 μL; 3: 0.5 μL; 4: negative control.

[0085] Figures 3 to 7 The results showed that the optimal LAMP reaction system was: the volume of the outer primer F3 / B3 (10 μmol / L) was 0.25 μL (such as Figure 3 As shown), the volume of the inner primer FIP / BIP (10 μmol / L) was 4 μL (as shown Figure 4 As shown), the volume of loop primer LF / LB (10 μmol / L) was 1.5 μL (as shown Figure 5 As shown), dNTP (10mmol / L) volume is 2.0μL (as shown Figure 6 As shown), MgSO 4 (100mmol / L) volume is 1.5μL (such as Figure 7 shown).

[0086] ③ Optimization of reaction conditions

[0087] Using the optimized best reaction system, the reaction temperatures were set to 61, 63, 65 and 67°C for screening; the reaction times were set to 10, 20, 30, 40, 50 and 60 min for screening to obtain the best reaction conditions.

[0088] In the optimized reaction system, other conditions in the LAMP standard reaction system were kept unchanged, and the reaction temperature was 61, 63, 65, and 67 ° C for 60 min. The results are as follows Figure 8 shown. Figure 8 In the figure, M: DL5000 DNA Marker; 1: negative control; 2: 61℃; 3: 63℃; 4: 65℃; 5: 67℃. Figure 8 The results showed that the optimal reaction temperature was 61°C.

[0089] In the optimized reaction system, other conditions in the LAMP standard reaction system were kept unchanged, and the reaction was carried out at the optimal reaction temperature for 10, 20, 30, 40, 50, and 60 min, respectively. The results are as follows Fig. 9 shown. Fig. 9 In the figure, M: DL2000 DNA Marker; 1: negative control; 2: 10 min; 3: 20 min; 4: 30 min; 5: 40 min; 6: 50 min; 7: 60 min. Fig. 9 The results showed that the optimal reaction time was 40 minutes.

[0090] ④ Screening of visualization dyes

[0091] The optimized optimal reaction system and reaction time were used. After the reaction, visualization dyes SYBR Green I and calcein were added to the reaction tubes respectively. The color changes of the reaction tubes were observed, and the optimal visualization dye was screened to obtain the visualization dye most suitable for naked eye observation. The results are shown in Fig.10 shown. Fig.10 In the figure, 1: turbidity negative control; 2: turbidity positive control; 3: negative control with calcein added; 4: positive control with calcein added; 5: negative control with SYBR Green I added; 6: positive control with SYBR Green I added.

[0092] Fig.10The turbidity comparison results show that the turbidity change of the reaction system is not obvious after the reaction by naked eye observation (as shown in Figure A). After the reaction, calcein is added to the reaction tube at an amount of 1 / 100 of the total volume of the LAMP reaction system, and the color change of the reaction tube is observed. The negative is light orange and the positive is light green (as shown in Figure B). After the reaction, 1-2μL of SYBR Green I (the stock solution is diluted 1:2000 as the working solution) is added to the reaction tube, and the color change of the reaction tube is observed. The negative is orange-red and the positive is yellow-green (as shown in Figure C). Since the color change of calcein is not as obvious as that of SYBR Green I when observed with the naked eye, SYBRGreen I was finally selected as the visualization dye.

[0093] Test Example 2: Specificity test of RT-LAMP

[0094] The viral genomic DNA or RNA of PRRSV, PRV, PCV2, PEDV, and CSFV were extracted respectively, and after reverse transcription of RNA into cDNA, the DNA or DNA of each virus was added to the established LAMP reaction system, and the optimal reaction conditions and dyes obtained by the above screening were selected for LAMP amplification. At the same time, RT-PCR control identification of 5 viruses, PRRSV, PRV, PCV2, PEDV, and CSFV, was established to analyze the specificity of the established RT-LAMP method for PRRSV.

[0095] Specifically, this experiment adds DNA / cDNA of PRRSV, PRV, PCV2, PEDV, and CSFV to the established LAMP reaction system, and selects the best reaction conditions and dyes for LAMP amplification. Take 10 μL of the amplified product for agarose gel electrophoresis detection. The results are as follows: Fig.11 shown. Fig.11 In the figure, M: DL2000 DNA Marker; 1: PRRSV; 2: PCV; 3: PRV; 4: CSFV; 5: ASFV; 6: negative control. Fig.11 The results showed that except for the PRRSV sample which had obvious ladder-shaped bands, the other samples had no bands, and the specificity was 100%, which proved that the detection reagent of the present invention had a better specificity.

[0096] Furthermore, SYBR Green I nucleic acid dye was added to the reaction tubes, and the color development results were as follows: Fig.12 shown. Fig.12 In the table, 1: PRRSV; 2: PCV; 3: PRV; 4: CSFV; 5: ASFV; 6: negative control. Fig.12 It was observed that the PRRSV reaction tube showed obvious yellow-green color, and the others showed orange-red color, indicating that the detection reagent of the present invention has an intuitive color development result.

[0097] Furthermore, the RT-PCR identification results were as follows Fig.13 shown. Fig.13 In the figure, M: DL1000 DNA Marker; 1: negative control; 2: PRRSV; 3: PCV; 4: PRV; 5: CSFV; 6: ASFV. Fig.13 It can be seen that each virus has the expected specific band, proving that all five viruses are positive.

[0098] Based on the above results, it can be shown that the RT-LAMP method established in the present invention has good specificity.

[0099] Test Example 3: RT-LAMP sensitivity test

[0100] The concentration of the recombinant plasmid standard was measured by a micro-spectrophotometer, and the relationship between mass concentration and copy number concentration was calculated according to the copy number calculation formula. 1 ~10 10 dilution (i.e. 1.64×10 10 ~1.64×10 1 The diluted recombinant plasmid was used as a template and amplified by the LAMP method and the fluorescence quantitative PCR method under the optimal conditions of Example 2 of the present invention, respectively. According to the final observed results, the minimum detection limit of the LAMP method established this time was determined, and compared with the amplification results of the fluorescence quantitative PCR method, the sensitivity of the LAMP detection method was comprehensively evaluated.

[0101] Among them, the results of the RT-LAMP sensitivity test detected by gel electrophoresis are as follows Fig.14 The results of the visual sensitivity test after dye development are shown in Fig.15 The results of RT-PCR sensitivity test are shown in Fig.16 shown. Fig.14 Middle, M: DL2000 DNA Marker; 1: negative control; 2-11: 1.64×10 10 ~1.64×10 1 copies / μL. Fig.15 In, 1: negative control; 2-11: 1.64×10 10 ~1.64×10 1 copies / μL. Fig.16 Medium, 1-7: 1.64×10 10 ~1.64×10 4 copies / μL.

[0102] Fig.14 The LAMP results showed that the recombinant plasmid standard product was 1.64×103 Ladder-shaped bands could still be detected at 1.5449 copies / μL. Fig.15 The color of the recombinant plasmid standard reaction tube turned yellow-green, and the detection limit of RT-LAMP was 1.64×10 3 copies / μL. Fig.16 The results of fluorescence quantitative PCR showed that the recombinant plasmid standard product was 1.64×10 4 It can be detected when the number of copies / μL is 1.58477 / μL. Therefore, the RT-LAMP detection method established by the present invention is one order of magnitude higher than that of RT-PCR, indicating that the RT-LAMP detection method of the present invention has good sensitivity.

[0103] Test Example 4: Stability Test of RT-LAMP

[0104] The recombinant plasmid standards with different dilutions were used as templates. Each sample was repeated 3 times and tested in a constant temperature water bath and fluorescence quantitative PCR using the established LAMP method. The standard deviation and coefficient of variation were calculated based on the Ct value read by the fluorescence quantitative PCR instrument. Intra-batch and inter-batch repeat tests were performed, and the repeatability of the LAMP method was comprehensively evaluated based on the results observed with the naked eye.

[0105] Specifically, 10 －3 , 10 －4 , 10 －5 (i.e. 1.64×10 8 , 1.64×10 7 , 1.64×10 6 The recombinant plasmid standard of 1000 copies / μL was used as a template. Each sample was repeated 3 times. The established LAMP method was used to detect in a constant temperature water bath and in fluorescence quantitative PCR. The standard deviation and coefficient of variation (CV) were calculated according to the Ct value read by the fluorescence quantitative PCR instrument. Intra-batch and inter-batch repeated tests were performed, respectively. The results are shown in Table 3 and Fig.17 shown. Fig.17 Middle, M: DL5000 DNA Marker; 1: negative control; 2-4: 1.64×10 8 , 1.64×10 7 , 1.64×10 6 copies / μL.

[0106] Table 3. RT-PCR stability test

[0107]

[0108] Combined with Table 3 and Fig.17 The repeatability test results show that the LAMP method of the present invention can stably detect positive samples and has good stability.

[0109] Test Example 5: Testing of Clinical Samples

[0110] The collected 20 clinical pig sera were used as test samples, and the nucleic acid was extracted and tested using the established RT-LAMP method of the present invention. The results were compared with the fluorescence quantitative PCR test results to analyze the coincidence rate of the two test results. The results are shown in Table 4.

[0111] Table 4. RT-LAMP and RT-PCR methods for detecting clinical samples

[0112] Detection Methods Total number of samples Number of positive samples detected Compliance rate RT-LAMP 20 14 100％ RT-PCR 20 14 100％

[0113] The results in Table 4 show that the detection results of the RT-LAMP method established in the present invention are consistent with those of the fluorescence quantitative PCR method, with a coincidence rate of 100%, indicating that the established RT-LAMP detection method can be effectively used for clinical sample detection.

[0114] In summary, the reagent and kit for LAMP visual detection of PRRSV provided by the present invention not only have the sensitivity and specificity of RT-PCR when used for PRRSV detection, but also have a shorter detection time, more convenient operation, and lower cost than RT-PCR, which can greatly improve the detection efficiency, save costs, and be easier to promote to large, medium, and small farms to achieve on-site detection of PRRSV. Therefore, the present invention can provide a new solution strategy for realizing the normalized monitoring of PRRSV, and can also provide practical guidance significance for timely discovering the infection of PRRSV, guiding the formulation of intervention measures, and the overall prevention and control of PRRSV.

[0115] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A reagent for LAMP visual detection of PRRSV, characterized in that: The reagents include outer primers F3 and B3, inner primers FIP and BIP, loop primers LF and LB, and also include PRRSV cDNA template, DNA polymerase, magnesium sulfate, dNTP Mix and visualization dye; Among them, the nucleotide sequence of the external primer F3 is shown as SEQ ID NO.1; the nucleotide sequence of the external primer B3 is shown as SEQ ID NO.2; the nucleotide sequence of the internal primer FIP is shown as SEQ ID NO.3; the nucleotide sequence of the internal primer BIP is shown as SEQ ID NO.4; the nucleotide sequence of the loop primer LF is shown as SEQ ID NO.5; and the nucleotide sequence of the loop primer LB is shown as SEQ ID NO.

6.

2. The reagent for LAMP visual detection of PRRSV according to claim 1, characterized in that The reagents also include 10×Thermopol buffer and nuclease-free water.

3. The reagent for LAMP visual detection of PRRSV according to claim 1, characterized in that The DNA polymerase is Bst 3.0 DNA polymerase.

4. The reagent for LAMP visual detection of PRRSV according to claim 1, characterized in that The visualization dye is SYBR Green I.

5. The reagent for LAMP visual detection of PRRSV according to claim 1, characterized in that The reagent is used for LAMP visual detection of PRRSV, and the detection process includes the following steps: extracting genomic DNA of the sample to be tested, using the reagent for LAMP visual detection of PRRSV to construct a reaction system for loop-mediated isothermal amplification, adding a visual dye after the amplification is completed, observing the turbidity change result, and determining whether PRRSV is infected.

6. The reagent for LAMP visual detection of PRRSV according to claim 5, characterized in that: The reaction system includes the following components and dosages: 1 μL of 8000 U / mL DNA polymerase, 2.5 μL of 10×Thermopol buffer, 1.5 μL of 100 mmol / L magnesium sulfate, 2 μL of 10 mmol / L dNTP Mix, 0.25 μL of 10 μmol / L outer primer F3 and outer primer B3, 4 μL of 10 μmol / L inner primer FIP and inner primer BIP, 1.5 μL of 10 μmol / L loop primer LF and loop primer LB, 3 μL of PRRSV cDNA template, and nuclease-free water is added to 25 μL.

7. The reagent for LAMP visual detection of PRRSV according to claim 5, characterized in that: The reaction temperature of the loop-mediated isothermal amplification was 61° C., and the reaction time was 40 min.

8. The reagent for LAMP visual detection of PRRSV according to claim 5, characterized in that: The sample to be tested is a pig serum sample.

9. Use of the reagent for LAMP visualization detection of PRRSV as claimed in any one of claims 1 to 8 in the preparation of a kit for LAMP visualization detection of PRRSV.

10. A kit for LAMP visualization detection of PRRSV, characterized in that: The invention comprises the reagent for LAMP visualization detection of PRRSV as described in any one of claims 1 to 8.

Images